Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4627Btlr/Mmmh
Stock Number:
041892-MU
Citation ID:
RRID:MMRRC_041892-MU
Other Names:
R4627 (G1), C57BL/6J-MtgxR4627Btlr
Major Collection:

Strain Information

Nfat5
Name: nuclear factor of activated T cells 5
Synonyms: nfatz, TonEBP, B130038B15Rik, OREBP
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54446
HGNC: HGNC:7774
Homologene: 4811
Slc6a1
Name: solute carrier family 6 (neurotransmitter transporter, GABA), member 1
Synonyms: XT-1, Gabt, Xtrp1, Gat1, Gabt1, GAT-1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232333
Homologene: 2290
Prdm16
Name: PR domain containing 16
Synonyms: Mel1, 5730557K01Rik, line 27, csp1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70673
Homologene: 11139
Prpf6
Name: pre-mRNA splicing factor 6
Synonyms: 1190003A07Rik, U5-102K, ANT-1, 2610031L17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68879
Homologene: 5368
Atm
Name: ataxia telangiectasia mutated
Synonyms: C030026E19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11920
HGNC: HGNC:795
Homologene: 30952
Aopep
Name: aminopeptidase O
Synonyms: ApO, 2010111I01Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72061
HGNC: HGNC:1361
Homologene: 66273
Sec23a
Name: SEC23 homolog A, COPII coat complex component
Synonyms: Sec23r, Msec23
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20334
Homologene: 4642
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 24,705,999 bp
  • A to T, chromosome 1 at 58,125,035 bp
  • G to A, chromosome 1 at 88,218,390 bp
  • T to C, chromosome 1 at 93,375,185 bp
  • T to C, chromosome 1 at 128,351,548 bp
  • T to C, chromosome 1 at 135,124,131 bp
  • T to G, chromosome 1 at 150,595,894 bp
  • C to A, chromosome 1 at 158,502,251 bp
  • C to A, chromosome 1 at 171,216,445 bp
  • T to C, chromosome 1 at 193,107,695 bp
  • A to G, chromosome 2 at 26,429,393 bp
  • C to T, chromosome 2 at 26,431,068 bp
  • T to A, chromosome 2 at 27,093,585 bp
  • C to A, chromosome 2 at 29,065,160 bp
  • TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA to TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA, chromosome 2 at 72,481,861 bp
  • G to A, chromosome 2 at 74,692,292 bp
  • T to C, chromosome 2 at 76,726,173 bp
  • G to A, chromosome 2 at 125,466,673 bp
  • A to G, chromosome 2 at 146,361,453 bp
  • A to G, chromosome 2 at 153,696,749 bp
  • A to G, chromosome 2 at 164,772,173 bp
  • A to G, chromosome 2 at 167,967,781 bp
  • A to C, chromosome 2 at 181,601,474 bp
  • A to T, chromosome 3 at 5,561,281 bp
  • G to T, chromosome 3 at 51,542,665 bp
  • C to T, chromosome 3 at 105,658,766 bp
  • T to C, chromosome 4 at 72,852,443 bp
  • T to C, chromosome 4 at 102,601,605 bp
  • A to T, chromosome 4 at 116,703,471 bp
  • A to T, chromosome 4 at 141,896,468 bp
  • A to T, chromosome 4 at 154,367,240 bp
  • C to T, chromosome 5 at 20,773,740 bp
  • G to T, chromosome 5 at 22,548,005 bp
  • C to A, chromosome 5 at 31,498,393 bp
  • C to T, chromosome 5 at 66,400,076 bp
  • T to C, chromosome 5 at 76,542,228 bp
  • A to G, chromosome 5 at 96,077,211 bp
  • T to C, chromosome 5 at 108,847,597 bp
  • C to T, chromosome 5 at 114,124,226 bp
  • T to C, chromosome 5 at 114,955,871 bp
  • A to G, chromosome 6 at 16,840,479 bp
  • T to C, chromosome 6 at 40,950,516 bp
  • T to A, chromosome 6 at 42,538,441 bp
  • G to A, chromosome 6 at 89,384,660 bp
  • C to T, chromosome 6 at 90,370,330 bp
  • G to T, chromosome 6 at 91,259,767 bp
  • T to C, chromosome 6 at 114,308,106 bp
  • A to T, chromosome 6 at 115,035,002 bp
  • A to G, chromosome 6 at 118,464,976 bp
  • T to C, chromosome 7 at 29,155,268 bp
  • C to T, chromosome 7 at 44,904,419 bp
  • A to G, chromosome 7 at 45,887,028 bp
  • A to T, chromosome 7 at 86,773,252 bp
  • T to C, chromosome 7 at 139,657,281 bp
  • A to T, chromosome 7 at 139,680,927 bp
  • T to A, chromosome 7 at 140,691,378 bp
  • T to A, chromosome 7 at 142,443,525 bp
  • C to T, chromosome 7 at 144,411,424 bp
  • A to G, chromosome 8 at 36,103,292 bp
  • G to T, chromosome 8 at 64,758,191 bp
  • A to T, chromosome 8 at 94,329,384 bp
  • A to T, chromosome 8 at 105,841,407 bp
  • A to T, chromosome 8 at 107,369,276 bp
  • C to T, chromosome 8 at 113,773,168 bp
  • G to T, chromosome 9 at 19,537,673 bp
  • A to G, chromosome 9 at 53,456,506 bp
  • A to T, chromosome 9 at 63,145,476 bp
  • C to T, chromosome 10 at 19,849,331 bp
  • T to C, chromosome 10 at 121,568,080 bp
  • T to C, chromosome 11 at 12,251,093 bp
  • C to T, chromosome 11 at 60,242,707 bp
  • T to A, chromosome 11 at 69,465,376 bp
  • T to A, chromosome 11 at 69,601,334 bp
  • T to A, chromosome 11 at 78,466,889 bp
  • C to T, chromosome 12 at 25,057,042 bp
  • G to A, chromosome 12 at 58,968,840 bp
  • G to A, chromosome 12 at 101,989,895 bp
  • A to T, chromosome 12 at 113,544,949 bp
  • G to T, chromosome 13 at 4,197,870 bp
  • T to C, chromosome 13 at 21,347,464 bp
  • A to T, chromosome 13 at 31,626,888 bp
  • A to G, chromosome 13 at 38,168,641 bp
  • A to G, chromosome 13 at 58,409,136 bp
  • T to C, chromosome 13 at 63,068,092 bp
  • A to C, chromosome 13 at 103,334,021 bp
  • G to A, chromosome 14 at 79,103,697 bp
  • A to C, chromosome 15 at 22,714,042 bp
  • T to A, chromosome 15 at 57,967,912 bp
  • T to G, chromosome 15 at 76,637,224 bp
  • T to C, chromosome 15 at 81,949,123 bp
  • G to T, chromosome 15 at 97,758,929 bp
  • A to T, chromosome 15 at 98,168,757 bp
  • A to T, chromosome 16 at 97,744,026 bp
  • G to A, chromosome 17 at 7,926,941 bp
  • A to C, chromosome 17 at 8,981,652 bp
  • G to A, chromosome 17 at 24,903,293 bp
  • G to T, chromosome 17 at 74,446,628 bp
  • C to G, chromosome 18 at 67,812,369 bp
  • T to C, chromosome X at 169,369,278 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4627 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041892-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.