Strain Name:
C57BL/6J-MtgxR4627Btlr/Mmmh
Stock Number:
041892-MU
Citation ID:
RRID:MMRRC_041892-MU
Other Names:
R4627 (G1), C57BL/6J-MtgxR4627Btlr
Major Collection:

Strain Information

Nfat5
Name: nuclear factor of activated T cells 5
Synonyms: nfatz, B130038B15Rik, OREBP, TonEBP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 54446
HGNC: HGNC:7774
Homologene: 4811
Slc6a1
Name: solute carrier family 6 (neurotransmitter transporter, GABA), member 1
Synonyms: GAT-1, Gabt1, Gabt, XT-1, Gat1, Xtrp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232333
Homologene: 2290
Prdm16
Name: PR domain containing 16
Synonyms: Mel1, 5730557K01Rik, csp1, line 27
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 70673
Homologene: 11139
Prpf6
Name: pre-mRNA splicing factor 6
Synonyms: 1190003A07Rik, ANT-1, 2610031L17Rik, U5-102K
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 68879
Homologene: 5368
Atm
Name: ataxia telangiectasia mutated
Synonyms: C030026E19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 11920
HGNC: HGNC:795
Homologene: 30952
Aopep
Name: aminopeptidase O
Synonyms: 2010111I01Rik, ApO
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 72061
HGNC: HGNC:1361
Homologene: 66273
Sec23a
Name: SEC23 homolog A, COPII coat complex component
Synonyms: Msec23, Sec23r
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 20334
Homologene: 4642
Mmachc
Name: methylmalonic aciduria cblC type, with homocystinuria
Synonyms: 1810037K07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 67096
Homologene: 12082
Mast4
Name: microtubule associated serine/threonine kinase family member 4
Synonyms: 4930420O11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 328329
Homologene: 42094
Apbb2
Name: amyloid beta (A4) precursor protein-binding, family B, member 2
Synonyms: 2310007D03Rik, Zfra, FE65L1, TR2L, Rirl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 11787
HGNC: HGNC:582
Homologene: 32079
Chchd6
Name: coiled-coil-helix-coiled-coil-helix domain containing 6
Synonyms: 1700021B03Rik, 0710001P09Rik, Micos25
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 66098
Homologene: 11920
Sec16a
Name: SEC16 homolog A, endoplasmic reticulum export factor
Synonyms: C230052J16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227648
Homologene: 10533
Cobl
Name: cordon-bleu WH2 repeat
Synonyms: C530045F18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 12808
Homologene: 9058
Tom1l2
Name: target of myb1-like 2 (chicken)
Synonyms: myb1-like protein 2, A730055F12Rik, 2900016I08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216810
Homologene: 44901
Ptpn1
Name: protein tyrosine phosphatase, non-receptor type 1
Synonyms: PTP1B, PTP-1B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 19246
HGNC: HGNC:9642
Homologene: 2119
Orc5
Name: origin recognition complex, subunit 5
Synonyms: Orc5l, mouse origin recognition complex 5, MmORC5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 26429
HGNC: HGNC:8491
Homologene: 37636
Slc12a3
Name: solute carrier family 12, member 3
Synonyms: NCC, TSC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 20497
Homologene: 287
Hnf1a
Name: HNF1 homeobox A
Synonyms: HNF1[a], Tcf1, HNF1, Hnf-1, Hnf1alpha, hepatocyte nuclear factor 1, LFB1, HNF1-alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 21405
Homologene: 459
Tonsl
Name: tonsoku-like, DNA repair protein
Synonyms: 2810439M11Rik, Nfkbil2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 72749
HGNC: HGNC:7801
Homologene: 22754
Utp25
Name: UTP25 small subunit processome component
Synonyms: AA408296, Diexf
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 215193
Homologene: 6170
Dsp
Name: desmoplakin
Synonyms: 5730453H04Rik, DP, 2300002E22Rik, rul
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 109620
HGNC: HGNC:3052
Homologene: 37922
Cpsf2
Name: cleavage and polyadenylation specific factor 2
Synonyms: Cpsf, 100kDa, 2610024B04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 51786
VEGA: 12
HGNC: HGNC:2325
Homologene: 6460
Ube2c
Name: ubiquitin-conjugating enzyme E2C
Synonyms: D2Ertd695e, 1110015A16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 68612
Homologene: 5096
Hoxd10
Name: homeobox D10
Synonyms: Hox-5.3, Hox-4.5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 15430
HGNC: HGNC:5133
Homologene: 1619
Ap2a1
Name: adaptor-related protein complex 2, alpha 1 subunit
Synonyms: Adtaa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11771
HGNC: HGNC:561
Homologene: 68997
Mcm6
Name: minichromosome maintenance complex component 6
Synonyms: D1Wsu22e, Mcmd6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 17219
HGNC: HGNC:6949
Homologene: 4322
Mapk8ip3
Name: mitogen-activated protein kinase 8 interacting protein 3
Synonyms: JSAP1d, sunday driver 2, JNK-interacting protein 3, JUN/SAPK-associated protein 1, D17Wsu15e, Jip3, JSAP1b, Syd2, JSAP1a, JSAP1c, c-Jun NH2-terminal kinase (JNK)/stress-activated protein kinase-associated protein 1, JSAP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 30957
HGNC: HGNC:6884
Homologene: 22790
Lmbrd1
Name: LMBR1 domain containing 1
Synonyms: 0910001K20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 68421
Homologene: 10156
Klhl2
Name: kelch-like 2, Mayven
Synonyms: 6030411N21Rik, Mav, ABP-KELCH, 8530402H02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 77113
HGNC: HGNC:6353
Homologene: 21416
Tbk1
Name: TANK-binding kinase 1
Synonyms: 1200008B05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 56480
VEGA: 10
Homologene: 22742
Exoc1
Name: exocyst complex component 1
Synonyms: Sec3l1, A730011E05Rik, 2810407P21Rik, Sec3p, SEC3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 69940
Homologene: 41241
Dnmt3c
Name: DNA methyltransferase 3C
Synonyms: Dnmt3c-ps, Gm14490
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 668932
Skor1
Name: SKI family transcriptional corepressor 1
Synonyms: C230094B15Rik, Lbxcor1, Corl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 207667
Homologene: 18175
Ccdc184
Name: coiled-coil domain containing 184
Synonyms: AI836003
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 239650
VEGA: 15
Homologene: 18612
Rapgef3
Name: Rap guanine nucleotide exchange factor (GEF) 3
Synonyms: 9330170P05Rik, Epac1, 2310016P22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223864
Homologene: 21231
Cep192
Name: centrosomal protein 192
Synonyms: D430014P18Rik, 4631422C13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 70799
VEGA: 18
Homologene: 73526
Pde4b
Name: phosphodiesterase 4B, cAMP specific
Synonyms: Dpde4, dunce
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18578
HGNC: HGNC:8781
Homologene: 1953
Csdc2
Name: cold shock domain containing C2, RNA binding
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 105859
Homologene: 8701
Pex2
Name: peroxisomal biogenesis factor 2
Synonyms: Pxmp3, D3Ertd138e, PMP35, Zellweger syndrome homolog
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 19302
HGNC: HGNC:9717
Homologene: 269
Cfap46
Name: cilia and flagella associated protein 46
Synonyms: Ttc40, 9330101J02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 212124
Tamm41
Name: TAM41 mitochondrial translocator assembly and maintenance homolog
Synonyms: 1500001M20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 68971
Homologene: 13754
Nlrc4
Name: NLR family, CARD domain containing 4
Synonyms: Card12, 9530011P19Rik, Ipaf
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 268973
VEGA: 17
Homologene: 10924
Fbn1
Name: fibrillin 1
Synonyms: Fib-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14118
HGNC: HGNC:3603
Homologene: 30958
Ttn
Name: titin
Synonyms: L56, mdm, D830007G01Rik, 2310074I15Rik, shru, 2310036G12Rik, connectin, D330041I19Rik, 2310057K23Rik, 1100001C23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Hmcn1
Name: hemicentin 1
Synonyms: EG545370, LOC240793
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 545370
Homologene: 23741
Dnah2
Name: dynein, axonemal, heavy chain 2
Synonyms: Dnahc2, D330014H01Rik, 2900022L05Rik, Dnhd3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 327954
HGNC: HGNC:2948
Homologene: 72110
Kidins220
Name: kinase D-interacting substrate 220
Synonyms: 3110039L19Rik, C330002I19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 77480
VEGA: 12
Homologene: 14254
Gpn1
Name: GPN-loop GTPase 1
Synonyms: 2410004J02Rik, Xab1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 74254
Homologene: 5257
Pde10a
Name: phosphodiesterase 10A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 23984
HGNC: HGNC:8772
Homologene: 4852
Ralgapa2
Name: Ral GTPase activating protein, alpha subunit 2 (catalytic)
Synonyms: RGC2, AS250, A230067G21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241694
Homologene: 28131
Fhad1
Name: forkhead-associated (FHA) phosphopeptide binding domain 1
Synonyms: 2900090M10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 329977
Homologene: 77947
Nr1i3
Name: nuclear receptor subfamily 1, group I, member 3
Synonyms: mCAR, CAR1, Care2, MB67, ESTM32, CAR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12355
HGNC: HGNC:7969
Homologene: 3759
Astn1
Name: astrotactin 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 11899
HGNC: HGNC:773
Homologene: 7233
Ttf1
Name: transcription termination factor, RNA polymerase I
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22130
Homologene: 137223
Vwa8
Name: von Willebrand factor A domain containing 8
Synonyms: 1300010F03Rik, 4932416F07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 219189
VEGA: 14
Homologene: 44881
Akr1c13
Name: aldo-keto reductase family 1, member C13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 27384
Homologene: 121208
Ripk4
Name: receptor-interacting serine-threonine kinase 4
Synonyms: Ankrd3, PKK, DIk, ANKK2, RIP4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 72388
HGNC: HGNC:496
Homologene: 10772
Aox3
Name: aldehyde oxidase 3
Synonyms: 1200011D03Rik, AOH1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 71724
Homologene: 90899
Zxdc
Name: ZXD family zinc finger C
Synonyms: B930086F11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 80292
Homologene: 82340
Shank2
Name: SH3 and multiple ankyrin repeat domains 2
Synonyms: ProSAP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 210274
Homologene: 105965
Slc35d3
Name: solute carrier family 35, member D3
Synonyms: Frcl1, 6230421J19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 76157
VEGA: 10
Homologene: 19123
Folh1
Name: folate hydrolase 1
Synonyms: glutamate carboxypeptidase II, GCP2, prostate-specific membrane antigen, mopsm
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 53320
Homologene: 55826
Adam6a
Name: a disintegrin and metallopeptidase domain 6A
Synonyms: Adam6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238406
HGNC: HGNC:213
Homologene: 128362
Fbln2
Name: fibulin 2
Synonyms: 5730577E14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 14115
HGNC: HGNC:3601
Homologene: 1514
Or13a17
Name: olfactory receptor family 13 subfamily A member 17
Synonyms: MOR253-2, Olfr45, GA_x6K02T2PBJ9-42837030-42837962, IB6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18344
Homologene: 79416
Vmn2r9
Name: vomeronasal 2, receptor 9
Synonyms: EG435864
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 435864
Homologene: 129606
Adamts18
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 18
Synonyms: E130314N14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 208936
Homologene: 65241
Aldoart1
Name: aldolase 1 A, retrogene 1
Synonyms: Aldo1-ps2, 4921524E03Rik, Aldoa-ps2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 353204
HGNC: HGNC:414
Homologene: 128442
Fam98c
Name: family with sequence similarity 98, member C
Synonyms: B230110F21Rik, 1110006G06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 73833
Homologene: 45483
Ugt1a6a
Name: UDP glucuronosyltransferase 1 family, polypeptide A6A
Synonyms: UGT1.6, Ugt1a6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 94284
Homologene: 85959
Atp1b2
Name: ATPase, Na+/K+ transporting, beta 2 polypeptide
Synonyms: Amog, Atpb-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 11932
HGNC: HGNC:805
Homologene: 36075
Tsnaxip1
Name: translin-associated factor X (Tsnax) interacting protein 1
Synonyms: TXI1, 1700016K08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 72236
Homologene: 10194
Tbc1d31
Name: TBC1 domain family, member 31
Synonyms: LOC210544, Wdr67, D330013L20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 210544
Homologene: 17089
Slc46a1
Name: solute carrier family 46, member 1
Synonyms: 1110002C08Rik, D11Ertd18e, HCP1, PCFT, heme carrier protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 52466
Homologene: 41693
Or7g33
Name: olfactory receptor family 7 subfamily G member 33
Synonyms: GA_x6K02T2PVTD-13277703-13276786, MOR154-1, Olfr853
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258908
HGNC: HGNC:8466
Homologene: 133623
Prag1
Name: PEAK1 related kinase activating pseudokinase 1
Synonyms: NACK, D8Ertd82e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244418
Homologene: 18256
Alkbh2
Name: alkB homolog 2, alpha-ketoglutarate-dependent dioxygenase
Synonyms: mABH2, Abh2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231642
Homologene: 18393
Ano7
Name: anoctamin 7
Synonyms: IPCA-5, Tmem16g, NGEP-L, Pcanap5, NGEP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 404545
Homologene: 45787
Setd7
Name: SET domain containing (lysine methyltransferase) 7
Synonyms: 1600028F23Rik, KMT7, Set7/9, Set7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 73251
Homologene: 12741
Cnot6l
Name: CCR4-NOT transcription complex, subunit 6-like
Synonyms: 4932442K20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231464
Homologene: 100830
Cdca7
Name: cell division cycle associated 7
Synonyms: 2310021G01Rik, JPO1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 66953
Homologene: 49970
Kcnd3
Name: potassium voltage-gated channel, Shal-related family, member 3
Synonyms: Kv4.3, potassium channel Kv4.3L, potassium channel Kv4.3M
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 56543
HGNC: HGNC:6239
Homologene: 21036
Zfp9
Name: zinc finger protein 9
Synonyms: 1810048F22Rik, Krox-4, Zfp-9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 22750
Homologene: 49280
Foxf2
Name: forkhead box F2
Synonyms: LUN, Fkh20, FREAC2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 14238
HGNC: HGNC:3810
Homologene: 1115
Phtf2
Name: putative homeodomain transcription factor 2
Synonyms: 1110054G21Rik, 9530062N20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 68770
Homologene: 10713
Adamtsl2
Name: ADAMTS-like 2
Synonyms: A930008K15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 77794
Homologene: 8798
Or10ac1
Name: olfactory receptor family 10 subfamily AC member 1
Synonyms: EG546896, Olfr455, GA_x6K02T2P3E9-5021913-5022918, MOR0-17_p, MOR0-2P, Olfr455-ps1, MORO-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 546896
Homologene: 67366
Or2b28
Name: olfactory receptor family 2 subfamily B member 28
Synonyms: GA_x6K02T2QHY8-11899770-11898820, Olfr1367, MOR256-16, MOR256-65
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 258526
Tfec
Name: transcription factor EC
Synonyms: bHLHe34, Tcfec, TFEC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 21426
Homologene: 32148
Ptprv
Name: protein tyrosine phosphatase, receptor type, V
Synonyms: OST-PTP, OST, Esp, mOST-PTP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13924
Homologene: 7306
Syngr4
Name: synaptogyrin 4
Synonyms: 1700016O14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 58867
Homologene: 8258
Rmi1
Name: RecQ mediated genome instability 1
Synonyms: 4932432N11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 74386
VEGA: 13
Homologene: 41601
Hnrnpa1l2-ps2
Name: heterogeneous nuclear ribonucleoprotein A1-like 2, pseudogene 2
Synonyms: Gm5803
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 545091
Homologene: 134075
E430024P14Rik
Name: RIKEN cDNA E430024P14 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Gm29588
Name: predicted gene 29588
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Tnni2
Name: troponin I, skeletal, fast 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 21953
Homologene: 37752
BC022960
Name: cDNA sequence BC022960
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 24,705,999 bp
  • A to T, chromosome 1 at 58,125,035 bp
  • G to A, chromosome 1 at 88,218,390 bp
  • T to C, chromosome 1 at 93,375,185 bp
  • T to C, chromosome 1 at 128,351,548 bp
  • T to C, chromosome 1 at 135,124,131 bp
  • T to G, chromosome 1 at 150,595,894 bp
  • C to A, chromosome 1 at 158,502,251 bp
  • C to A, chromosome 1 at 171,216,445 bp
  • T to C, chromosome 1 at 193,107,695 bp
  • A to G, chromosome 2 at 26,429,393 bp
  • C to T, chromosome 2 at 26,431,068 bp
  • T to A, chromosome 2 at 27,093,585 bp
  • C to A, chromosome 2 at 29,065,160 bp
  • TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA to TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA, chromosome 2 at 72,481,861 bp
  • G to A, chromosome 2 at 74,692,292 bp
  • T to C, chromosome 2 at 76,726,173 bp
  • G to A, chromosome 2 at 125,466,673 bp
  • A to G, chromosome 2 at 146,361,453 bp
  • A to G, chromosome 2 at 153,696,749 bp
  • A to G, chromosome 2 at 164,772,173 bp
  • A to G, chromosome 2 at 167,967,781 bp
  • A to C, chromosome 2 at 181,601,474 bp
  • A to T, chromosome 3 at 5,561,281 bp
  • G to T, chromosome 3 at 51,542,665 bp
  • C to T, chromosome 3 at 105,658,766 bp
  • T to C, chromosome 4 at 72,852,443 bp
  • T to C, chromosome 4 at 102,601,605 bp
  • A to T, chromosome 4 at 116,703,471 bp
  • A to T, chromosome 4 at 141,896,468 bp
  • A to T, chromosome 4 at 154,367,240 bp
  • C to T, chromosome 5 at 20,773,740 bp
  • G to T, chromosome 5 at 22,548,005 bp
  • C to A, chromosome 5 at 31,498,393 bp
  • C to T, chromosome 5 at 66,400,076 bp
  • T to C, chromosome 5 at 76,542,228 bp
  • A to G, chromosome 5 at 96,077,211 bp
  • T to C, chromosome 5 at 108,847,597 bp
  • C to T, chromosome 5 at 114,124,226 bp
  • T to C, chromosome 5 at 114,955,871 bp
  • A to G, chromosome 6 at 16,840,479 bp
  • T to C, chromosome 6 at 40,950,516 bp
  • T to A, chromosome 6 at 42,538,441 bp
  • G to A, chromosome 6 at 89,384,660 bp
  • C to T, chromosome 6 at 90,370,330 bp
  • G to T, chromosome 6 at 91,259,767 bp
  • T to C, chromosome 6 at 114,308,106 bp
  • A to T, chromosome 6 at 115,035,002 bp
  • A to G, chromosome 6 at 118,464,976 bp
  • T to C, chromosome 7 at 29,155,268 bp
  • C to T, chromosome 7 at 44,904,419 bp
  • A to G, chromosome 7 at 45,887,028 bp
  • A to T, chromosome 7 at 86,773,252 bp
  • T to C, chromosome 7 at 139,657,281 bp
  • A to T, chromosome 7 at 139,680,927 bp
  • T to A, chromosome 7 at 140,691,378 bp
  • T to A, chromosome 7 at 142,443,525 bp
  • C to T, chromosome 7 at 144,411,424 bp
  • A to G, chromosome 8 at 36,103,292 bp
  • G to T, chromosome 8 at 64,758,191 bp
  • A to T, chromosome 8 at 94,329,384 bp
  • A to T, chromosome 8 at 105,841,407 bp
  • A to T, chromosome 8 at 107,369,276 bp
  • C to T, chromosome 8 at 113,773,168 bp
  • G to T, chromosome 9 at 19,537,673 bp
  • A to G, chromosome 9 at 53,456,506 bp
  • A to T, chromosome 9 at 63,145,476 bp
  • C to T, chromosome 10 at 19,849,331 bp
  • T to C, chromosome 10 at 121,568,080 bp
  • T to C, chromosome 11 at 12,251,093 bp
  • C to T, chromosome 11 at 60,242,707 bp
  • T to A, chromosome 11 at 69,465,376 bp
  • T to A, chromosome 11 at 69,601,334 bp
  • T to A, chromosome 11 at 78,466,889 bp
  • C to T, chromosome 12 at 25,057,042 bp
  • G to A, chromosome 12 at 58,968,840 bp
  • G to A, chromosome 12 at 101,989,895 bp
  • A to T, chromosome 12 at 113,544,949 bp
  • G to T, chromosome 13 at 4,197,870 bp
  • T to C, chromosome 13 at 21,347,464 bp
  • A to T, chromosome 13 at 31,626,888 bp
  • A to G, chromosome 13 at 38,168,641 bp
  • A to G, chromosome 13 at 58,409,136 bp
  • T to C, chromosome 13 at 63,068,092 bp
  • A to C, chromosome 13 at 103,334,021 bp
  • G to A, chromosome 14 at 79,103,697 bp
  • A to C, chromosome 15 at 22,714,042 bp
  • T to A, chromosome 15 at 57,967,912 bp
  • T to G, chromosome 15 at 76,637,224 bp
  • T to C, chromosome 15 at 81,949,123 bp
  • G to T, chromosome 15 at 97,758,929 bp
  • A to T, chromosome 15 at 98,168,757 bp
  • A to T, chromosome 16 at 97,744,026 bp
  • G to A, chromosome 17 at 7,926,941 bp
  • A to C, chromosome 17 at 8,981,652 bp
  • G to A, chromosome 17 at 24,903,293 bp
  • G to T, chromosome 17 at 74,446,628 bp
  • C to G, chromosome 18 at 67,812,369 bp
  • T to C, chromosome X at 169,369,278 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4627 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041892-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.