Strain Name:
Stock Number:
Citation ID:
Other Names:
R4082 (G1), C57BL/6J-MtgxR4082Btlr
Major Collection:

Gene Information

Name: nonagouti
Synonyms: agouti, As, agouti signal protein, ASP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 50518
Homologene: 1264
Name: SUFU negative regulator of hedgehog signaling
Synonyms: Su(Fu), 2810026F04Rik, b2b273Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 24069
Homologene: 9262
Name: Fas ligand (TNF superfamily, member 6)
Synonyms: Fas-L, CD178, APT1LG1, CD95L, Tnfsf6, Fasl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14103
Homologene: 533
Name: brain glycogen phosphorylase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 110078
Homologene: 100930
Name: ATP-binding cassette, sub-family A (ABC1), member 12
Synonyms: 4832428G11Rik, 4833417A11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 74591
Homologene: 45441
Name: 5'-3' exoribonuclease 1
Synonyms: mXrn1, Dhm2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 24127
Homologene: 5894
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14725
Homologene: 20952
Name: polyadenylate binding protein-interacting protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218693
Homologene: 4709
Name: polymerase (DNA directed), kappa
Synonyms: Dinb1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 27015
VEGA: 13
Homologene: 32140
Name: mitochondrial ribosomal protein L20
Synonyms: 2610008D01Rik, 4930425I20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 66448
Homologene: 9941
Name: SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)
Synonyms: C130002K18Rik, 5430435M13Rik, 2610207I05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233789
Homologene: 56697
Name: protein tyrosine phosphatase, non-receptor type 6
Synonyms: SHP-1, Ptp1C, hcp, Hcph
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 15170
Homologene: 56589
Name: coiled-coil domain containing 80
Synonyms: Urb, Ssg1, 2610001E17Rik, DRO1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 67896
Homologene: 12206
Name: polymerase (DNA directed), gamma
Synonyms: Pol gamma, polymerase gamma, mitochondrial DNA polymerase gamma, mitochondrial DNA polymerase-gamma, Polga
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18975
Homologene: 2016
Name: adenylate cyclase 1
Synonyms: AC1, I-AC, D11Bwg1392e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 432530
Homologene: 41419
Name: PMS1 homolog2, mismatch repair system component
Synonyms: mismatch repair, DNA mismatch repair
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 18861
Homologene: 133560
Name: limb region 1
Synonyms: 1110048D14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 56873
Homologene: 49706
Name: glutamate decarboxylase 1
Synonyms: GAD67, Gad-1, Z49976, EP10, GAD44, GAD25
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14415
Homologene: 635
Name: glutamate receptor, ionotropic, kainate 4
Synonyms: KA1, 6330551K01Rik, GluRgamma1, KA-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 110637
Homologene: 81829
Name: oxysterol binding protein
Synonyms: 1110018F06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 76303
VEGA: 19
Homologene: 97668
Name: cysteinyl-tRNA synthetase
Synonyms: CA3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 27267
Homologene: 1328
Name: activator of basal transcription 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 30946
Homologene: 134288
Name: cell division cycle 123
Synonyms: G431001I09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 98828
Homologene: 4394
Name: zinc finger homeobox 2
Synonyms: zfh-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 239102
Homologene: 52657
Name: zona pellucida glycoprotein 2
Synonyms: Zp-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 22787
Homologene: 48194
Name: microRNA 874
Synonyms: mmu-mir-874, Mirn874
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 100124491
VEGA: 13
Name: ret proto-oncogene
Synonyms: RET51, RET9, c-Ret
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 19713
Homologene: 7517
Name: myosin XV
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17910
Homologene: 56504
Name: cubilin (intrinsic factor-cobalamin receptor)
Synonyms: D2Wsu88e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 65969
Homologene: 37434
Name: NLR family, apoptosis inhibitory protein 5
Synonyms: Naip-rs3, Birc1e, Lgn1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17951
Homologene: 113589
Name: spectrin alpha, erythrocytic 1
Synonyms: Spna-1, erythroid, ihj, Spna1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20739
Homologene: 74460
Name: collagen, type VI, alpha 3
Synonyms: Col6a-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12835
Homologene: 37917
Name: olfactory receptor 702
Synonyms: GA_x6K02T2PBJ9-9202245-9201289, MOR260-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258590
Homologene: 121512
Name: collagen, type XIV, alpha 1
Synonyms: 5730412L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 12818
Homologene: 18741
Name: ral guanine nucleotide dissociation stimulator
Synonyms: RalGDS, Rgds, Gnds
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 19730
Homologene: 4562
Name: tubby like protein 4
Synonyms: 1110057P05Rik, 2210038L17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 68842
Homologene: 32467
Name: filaggrin family member 2
Synonyms: EG229574
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229574
Homologene: 134146
Name: protein only RNase P catalytic subunit
Synonyms: Mrpp3, 1110008L16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 66132
Homologene: 45935
Name: synaptotagmin-like 2
Synonyms: Slp2-a, Slp2, Slp2-d, Slp2-c, Slp2-b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 83671
Homologene: 131343
Name: aminoadipate-semialdehyde synthase
Synonyms: LOR/SDH, Lorsdh
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 30956
Homologene: 4212
Name: ciliary rootlet coiled-coil, rootletin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230872
Homologene: 16811
Name: phosphodiesterase 3B, cGMP-inhibited
Synonyms: 9830102A01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18576
Homologene: 709
Name: aldo-keto reductase family 1, member D1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 208665
Homologene: 55943
Name: absent in melanoma 2
Synonyms: LOC383619, Ifi210
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 383619
Homologene: 83226
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 211468
Homologene: 14332
Name: vomeronasal 2, receptor 117
Synonyms: EG619788, V2Rp6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 619788
Homologene: 86604
Name: zinc finger protein 955B
Synonyms: C430039G02Rik, A430003O12Rik, Gm4455
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 100043468
VEGA: 17
Homologene: 104925
Name: vomeronasal 1 receptor 209
Synonyms: Gm11315
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 432736
Homologene: 110880
Name: StAR-related lipid transfer (START) domain containing 13
Synonyms: GT650, DLC2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 243362
Homologene: 64844
Name: olfactory receptor 654
Synonyms: GA_x6K02T2PBJ9-7215221-7216195, MOR38-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258377
Homologene: 90859
Name: tandem C2 domains, nuclear
Synonyms: 4933406D09Rik, Tac2-N, Mtac2d1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 74413
Homologene: 12560
Name: transmembrane and coiled coil domains 1
Synonyms: 3632431M01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 330401
Homologene: 8995
Name: ADAMTS-like 5
Synonyms: 2010109H09Rik, Thsd6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 66548
Homologene: 19803
Name: glycerol-3-phosphate dehydrogenase 1-like
Synonyms: 2210409H23Rik, D9Ertd660e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 333433
Homologene: 56097
Name: syntaphilin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241727
Homologene: 8817
Name: POU domain class 5, transcription factor 2
Synonyms: 1700013G10Rik, Sprm1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 75507
Homologene: 83454
Name: olfactory receptor 1123
Synonyms: GA_x6K02T2Q125-48917235-48918206, MOR264-17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258347
Homologene: 105187
Name: cytochrome P450, family 2, subfamily e, polypeptide 1
Synonyms: Cyp2e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 13106
Homologene: 68089
Name: complement component 8, gamma polypeptide
Synonyms: 1700013L23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 69379
Homologene: 505
Name: CWC25 spliceosome-associated protein
Synonyms: R75228, 1300013D05Rik, Ccdc49
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 67480
Homologene: 135922
Name: vesicular, overexpressed in cancer, prosurvival protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232023
Homologene: 12772
Name: R-spondin 2
Synonyms: 2610028F08Rik, ftls
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 239405
VEGA: 15
Homologene: 18235
Name: claudin 11
Synonyms: oligodendrocyte-specific protein, Otm, Osp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 18417
Homologene: 4093
Name: testis expressed gene 11
Synonyms: 4930565P14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 83558
Homologene: 49962
Name: microRNA 7033
Synonyms: mmu-mir-7033
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 102466217
Name: WD repeat domain 54
Synonyms: 1700030E05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 75659
Homologene: 11382
Name: predicted gene 15494
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Name: chemokine (C-C motif) ligand 22
Synonyms: ABCD-1, MDC, Scya22
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 20299
Homologene: 7529
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 71,267,463 bp
  • G to A, chromosome 1 at 90,821,883 bp
  • C to T, chromosome 1 at 161,781,851 bp
  • T to C, chromosome 1 at 173,459,851 bp
  • A to G, chromosome 1 at 174,214,066 bp
  • G to A, chromosome 2 at 5,810,755 bp
  • A to G, chromosome 2 at 13,428,563 bp
  • T to C, chromosome 2 at 25,504,631 bp
  • C to T, chromosome 2 at 28,552,271 bp
  • T to A, chromosome 2 at 69,513,273 bp
  • T to C, chromosome 2 at 70,572,746 bp
  • T to A, chromosome 2 at 87,418,457 bp
  • G to A, chromosome 2 at 150,826,471 bp
  • T to C, chromosome 2 at 151,593,802 bp
  • A to T, chromosome 2 at 155,045,758 bp
  • A to T, chromosome 3 at 31,163,129 bp
  • A to C, chromosome 3 at 93,203,521 bp
  • T to C, chromosome 4 at 141,033,971 bp
  • A to T, chromosome 4 at 155,808,513 bp
  • T to C, chromosome 5 at 29,258,755 bp
  • T to C, chromosome 5 at 135,388,637 bp
  • A to G, chromosome 5 at 143,931,019 bp
  • C to A, chromosome 5 at 151,092,829 bp
  • A to T, chromosome 6 at 23,109,498 bp
  • G to A, chromosome 6 at 37,557,489 bp
  • A to T, chromosome 6 at 57,789,979 bp
  • C to A, chromosome 6 at 83,153,582 bp
  • T to A, chromosome 6 at 116,043,480 bp
  • T to C, chromosome 6 at 118,153,966 bp
  • T to C, chromosome 6 at 124,728,419 bp
  • T to A, chromosome 7 at 4,470,798 bp
  • C to A, chromosome 7 at 79,464,828 bp
  • T to A, chromosome 7 at 90,408,427 bp
  • T to A, chromosome 7 at 104,588,623 bp
  • T to C, chromosome 7 at 106,824,038 bp
  • T to C, chromosome 7 at 114,494,588 bp
  • T to A, chromosome 7 at 118,160,246 bp
  • T to C, chromosome 7 at 120,135,252 bp
  • T to C, chromosome 7 at 140,771,078 bp
  • C to T, chromosome 7 at 143,569,497 bp
  • A to G, chromosome 8 at 94,746,908 bp
  • G to T, chromosome 9 at 42,597,884 bp
  • A to G, chromosome 9 at 95,981,920 bp
  • A to T, chromosome 9 at 114,917,078 bp
  • G to A, chromosome 10 at 80,341,230 bp
  • A to C, chromosome 11 at 7,064,117 bp
  • A to G, chromosome 11 at 60,487,196 bp
  • G to T, chromosome 11 at 97,753,918 bp
  • G to T, chromosome 12 at 55,304,613 bp
  • T to C, chromosome 12 at 101,651,155 bp
  • A to C, chromosome 13 at 22,805,615 bp
  • T to C, chromosome 13 at 23,422,146 bp
  • C to T, chromosome 13 at 58,018,797 bp
  • T to C, chromosome 13 at 78,025,905 bp
  • G to T, chromosome 13 at 96,483,673 bp
  • A to T, chromosome 13 at 100,245,830 bp
  • G to A, chromosome 13 at 119,457,004 bp
  • T to C, chromosome 14 at 55,065,205 bp
  • A to C, chromosome 15 at 43,022,537 bp
  • T to C, chromosome 15 at 55,437,033 bp
  • T to C, chromosome 16 at 45,122,927 bp
  • C to T, chromosome 17 at 6,231,780 bp
  • C to T, chromosome 17 at 23,460,106 bp
  • T to A, chromosome 17 at 33,302,155 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • A to G, chromosome 19 at 11,978,666 bp
  • A to G, chromosome 19 at 46,425,102 bp
  • C to A, chromosome X at 100,933,415 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4082 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
041624-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.