Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4632Btlr/Mmmh
Stock Number:
041897-MU
Citation ID:
RRID:MMRRC_041897-MU
Other Names:
R4632 (G1), C57BL/6J-MtgxR4632Btlr
Major Collection:

Strain Information

Dspp
Name: dentin sialophosphoprotein
Synonyms: Dmp3, Dpp, Dsp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 666279
HGNC: HGNC:3054
Sort1
Name: sortilin 1
Synonyms: sortilin, neurotensin receptor 3, Ntsr3, Ntr3, 2900053A11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20661
Homologene: 136097
Etv1
Name: ets variant 1
Synonyms: ER81, Etsrp81
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 14009
HGNC: HGNC:3490
Homologene: 3636
Nos2
Name: nitric oxide synthase 2, inducible
Synonyms: iNOS, Nos-2, NOS-II, Nos2a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18126
HGNC: HGNC:7873
Homologene: 55473
Tanc1
Name: tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Synonyms: 1200003E16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66860
Homologene: 18946
Utp20
Name: UTP20 small subunit processome component
Synonyms: mDRIM, DRIM, 3830408P06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 36,778,458 bp
  • A to T, chromosome 1 at 51,474,602 bp
  • A to G, chromosome 1 at 53,427,951 bp
  • T to A, chromosome 1 at 72,647,184 bp
  • G to A, chromosome 1 at 90,939,386 bp
  • A to T, chromosome 1 at 120,068,249 bp
  • A to G, chromosome 1 at 140,523,148 bp
  • G to A, chromosome 1 at 162,134,480 bp
  • G to A, chromosome 1 at 172,325,809 bp
  • T to A, chromosome 1 at 188,395,874 bp
  • T to A, chromosome 2 at 4,896,760 bp
  • C to T, chromosome 2 at 29,148,615 bp
  • G to A, chromosome 2 at 34,727,243 bp
  • C to A, chromosome 2 at 59,795,835 bp
  • A to G, chromosome 2 at 69,489,129 bp
  • G to T, chromosome 2 at 164,237,747 bp
  • C to T, chromosome 3 at 105,658,766 bp
  • G to T, chromosome 3 at 108,346,678 bp
  • A to G, chromosome 3 at 157,962,302 bp
  • T to C, chromosome 4 at 55,012,981 bp
  • T to C, chromosome 4 at 116,553,038 bp
  • C to T, chromosome 4 at 116,741,712 bp
  • A to G, chromosome 4 at 144,158,128 bp
  • A to G, chromosome 4 at 148,951,855 bp
  • T to A, chromosome 4 at 155,955,258 bp
  • A to T, chromosome 5 at 4,755,865 bp
  • G to A, chromosome 5 at 18,015,366 bp
  • A to G, chromosome 5 at 24,591,831 bp
  • A to G, chromosome 5 at 103,569,860 bp
  • A to G, chromosome 5 at 104,177,406 bp
  • C to T, chromosome 5 at 114,124,226 bp
  • T to C, chromosome 5 at 120,733,481 bp
  • G to A, chromosome 5 at 131,472,275 bp
  • T to A, chromosome 6 at 42,141,498 bp
  • G to T, chromosome 7 at 24,668,368 bp
  • A to T, chromosome 7 at 58,807,438 bp
  • G to T, chromosome 7 at 75,666,553 bp
  • A to G, chromosome 7 at 76,413,685 bp
  • ATGGCG to ATGGCGACGGTGGCG, chromosome 7 at 97,579,904 bp
  • T to C, chromosome 7 at 104,160,893 bp
  • T to A, chromosome 7 at 105,754,355 bp
  • C to T, chromosome 8 at 27,042,985 bp
  • T to A, chromosome 8 at 58,427,823 bp
  • T to C, chromosome 8 at 110,978,713 bp
  • A to G, chromosome 8 at 117,447,411 bp
  • A to G, chromosome 9 at 36,894,413 bp
  • T to C, chromosome 9 at 54,946,516 bp
  • G to A, chromosome 9 at 59,869,664 bp
  • A to T, chromosome 9 at 65,279,880 bp
  • T to C, chromosome 9 at 70,579,369 bp
  • A to G, chromosome 9 at 105,654,899 bp
  • T to A, chromosome 9 at 106,370,766 bp
  • G to A, chromosome 9 at 121,454,425 bp
  • A to G, chromosome 10 at 88,778,261 bp
  • C to T, chromosome 10 at 103,221,427 bp
  • A to G, chromosome 10 at 106,836,044 bp
  • TGGACCACTCCAGGACCACTC to TGGACCACTC, chromosome 11 at 62,265,382 bp
  • C to T, chromosome 11 at 76,509,019 bp
  • T to C, chromosome 11 at 78,957,591 bp
  • G to A, chromosome 11 at 87,231,530 bp
  • A to C, chromosome 11 at 99,809,528 bp
  • A to G, chromosome 11 at 100,121,224 bp
  • C to T, chromosome 11 at 118,303,772 bp
  • A to G, chromosome 11 at 120,465,784 bp
  • T to A, chromosome 12 at 38,781,314 bp
  • A to T, chromosome 12 at 84,325,736 bp
  • T to C, chromosome 13 at 63,068,092 bp
  • A to T, chromosome 13 at 75,769,574 bp
  • A to T, chromosome 15 at 4,759,868 bp
  • A to G, chromosome 15 at 44,484,400 bp
  • A to G, chromosome 15 at 48,011,209 bp
  • T to A, chromosome 15 at 53,719,671 bp
  • C to T, chromosome 15 at 89,146,376 bp
  • C to T, chromosome 15 at 101,846,187 bp
  • C to T, chromosome 16 at 3,839,087 bp
  • T to G, chromosome 16 at 45,417,908 bp
  • C to G, chromosome 17 at 12,232,504 bp
  • C to T, chromosome 17 at 19,531,954 bp
  • T to C, chromosome 17 at 19,793,696 bp
  • A to T, chromosome 17 at 23,835,491 bp
  • T to C, chromosome 17 at 31,064,473 bp
  • T to C, chromosome 17 at 85,083,231 bp
  • A to G, chromosome 19 at 55,314,309 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4632 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The submitter or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041897-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.