Strain Name:
Stock Number:
Citation ID:
Other Names:
R4433 (G1), C57BL/6J-MtgxR4433Btlr
Major Collection:

Gene Information

Name: neurotensin
Synonyms: neuromedin N, NT/N, NTS1, NMN-125, 5033428E16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 67405
VEGA: 10
Homologene: 4506
Name: nuclear factor I/B
Synonyms: 6720429L07Rik, E030026I10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18028
Homologene: 4087
Name: adaptor-related protein complex 2, mu 1 subunit
Synonyms: clathrin-associated AP-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 11773
Homologene: 3000
Name: transcription factor 7 like 1 (T cell specific, HMG box)
Synonyms: Tcf3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 21415
Homologene: 7563
Name: zinc finger homeobox 3
Synonyms: WBP9, A230102L03Rik, Atbf1, Sci
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 11906
Homologene: 21366
Name: heterogeneous nuclear ribonucleoprotein R
Synonyms: hnRNPR, 2610003J05Rik, Hnrpr, 2610528B01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 74326
Homologene: 4251
Name: zinc finger, GRF-type containing 1
Synonyms: 4930422G04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 71643
Homologene: 34708
Name: peroxisomal biogenesis factor 14
Synonyms: Pex14p
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 56273
Homologene: 37936
Name: eukaryotic translation elongation factor 2
Synonyms: Ef-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 13629
VEGA: 10
Homologene: 134867
Name: ATP-binding cassette, sub-family C (CFTR/MRP), member 5
Synonyms: Mrp5, Abcc5b, Abcc5a, 2900011L11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 27416
Homologene: 21164
Name: ATPase type 13A5
Synonyms: C630015F21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 268878
Homologene: 77451
Name: neuropilin (NRP) and tolloid (TLL)-like 2
Synonyms: 5530601C23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 74513
Homologene: 32387
Name: transcription factor 7, T cell specific
Synonyms: TCF-1, T-cell factor 1, Tcf1, T cell factor-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 21414
Homologene: 137220
Name: ATPase, H+/K+ exchanging, gastric, alpha polypeptide
Synonyms: H+K+-transporting alpha 1, H+/K+-ATPase alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11944
Homologene: 68081
Name: ras homolog family member B
Synonyms: Arhb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 11852
VEGA: 12
Homologene: 68377
Name: prefoldin 2
Synonyms: ESTM27, W48336
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18637
Homologene: 7887
Name: collagen, type XXIV, alpha 1
Synonyms: 5430404K19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 71355
Homologene: 65061
Name: calcium channel, voltage-dependent, L type, alpha 1C subunit
Synonyms: (alpha)1 subunit, Cchl1a1, Cav1.2, L-type Cav1.2, D930026N18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 12288
Homologene: 55484
Name: nuclear receptor subfamily 3, group C, member 2
Synonyms: aldosterone receptor, Mlr, MR, mineralocorticoid receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 110784
Homologene: 121495
Name: calcium homeostasis modulator family member 6
Synonyms: A630077B13Rik, Fam26f
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 215900
VEGA: 10
Homologene: 25235
Name: FAT atypical cadherin 2
Synonyms: LOC245827, mKIAA0811, Fath2, EMI2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 245827
Homologene: 1110
Name: solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms: LOC208169, spermNHE, Slc9a10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 208169
Homologene: 19505
Name: FAT atypical cadherin 3
Synonyms: LOC234973, LOC382129, D430038H04Rik, 9430076A06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 270120
Homologene: 82252
Name: phospholipase C, epsilon 1
Synonyms: 4933403A21Rik, PLCepsilon
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 74055
Homologene: 9478
Name: family with sequence similarity 126, member A
Synonyms: hyccin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 84652
Homologene: 57175
Name: NOL1/NOP2/Sun domain family, member 4
Synonyms: 2310010O12Rik, 2810405F18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 72181
Homologene: 12455
Name: otolin 1
Synonyms: LOC229389, Gm414
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229389
Homologene: 19018
Name: ADAMTS-like 4
Synonyms: Tsrc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229595
Homologene: 23141
Name: mitochondria localized glutamic acid rich protein
Synonyms: Osap, 4930583H14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 67749
Homologene: 49858
Name: tolloid-like 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 24087
VEGA: 19
Homologene: 56545
Name: anaplastic lymphoma kinase
Synonyms: Tcrz, CD246
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 11682
VEGA: 17
Homologene: 68387
Name: protocadherin beta 15
Synonyms: Pcdhb7, PcdhbO
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93886
Homologene: 32429
Name: contactin associated protein-like 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 238680
VEGA: 13
Homologene: 129602
Name: protein kinase domain containing, cytoplasmic
Synonyms: ESTM17, Vlk, MAd1, Adtk1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 106522
Homologene: 18932
Name: GTPase, IMAP family member 3
Synonyms: 2010110D23Rik, Ian4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 83408
Homologene: 41257
Name: acyl-CoA synthetase medium-chain family member 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233799
Homologene: 70404
Name: olfactory receptor family 1 subfamily E member 19
Synonyms: GA_x6K02T2P1NL-3586282-3585338, MOR135-2, Olfr378
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 259026
Homologene: 74110
Name: cell division cycle 25B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 12531
Homologene: 41451
Name: tubulin, gamma complex associated protein 4
Synonyms: 4932441P04Rik, D2Ertd435e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 51885
Homologene: 8690
Name: PDZ domain containing 3
Synonyms: sodium-phosphate cotransporter IIa C-terminal-associated protein 2, NaPi-Cap2, Pdzk2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 170761
Homologene: 11719
Name: solute carrier family 27 (fatty acid transporter), member 3
Synonyms: fatty acid transport protein 3, FATP3, Acsvl3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 26568
Homologene: 11529
Name: olfactory receptor family 1 subfamily E member 25
Synonyms: GA_x6K02T2P1NL-3773152-3774090, GA_x6K02T2P1NL-3739520-3740032, MOR135-5, Olfr386, Olfr384
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 193053
Homologene: 105206
Name: exocrine gland secreted peptide 36
Synonyms: Gm20408
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 100126765
Name: adenylate kinase 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229949
Homologene: 76103
Name: olfactory receptor family 51 subfamily AG member 1
Synonyms: GA_x6K02T2PBJ9-6221839-6220892, MOR9-2, Olfr610
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259085
Homologene: 17495
Name: vestigial like family member 3
Synonyms: 1700110N18Rik, Vito-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 73569
VEGA: 16
Homologene: 53442
Name: dynein light chain Tctex-type 4
Synonyms: 4833401D15Rik, Tctex1d4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242646
Homologene: 18398
Name: 5'-nucleotidase, cytosolic IA
Synonyms: Cn1a, LOC230718
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230718
Homologene: 57173
Name: protein tyrosine phosphatase, receptor type, V
Synonyms: mOST-PTP, Esp, OST-PTP, OST
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13924
Homologene: 7306
Name: phosphatase and actin regulator 3
Synonyms: scapinin, 1500003N10Rik, 4930415A02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 74189
Homologene: 14482
Name: CEA cell adhesion molecule 16
Synonyms: LOC330483
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 330483
Homologene: 19857
Name: olfactory receptor family 4 subfamily G member 7
Synonyms: GA_x6K02T2Q125-72530279-72531217, MOR245-9, Olfr1288
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258395
Homologene: 88360
Name: RAB36, member RAS oncogene family
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 76877
Homologene: 3610
Name: protocadherin gamma subfamily B, 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93699
Homologene: 81867
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 135,114,570 bp
  • G to C, chromosome 1 at 171,356,715 bp
  • T to A, chromosome 2 at 111,479,412 bp
  • A to G, chromosome 2 at 121,184,473 bp
  • A to G, chromosome 2 at 131,191,698 bp
  • C to A, chromosome 2 at 178,283,132 bp
  • A to G, chromosome 3 at 51,396,260 bp
  • G to A, chromosome 3 at 70,018,548 bp
  • G to A, chromosome 3 at 90,387,340 bp
  • T to C, chromosome 3 at 95,681,759 bp
  • A to G, chromosome 3 at 127,562,078 bp
  • G to T, chromosome 3 at 145,314,383 bp
  • A to G, chromosome 3 at 152,655,880 bp
  • C to T, chromosome 4 at 82,498,435 bp
  • A to G, chromosome 4 at 116,040,130 bp
  • C to T, chromosome 4 at 117,128,123 bp
  • T to A, chromosome 4 at 123,215,896 bp
  • A to G, chromosome 4 at 136,317,148 bp
  • T to C, chromosome 4 at 148,961,510 bp
  • A to C, chromosome 5 at 23,979,581 bp
  • T to C, chromosome 6 at 48,765,946 bp
  • C to G, chromosome 6 at 72,788,769 bp
  • G to A, chromosome 6 at 118,697,763 bp
  • A to G, chromosome 7 at 19,853,589 bp
  • G to A, chromosome 7 at 30,720,225 bp
  • T to A, chromosome 7 at 103,506,139 bp
  • A to G, chromosome 7 at 119,554,509 bp
  • A to G, chromosome 8 at 77,217,467 bp
  • G to A, chromosome 8 at 85,641,083 bp
  • G to A, chromosome 8 at 108,955,637 bp
  • A to G, chromosome 9 at 16,031,152 bp
  • T to C, chromosome 9 at 44,247,988 bp
  • T to A, chromosome 10 at 34,127,831 bp
  • G to A, chromosome 10 at 75,044,496 bp
  • CCC to CCCC, chromosome 10 at 81,178,768 bp
  • A to G, chromosome 10 at 102,485,027 bp
  • G to T, chromosome 11 at 52,261,615 bp
  • A to T, chromosome 11 at 55,309,640 bp
  • A to T, chromosome 11 at 73,425,711 bp
  • A to G, chromosome 11 at 73,602,886 bp
  • A to G, chromosome 12 at 8,499,533 bp
  • A to C, chromosome 13 at 64,778,853 bp
  • A to T, chromosome 16 at 20,368,187 bp
  • A to T, chromosome 16 at 20,543,384 bp
  • A to T, chromosome 16 at 29,282,024 bp
  • A to T, chromosome 16 at 45,599,466 bp
  • GCCACCACCACCACCACCACC to GCCACCACCACCACCACC, chromosome 16 at 65,839,521 bp
  • T to A, chromosome 17 at 38,418,956 bp
  • G to T, chromosome 17 at 71,899,241 bp
  • C to T, chromosome 17 at 83,221,141 bp
  • A to G, chromosome 18 at 37,475,512 bp
  • T to C, chromosome 18 at 37,681,251 bp
  • A to T, chromosome 19 at 38,767,301 bp
  • A to G, chromosome 19 at 41,121,348 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4433 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041147-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.