Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4433Btlr/Mmmh
Stock Number:
041147-MU
Citation ID:
RRID:MMRRC_041147-MU
Other Names:
R4433 (G1), C57BL/6J-MtgxR4433Btlr
Major Collection:

Strain Information

Nts
Name: neurotensin
Synonyms: neuromedin N, NT/N, NTS1, NMN-125, 5033428E16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67405
VEGA: 10
HGNC: HGNC:8038
Homologene: 4506
Nfib
Name: nuclear factor I/B
Synonyms: 6720429L07Rik, E030026I10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18028
HGNC: HGNC:7785
Homologene: 4087
Ap2m1
Name: adaptor-related protein complex 2, mu 1 subunit
Synonyms: clathrin-associated AP-2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11773
HGNC: HGNC:564
Homologene: 3000
Tcf7l1
Name: transcription factor 7 like 1 (T cell specific, HMG box)
Synonyms: Tcf3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21415
Homologene: 7563
Zfhx3
Name: zinc finger homeobox 3
Synonyms: WBP9, A230102L03Rik, Atbf1, Sci
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11906
HGNC: HGNC:777
Homologene: 21366
Hnrnpr
Name: heterogeneous nuclear ribonucleoprotein R
Synonyms: hnRNPR, 2610003J05Rik, Hnrpr, 2610528B01Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74326
HGNC: HGNC:5047
Homologene: 4251
Zgrf1
Name: zinc finger, GRF-type containing 1
Synonyms: 4930422G04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71643
Homologene: 34708
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 135,114,570 bp
  • G to C, chromosome 1 at 171,356,715 bp
  • T to A, chromosome 2 at 111,479,412 bp
  • A to G, chromosome 2 at 121,184,473 bp
  • A to G, chromosome 2 at 131,191,698 bp
  • C to A, chromosome 2 at 178,283,132 bp
  • A to G, chromosome 3 at 51,396,260 bp
  • G to A, chromosome 3 at 70,018,548 bp
  • G to A, chromosome 3 at 90,387,340 bp
  • T to C, chromosome 3 at 95,681,759 bp
  • A to G, chromosome 3 at 127,562,078 bp
  • G to T, chromosome 3 at 145,314,383 bp
  • A to G, chromosome 3 at 152,655,880 bp
  • C to T, chromosome 4 at 82,498,435 bp
  • A to G, chromosome 4 at 116,040,130 bp
  • C to T, chromosome 4 at 117,128,123 bp
  • T to A, chromosome 4 at 123,215,896 bp
  • A to G, chromosome 4 at 136,317,148 bp
  • T to C, chromosome 4 at 148,961,510 bp
  • A to C, chromosome 5 at 23,979,581 bp
  • T to C, chromosome 6 at 48,765,946 bp
  • C to G, chromosome 6 at 72,788,769 bp
  • G to A, chromosome 6 at 118,697,763 bp
  • A to G, chromosome 7 at 19,853,589 bp
  • G to A, chromosome 7 at 30,720,225 bp
  • T to A, chromosome 7 at 103,506,139 bp
  • A to G, chromosome 7 at 119,554,509 bp
  • A to G, chromosome 8 at 77,217,467 bp
  • G to A, chromosome 8 at 85,641,083 bp
  • G to A, chromosome 8 at 108,955,637 bp
  • A to G, chromosome 9 at 16,031,152 bp
  • T to C, chromosome 9 at 44,247,988 bp
  • T to A, chromosome 10 at 34,127,831 bp
  • G to A, chromosome 10 at 75,044,496 bp
  • CCC to CCCC, chromosome 10 at 81,178,768 bp
  • A to G, chromosome 10 at 102,485,027 bp
  • G to T, chromosome 11 at 52,261,615 bp
  • A to T, chromosome 11 at 55,309,640 bp
  • A to T, chromosome 11 at 73,425,711 bp
  • A to G, chromosome 11 at 73,602,886 bp
  • A to G, chromosome 12 at 8,499,533 bp
  • A to C, chromosome 13 at 64,778,853 bp
  • A to T, chromosome 16 at 20,368,187 bp
  • A to T, chromosome 16 at 20,543,384 bp
  • A to T, chromosome 16 at 29,282,024 bp
  • A to T, chromosome 16 at 45,599,466 bp
  • GCCACCACCACCACCACCACC to GCCACCACCACCACCACC, chromosome 16 at 65,839,521 bp
  • T to A, chromosome 17 at 38,418,956 bp
  • G to T, chromosome 17 at 71,899,241 bp
  • C to T, chromosome 17 at 83,221,141 bp
  • A to G, chromosome 18 at 37,475,512 bp
  • T to C, chromosome 18 at 37,681,251 bp
  • A to T, chromosome 19 at 38,767,301 bp
  • A to G, chromosome 19 at 41,121,348 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4433 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041147-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.