Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4272Btlr/Mmmh
Stock Number:
041644-MU
Citation ID:
RRID:MMRRC_041644-MU
Other Names:
R4272 (G1), C57BL/6J-MtgxR4272Btlr
Major Collection:

Strain Information

Tnpo1
Name: transportin 1
Synonyms: D13Ertd688e, Kpnb2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238799
HGNC: HGNC:6401
Homologene: 5358
Efnb2
Name: ephrin B2
Synonyms: Epl5, NLERK-1, LERK-5, ELF-2, Htk-L, Eplg5, Lerk5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13642
HGNC: HGNC:3227
Homologene: 3019
Arl5b
Name: ADP-ribosylation factor-like 5B
Synonyms: 4930587A11Rik, Arl8
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75869
Homologene: 101695
Psmb2
Name: proteasome (prosome, macropain) subunit, beta type 2
Synonyms: HC7-I, D4Wsu33e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 26445
HGNC: HGNC:9539
Homologene: 2088
Ttc27
Name: tetratricopeptide repeat domain 27
Synonyms: 2610511O17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74196
VEGA: 17
Homologene: 41191
Chka
Name: choline kinase alpha
Synonyms: choline/ethanolamine kinase alpha, CK/EK-alpha, ChoK, EtnK-alpha, Chk
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12660
HGNC: HGNC:1937
Homologene: 88575
Ago3
Name: argonaute RISC catalytic subunit 3
Synonyms: argonaute 3, eIF2C3, C130014L07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 214150
Homologene: 49799
Lmtk2
Name: lemur tyrosine kinase 2
Synonyms: 2900041G10Rik, KPI-2, cprk, KPI2, A330101P12Rik, BREK, AATYK2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231876
Homologene: 8948
Arap2
Name: ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2
Synonyms: Centd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 212285
Homologene: 9064
Skp2
Name: S-phase kinase-associated protein 2
Synonyms: FBXL1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 27401
Homologene: 55942
Ezh1
Name: enhancer of zeste 1 polycomb repressive complex 2 subunit
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14055
HGNC: HGNC:3526
Homologene: 20458
Trhr
Name: thyrotropin releasing hormone receptor
Synonyms: TRH-R1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 22045
VEGA: 15
Homologene: 20707
Cnpy4
Name: canopy FGF signaling regulator 4
Synonyms: 2610019P18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66455
Homologene: 15196
Htt
Name: huntingtin
Synonyms: huntingtin, HD, htt, IT15, C430023I11Rik, Hdh
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15194
HGNC: HGNC:4851
Homologene: 1593
Hspg2
Name: perlecan (heparan sulfate proteoglycan 2)
Synonyms: per, Pcn, Plc, perlecan
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15530
HGNC: HGNC:5273
Homologene: 68473
Dync1li2
Name: dynein, cytoplasmic 1 light intermediate chain 2
Synonyms: LIC2, Dncli2, Dnclic2, Dlic2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234663
HGNC: HGNC:2966
Homologene: 4474
Riok3
Name: RIO kinase 3
Synonyms: 1200013N13Rik, Sudd, D18Ertd331e, E130306C24Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 66878
VEGA: 18
Homologene: 2843
Mphosph9
Name: M-phase phosphoprotein 9
Synonyms: 4930548D04Rik, MPP-9, MPP9, B930097C17Rik, 9630025B04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269702
HGNC: HGNC:7215
Homologene: 11256
Mctp2
Name: multiple C2 domains, transmembrane 2
Synonyms: LOC244049
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244049
Homologene: 69254
Trpm2
Name: transient receptor potential cation channel, subfamily M, member 2
Synonyms: Trrp7, LTRPC2, TRPC7, 9830168K16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 28240
Homologene: 20709
Pdgfra
Name: platelet derived growth factor receptor, alpha polypeptide
Synonyms: CD140a, Pdgfr-2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18595
HGNC: HGNC:8803
Homologene: 31361
Gcgr
Name: glucagon receptor
Synonyms: GR
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14527
HGNC: HGNC:4192
Homologene: 131
Scn1a
Name: sodium channel, voltage-gated, type I, alpha
Synonyms: Nav1.1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20265
Homologene: 21375
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Crb1
Name: crumbs family member 1, photoreceptor morphogenesis associated
Synonyms: A930008G09Rik, 7530426H14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 170788
HGNC: HGNC:2343
Homologene: 8092
Rusc2
Name: RUN and SH3 domain containing 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100213
Homologene: 18967
Enpp4
Name: ectonucleotide pyrophosphatase/phosphodiesterase 4
Synonyms: LOC224794, 4933413N07Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224794
HGNC: HGNC:3359
Homologene: 28264
Rtcb
Name: RNA 2',3'-cyclic phosphate and 5'-OH ligase
Synonyms: HSPC117, D10Wsu52e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 28088
Homologene: 36344
Exoc3
Name: exocyst complex component 3
Synonyms: E430013E20Rik, Sec6l1, 2810050O03Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 211446
VEGA: 13
Homologene: 38296
Sycp2
Name: synaptonemal complex protein 2
Synonyms: 3830402K23Rik, 4930518F03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320558
Homologene: 8604
Htra1
Name: HtrA serine peptidase 1
Synonyms: insulin-like growth factor binding protein 5 protease, RSPP11, L56, HtrA1, Prss11
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56213
HGNC: HGNC:9476
Homologene: 31114
Dlec1
Name: deleted in lung and esophageal cancer 1
Synonyms: D630005C06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320256
HGNC: HGNC:2899
Homologene: 84733
Phykpl
Name: 5-phosphohydroxy-L-lysine phospholyase
Synonyms: 2900006B13Rik, Agxt2l2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72947
Homologene: 75268
Lrrc15
Name: leucine rich repeat containing 15
Synonyms: 5430427N11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74488
Homologene: 26080
Slc52a3
Name: solute carrier protein family 52, member 3
Synonyms: 2310046K01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69698
Homologene: 12324
Rgl1
Name: ral guanine nucleotide dissociation stimulator,-like 1
Synonyms: Rgl
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19731
Homologene: 9039
Zfp52
Name: zinc finger protein 52
Synonyms: zfec29, Zfp-52, KRAB11, Zfp76
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22710
VEGA: 17
Homologene: 77326
Npffr2
Name: neuropeptide FF receptor 2
Synonyms: NPFF2, Gpr74
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 104443
HGNC: HGNC:4525
Homologene: 56982
Rragd
Name: Ras-related GTP binding D
Synonyms: 5730543C08Rik, D4Ertd174e, C030003H22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 52187
Homologene: 49667
Dlgap1
Name: DLG associated protein 1
Synonyms: SAPAP1, DAP-1 beta, D17Bwg0511e, GKAP/SAPAP, Sapap1, 4933422O14Rik, Gkap
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224997
HGNC: HGNC:2905
Homologene: 31258
Adgrf2
Name: adhesion G protein-coupled receptor F2
Synonyms: PGR20, Gpr111
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 435529
Homologene: 45213
Ift70a1
Name: intraflagellar transport 70A1
Synonyms: 4930506L13Rik, Ttc30a1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78802
Homologene: 136638
Medag
Name: mesenteric estrogen dependent adipogenesis
Synonyms: MEDA-4, 6330406I15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70717
Homologene: 12364
Sall2
Name: spalt like transcription factor 2
Synonyms: Msal-2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 50524
Homologene: 9269
Disp1
Name: dispatched RND transporter family member 1
Synonyms: DispA, 1190008H24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68897
Homologene: 14133
Tas1r1
Name: taste receptor, type 1, member 1
Synonyms: TR1, T1r1, Gpr70, T1R1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 110326
Homologene: 12888
Capza3
Name: capping actin protein of muscle Z-line subunit alpha 3
Synonyms: Gsg3, Tex8, cp alpha3, Cappa3, 510-4, repro32
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12344
Homologene: 7253
Or4c117
Name: olfactory receptor family 4 subfamily C member 117
Synonyms: GA_x6K02T2Q125-50604368-50603433, MOR233-14, Olfr1222
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258177
Homologene: 73988
Gm4887
Name: predicted gene 4887
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233637
Homologene: 131294
Obox3-ps8
Name: oocyte specific homeobox 3, pseudogene 8
Synonyms: Gm4830
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224752
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 139,323,311 bp
  • A to T, chromosome 1 at 152,536,289 bp
  • T to A, chromosome 1 at 183,087,644 bp
  • A to G, chromosome 2 at 15,073,179 bp
  • T to C, chromosome 2 at 66,273,176 bp
  • A to G, chromosome 2 at 75,980,474 bp
  • C to A, chromosome 2 at 76,778,347 bp
  • A to G, chromosome 2 at 89,125,362 bp
  • T to A, chromosome 2 at 152,005,740 bp
  • A to T, chromosome 2 at 178,358,224 bp
  • T to C, chromosome 4 at 32,996,099 bp
  • T to A, chromosome 4 at 43,415,533 bp
  • T to A, chromosome 4 at 126,355,091 bp
  • T to C, chromosome 4 at 126,687,037 bp
  • C to T, chromosome 4 at 137,518,940 bp
  • T to C, chromosome 4 at 152,032,157 bp
  • G to A, chromosome 5 at 34,849,069 bp
  • T to C, chromosome 5 at 62,670,979 bp
  • G to A, chromosome 5 at 75,183,070 bp
  • G to A, chromosome 5 at 89,568,023 bp
  • G to A, chromosome 5 at 124,304,203 bp
  • G to T, chromosome 5 at 138,192,591 bp
  • A to G, chromosome 5 at 144,183,226 bp
  • A to G, chromosome 5 at 149,422,163 bp
  • A to G, chromosome 6 at 42,350,946 bp
  • A to G, chromosome 6 at 140,042,538 bp
  • A to G, chromosome 7 at 12,668,179 bp
  • A to T, chromosome 7 at 72,259,331 bp
  • G to T, chromosome 7 at 104,821,328 bp
  • C to T, chromosome 7 at 130,936,520 bp
  • T to A, chromosome 8 at 8,620,698 bp
  • A to G, chromosome 8 at 104,423,143 bp
  • C to T, chromosome 9 at 119,143,163 bp
  • A to T, chromosome 10 at 77,933,642 bp
  • A to T, chromosome 10 at 85,957,619 bp
  • T to C, chromosome 11 at 51,585,528 bp
  • A to G, chromosome 11 at 101,194,908 bp
  • T to A, chromosome 11 at 120,538,424 bp
  • A to G, chromosome 13 at 74,192,644 bp
  • GCACCTCTGCTTCCTC to GCACCTCTGCTTCCTCACCTCTGCTTCCTC, chromosome 13 at 98,867,129 bp
  • C to A, chromosome 14 at 52,313,803 bp
  • C to A, chromosome 15 at 9,116,860 bp
  • G to A, chromosome 15 at 44,197,224 bp
  • T to C, chromosome 16 at 30,273,855 bp
  • C to A, chromosome 17 at 21,560,197 bp
  • A to C, chromosome 17 at 36,453,017 bp
  • T to A, chromosome 17 at 42,710,122 bp
  • T to C, chromosome 17 at 44,101,807 bp
  • T to A, chromosome 17 at 70,766,043 bp
  • T to A, chromosome 17 at 74,840,360 bp
  • AGAAGCGG to AG, chromosome 18 at 12,135,941 bp
  • G to A, chromosome 19 at 3,875,737 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4272 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041644-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.