Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4082Btlr/Mmmh
Stock Number:
041624-MU
Citation ID:
RRID:MMRRC_041624-MU
Other Names:
R4082 (G1), C57BL/6J-MtgxR4082Btlr
Major Collection:

Strain Information

a
Name: nonagouti
Synonyms: agouti, As, agouti signal protein, ASP, Asip
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 50518
HGNC: HGNC:745
Homologene: 1264
Sufu
Name: SUFU negative regulator of hedgehog signaling
Synonyms: Su(Fu), 2810026F04Rik, b2b273Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 24069
Homologene: 9262
Fasl
Name: Fas ligand
Synonyms: Fas-L, CD178, APT1LG1, CD95L, Tnfsf6, Fasl
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14103
Homologene: 533
Pygb
Name: brain glycogen phosphorylase
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110078
HGNC: HGNC:9723
Homologene: 100930
Abca12
Name: ATP-binding cassette, sub-family A member 12
Synonyms: 4832428G11Rik, 4833417A11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74591
Homologene: 45441
Xrn1
Name: 5'-3' exoribonuclease 1
Synonyms: mXrn1, Dhm2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 24127
Homologene: 5894
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Paip1
Name: polyadenylate binding protein-interacting protein 1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218693
Homologene: 4709
Polk
Name: polymerase (DNA directed), kappa
Synonyms: Dinb1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 27015
VEGA: 13
HGNC: HGNC:9183
Homologene: 32140
Mrpl20
Name: mitochondrial ribosomal protein L20
Synonyms: 2610008D01Rik, 4930425I20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66448
Homologene: 9941
Smg1
Name: SMG1 nonsense mediated mRNA decay associated PI3K related kinase
Synonyms: C130002K18Rik, 5430435M13Rik, 2610207I05Rik, SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233789
Homologene: 56697
Ptpn6
Name: protein tyrosine phosphatase, non-receptor type 6
Synonyms: SHP-1, Ptp1C, hcp, Hcph
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15170
HGNC: HGNC:9658
Homologene: 56589
Ccdc80
Name: coiled-coil domain containing 80
Synonyms: Urb, Ssg1, 2610001E17Rik, DRO1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67896
Homologene: 12206
Polg
Name: polymerase (DNA directed), gamma
Synonyms: Pol gamma, polymerase gamma, mitochondrial DNA polymerase gamma, mitochondrial DNA polymerase-gamma, Polga
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18975
HGNC: HGNC:9179
Homologene: 2016
Adcy1
Name: adenylate cyclase 1
Synonyms: AC1, I-AC, D11Bwg1392e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432530
HGNC: HGNC:232
Homologene: 41419
Pms2
Name: PMS1 homolog2, mismatch repair system component
Synonyms: mismatch repair, DNA mismatch repair
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18861
HGNC: HGNC:9122
Homologene: 133560
Lmbr1
Name: limb region 1
Synonyms: 1110048D14Rik, C79130
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56873
Homologene: 49706
Gad1
Name: glutamate decarboxylase 1
Synonyms: GAD67, Gad-1, Z49976, EP10, GAD44, GAD25
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14415
HGNC: HGNC:4092
Homologene: 635
Grik4
Name: glutamate receptor, ionotropic, kainate 4
Synonyms: KA1, 6330551K01Rik, GluRgamma1, KA-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110637
HGNC: HGNC:4582
Homologene: 81829
Osbp
Name: oxysterol binding protein
Synonyms: 1110018F06Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 76303
VEGA: 19
HGNC: HGNC:8503
Homologene: 97668
Cars1
Name: cysteinyl-tRNA synthetase 1
Synonyms: CA3, Cars
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27267
HGNC: HGNC:1493
Homologene: 1328
Abt1
Name: activator of basal transcription 1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 30946
Homologene: 134288
Cdc123
Name: cell division cycle 123
Synonyms: G431001I09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 98828
Homologene: 4394
Zfhx2
Name: zinc finger homeobox 2
Synonyms: zfh-5
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239102
Homologene: 52657
Zp2
Name: zona pellucida glycoprotein 2
Synonyms: Zp-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22787
Homologene: 48194
Mir874
Name: microRNA 874
Synonyms: mmu-mir-874, Mirn874
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 100124491
VEGA: 13
Ret
Name: ret proto-oncogene
Synonyms: RET51, RET9, c-Ret
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19713
HGNC: HGNC:9967
Homologene: 7517
Cubn
Name: cubilin
Synonyms: D2Wsu88e, intrinsic factor-cobalamin receptor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 65969
HGNC: HGNC:2548
Homologene: 37434
Naip5
Name: NLR family, apoptosis inhibitory protein 5
Synonyms: Naip-rs3, Birc1e, Lgn1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17951
HGNC: HGNC:7634
Homologene: 113589
Spta1
Name: spectrin alpha, erythrocytic 1
Synonyms: Spna-1, erythroid, ihj, Spna1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20739
Homologene: 74460
Col6a3
Name: collagen, type VI, alpha 3
Synonyms: Col6a-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12835
HGNC: HGNC:2213
Homologene: 37917
Or13n4
Name: olfactory receptor family 13 subfamily N member 4
Synonyms: GA_x6K02T2PBJ9-9202245-9201289, MOR260-4, Olfr702
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258590
Homologene: 121512
Col14a1
Name: collagen, type XIV, alpha 1
Synonyms: 5730412L22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12818
HGNC: HGNC:2191
Homologene: 18741
Ralgds
Name: ral guanine nucleotide dissociation stimulator
Synonyms: RalGDS, Rgds, Gnds
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19730
HGNC: HGNC:9842
Homologene: 4562
Tulp4
Name: TUB like protein 4
Synonyms: 1110057P05Rik, 2210038L17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68842
Homologene: 32467
Flg2
Name: filaggrin family member 2
Synonyms: EG229574
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229574
Homologene: 134146
Prorp
Name: protein only RNase P catalytic subunit
Synonyms: 1110008L16Rik, Mrpp3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66132
Homologene: 45935
Sytl2
Name: synaptotagmin-like 2
Synonyms: Slp2-a, Slp2, Slp2-d, Slp2-c, Slp2-b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 83671
Homologene: 131343
Aass
Name: aminoadipate-semialdehyde synthase
Synonyms: LOR/SDH, Lorsdh
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 30956
Homologene: 4212
Crocc
Name: ciliary rootlet coiled-coil, rootletin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230872
Homologene: 16811
Pde3b
Name: phosphodiesterase 3B, cGMP-inhibited
Synonyms: 9830102A01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18576
HGNC: HGNC:8779
Homologene: 709
Akr1d1
Name: aldo-keto reductase family 1, member D1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 208665
HGNC: HGNC:388
Homologene: 55943
Aim2
Name: absent in melanoma 2
Synonyms: LOC383619, Ifi210
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 383619
HGNC: HGNC:357
Homologene: 83226
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 211468
Homologene: 14332
Vmn2r117
Name: vomeronasal 2, receptor 117
Synonyms: EG619788, V2Rp6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 619788
Homologene: 86604
Zfp955b
Name: zinc finger protein 955B
Synonyms: C430039G02Rik, A430003O12Rik, Gm4455
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100043468
VEGA: 17
Homologene: 104925
Vmn1r209
Name: vomeronasal 1 receptor 209
Synonyms: Gm11315
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 432736
Homologene: 110880
Stard13
Name: StAR related lipid transfer domain containing 13
Synonyms: GT650, DLC2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243362
Homologene: 64844
Or52u1
Name: olfactory receptor family 52 subfamily U member 1
Synonyms: GA_x6K02T2PBJ9-7215221-7216195, MOR38-2, Olfr654
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258377
Homologene: 90859
Tc2n
Name: tandem C2 domains, nuclear
Synonyms: 4933406D09Rik, Tac2-N, Mtac2d1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74413
Homologene: 12560
Tmcc1
Name: transmembrane and coiled coil domains 1
Synonyms: 3632431M01Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330401
Homologene: 8995
Adamtsl5
Name: ADAMTS-like 5
Synonyms: 2010109H09Rik, Thsd6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66548
Homologene: 19803
Gpd1l
Name: glycerol-3-phosphate dehydrogenase 1-like
Synonyms: 2210409H23Rik, D9Ertd660e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 333433
Homologene: 56097
Pou5f2
Name: POU domain class 5, transcription factor 2
Synonyms: 1700013G10Rik, Sprm1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 75507
Homologene: 83454
Or10ag2
Name: olfactory receptor family 10 subfamily AG member 2
Synonyms: GA_x6K02T2Q125-48917235-48918206, MOR264-17, Olfr1123
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258347
Homologene: 105187
Cyp2e1
Name: cytochrome P450, family 2, subfamily e, polypeptide 1
Synonyms: Cyp2e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13106
HGNC: HGNC:2631
Homologene: 68089
C8g
Name: complement component 8, gamma polypeptide
Synonyms: 1700013L23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69379
HGNC: HGNC:1354
Homologene: 505
Cwc25
Name: CWC25 spliceosome-associated protein
Synonyms: R75228, 1300013D05Rik, Ccdc49
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67480
Homologene: 135922
Vopp1
Name: vesicular, overexpressed in cancer, prosurvival protein 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232023
Homologene: 12772
Rspo2
Name: R-spondin 2
Synonyms: 2610028F08Rik, ftls
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239405
VEGA: 15
Homologene: 18235
Cldn11
Name: claudin 11
Synonyms: oligodendrocyte-specific protein, Otm, Osp
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18417
HGNC: HGNC:8514
Homologene: 4093
Tex11
Name: testis expressed gene 11
Synonyms: 4930565P14Rik
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 83558
Homologene: 49962
Mir7033
Name: microRNA 7033
Synonyms: mmu-mir-7033
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 102466217
VEGA: 5
Wdr54
Name: WD repeat domain 54
Synonyms: 1700030E05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 75659
Homologene: 11382
Gm15494
Name: predicted gene 15494
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Ccl22
Name: C-C motif chemokine ligand 22
Synonyms: ABCD-1, MDC, Scya22
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20299
Homologene: 7529
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 71,267,463 bp
  • G to A, chromosome 1 at 90,821,883 bp
  • C to T, chromosome 1 at 161,781,851 bp
  • T to C, chromosome 1 at 173,459,851 bp
  • A to G, chromosome 1 at 174,214,066 bp
  • G to A, chromosome 2 at 5,810,755 bp
  • A to G, chromosome 2 at 13,428,563 bp
  • T to C, chromosome 2 at 25,504,631 bp
  • C to T, chromosome 2 at 28,552,271 bp
  • T to A, chromosome 2 at 69,513,273 bp
  • T to C, chromosome 2 at 70,572,746 bp
  • T to A, chromosome 2 at 87,418,457 bp
  • G to A, chromosome 2 at 150,826,471 bp
  • T to C, chromosome 2 at 151,593,802 bp
  • A to T, chromosome 2 at 155,045,758 bp
  • A to T, chromosome 3 at 31,163,129 bp
  • A to C, chromosome 3 at 93,203,521 bp
  • T to C, chromosome 4 at 141,033,971 bp
  • A to T, chromosome 4 at 155,808,513 bp
  • T to C, chromosome 5 at 29,258,755 bp
  • T to C, chromosome 5 at 135,388,637 bp
  • A to G, chromosome 5 at 143,931,019 bp
  • C to A, chromosome 5 at 151,092,829 bp
  • A to T, chromosome 6 at 23,109,498 bp
  • G to A, chromosome 6 at 37,557,489 bp
  • A to T, chromosome 6 at 57,789,979 bp
  • C to A, chromosome 6 at 83,153,582 bp
  • T to A, chromosome 6 at 116,043,480 bp
  • T to C, chromosome 6 at 118,153,966 bp
  • T to C, chromosome 6 at 124,728,419 bp
  • T to A, chromosome 7 at 4,470,798 bp
  • C to A, chromosome 7 at 79,464,828 bp
  • T to A, chromosome 7 at 90,408,427 bp
  • T to A, chromosome 7 at 104,588,623 bp
  • T to C, chromosome 7 at 106,824,038 bp
  • T to C, chromosome 7 at 114,494,588 bp
  • T to A, chromosome 7 at 118,160,246 bp
  • T to C, chromosome 7 at 120,135,252 bp
  • T to C, chromosome 7 at 140,771,078 bp
  • C to T, chromosome 7 at 143,569,497 bp
  • A to G, chromosome 8 at 94,746,908 bp
  • G to T, chromosome 9 at 42,597,884 bp
  • A to G, chromosome 9 at 95,981,920 bp
  • A to T, chromosome 9 at 114,917,078 bp
  • G to A, chromosome 10 at 80,341,230 bp
  • A to C, chromosome 11 at 7,064,117 bp
  • A to G, chromosome 11 at 60,487,196 bp
  • G to T, chromosome 11 at 97,753,918 bp
  • G to T, chromosome 12 at 55,304,613 bp
  • T to C, chromosome 12 at 101,651,155 bp
  • A to C, chromosome 13 at 22,805,615 bp
  • T to C, chromosome 13 at 23,422,146 bp
  • C to T, chromosome 13 at 58,018,797 bp
  • T to C, chromosome 13 at 78,025,905 bp
  • G to T, chromosome 13 at 96,483,673 bp
  • A to T, chromosome 13 at 100,245,830 bp
  • G to A, chromosome 13 at 119,457,004 bp
  • T to C, chromosome 14 at 55,065,205 bp
  • A to C, chromosome 15 at 43,022,537 bp
  • T to C, chromosome 15 at 55,437,033 bp
  • T to C, chromosome 16 at 45,122,927 bp
  • C to T, chromosome 17 at 6,231,780 bp
  • C to T, chromosome 17 at 23,460,106 bp
  • T to A, chromosome 17 at 33,302,155 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • A to G, chromosome 19 at 11,978,666 bp
  • A to G, chromosome 19 at 46,425,102 bp
  • C to A, chromosome X at 100,933,415 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4082 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041624-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.