Strain Name:
C57BL/6J-MtgxR4632Btlr/Mmmh
Stock Number:
041897-MU
Citation ID:
RRID:MMRRC_041897-MU
Other Names:
R4632 (G1), C57BL/6J-MtgxR4632Btlr
Major Collection:

Gene Information

Dspp
Name: dentin sialophosphoprotein
Synonyms: Dmp3, Dpp, Dsp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 666279
HGNC: HGNC:3054
Homologene: null
Sort1
Name: sortilin 1
Synonyms: Ntr3, neurotensin receptor 3, 2900053A11Rik, sortilin, Ntsr3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 20661
Homologene: 136097
Etv1
Name: ets variant 1
Synonyms: ER81, Etsrp81
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 14009
HGNC: HGNC:3490
Homologene: 3636
Nos2
Name: nitric oxide synthase 2, inducible
Synonyms: Nos2a, Nos-2, iNOS, NOS-II
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 18126
HGNC: HGNC:7873
Homologene: 55473
Tanc1
Name: tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Synonyms: 1200003E16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 66860
Homologene: 18946
Utp20
Name: UTP20 small subunit processome component
Synonyms: DRIM, 3830408P06Rik, mDRIM
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 70683
VEGA: 10
Homologene: 38373
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: D230004K18Rik, b2b1625.2Clo, Gp330, Megalin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Aopep
Name: aminopeptidase O
Synonyms: ApO, 2010111I01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 72061
HGNC: HGNC:1361
Homologene: 66273
Tesk2
Name: testis-specific kinase 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 230661
Homologene: 5188
Prepl
Name: prolyl endopeptidase-like
Synonyms: 9530014L06Rik, D030028O16Rik, 2810457N15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 213760
VEGA: 17
Homologene: 15481
Ppm1e
Name: protein phosphatase 1E (PP2C domain containing)
Synonyms: POPX1, B930008A12Rik, PP2CH
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 320472
Homologene: 22848
Map3k4
Name: mitogen-activated protein kinase kinase kinase 4
Synonyms: D17Rp17e, MAPKKK4, D17Rp17, MTK1, Tas, RP17, Mekk4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 26407
VEGA: 17
HGNC: HGNC:6856
Homologene: 31346
Sephs1
Name: selenophosphate synthetase 1
Synonyms: 1110046B24Rik, SPS1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 109079
Homologene: 56558
Ube2j2
Name: ubiquitin-conjugating enzyme E2J 2
Synonyms: 5730472G04Rik, 2400008G19Rik, 1200007B18Rik, Ubc6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 140499
Homologene: 10975
Setx
Name: senataxin
Synonyms: A930037J23Rik, Als4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 269254
HGNC: HGNC:445
Homologene: 41003
Auts2
Name: autism susceptibility candidate 2
Synonyms: 2700063G02Rik, D830032G16Rik, A730011F23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 319974
Homologene: 22907
Ddx19a
Name: DEAD (Asp-Glu-Ala-Asp) box polypeptide 19a
Synonyms: Ddx19, DBP5, Eif4a-rs1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 13680
Homologene: 5240
Zfp462
Name: zinc finger protein 462
Synonyms: 9430078C22Rik, Gt4-2, Zfpip
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 242466
Homologene: 41430
Akap13
Name: A kinase (PRKA) anchor protein 13
Synonyms: 1700026G02Rik, 5830460E08Rik, 5730522G15Rik, AKAP-Lbc, PROTO-LBC, PROTO-LB, Ht31
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Rsf1
Name: remodeling and spacing factor 1
Synonyms: XAP8, p325, 4832420A03Rik, C030033M12Rik, Hbxap
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 233532
Homologene: 41142
Gapvd1
Name: GTPase activating protein and VPS9 domains 1
Synonyms: 4432404J10Rik, 2010005B09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 66691
Homologene: 32637
Sltm
Name: SAFB-like, transcription modulator
Synonyms: 5730555F13Rik, 9130215G10Rik, 5730455C01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 66660
VEGA: 9
Homologene: 11696
Abcg1
Name: ATP binding cassette subfamily G member 1
Synonyms: Abc8, White
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 11307
HGNC: HGNC:73
Homologene: 21022
Myo9a
Name: myosin IXa
Synonyms: C130068I12Rik, 4732465J09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 270163
HGNC: HGNC:7608
Homologene: 21371
Abr
Name: active BCR-related gene
Synonyms: 6330400K15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 109934
HGNC: HGNC:81
Homologene: 11081
Trak1
Name: trafficking protein, kinesin binding 1
Synonyms: hyrt, 2310001H13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 67095
Homologene: 25103
Dnah7a
Name: dynein, axonemal, heavy chain 7A
Synonyms: Dnahc7, Dnahc7a, LOC381341
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 627872
Homologene: 41287
C6
Name: complement component 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 12274
HGNC: HGNC:1339
Homologene: 47
Zdhhc6
Name: zinc finger, DHHC domain containing 6
Synonyms: 5930409M18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 66980
VEGA: 19
Homologene: 41487
Ankrd13c
Name: ankyrin repeat domain 13c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 433667
Homologene: 41804
Casz1
Name: castor zinc finger 1
Synonyms: Cst, 2410019P08Rik, D4Ertd432e, castor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 69743
Homologene: 9824
Zap70
Name: zeta-chain (TCR) associated protein kinase
Synonyms: ZAP-70, TZK, Srk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 22637
Homologene: 839
Kcnj9
Name: potassium inwardly-rectifying channel, subfamily J, member 9
Synonyms: Girk3, 1700085N21Rik, Kir3.3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 16524
HGNC: HGNC:6270
Homologene: 37989
Timp2
Name: tissue inhibitor of metalloproteinase 2
Synonyms: D11Bwg1104e, TIMP-2, Timp-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 21858
Homologene: 2444
Chpf2
Name: chondroitin polymerizing factor 2
Synonyms: 2010209O12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 100910
Homologene: 14763
Zfp410
Name: zinc finger protein 410
Synonyms: D12Ertd748e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 52708
VEGA: 12
Homologene: 10918
Arl16
Name: ADP-ribosylation factor-like 16
Synonyms: 2600005N12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 70317
Homologene: 53461
Cmip
Name: c-Maf inducing protein
Synonyms: 5830471E12Rik, 4933407C03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 74440
Homologene: 18869
Samd12
Name: sterile alpha motif domain containing 12
Synonyms: A830094I09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 320679
Homologene: 35979
Ell2
Name: elongation factor RNA polymerase II 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 192657
VEGA: 13
Homologene: 8094
Mapk11
Name: mitogen-activated protein kinase 11
Synonyms: Sapk2, p38beta, Prkm11, P38b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 19094
VEGA: 15
HGNC: HGNC:6873
Homologene: 55684
Cilp
Name: cartilage intermediate layer protein, nucleotide pyrophosphohydrolase
Synonyms: C130036G17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 214425
HGNC: HGNC:1980
Homologene: 2679
Atp10a
Name: ATPase, class V, type 10A
Synonyms: pfatp, Atp10c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 11982
Homologene: 56461
Mlph
Name: melanophilin
Synonyms: D1Wsu84e, Slac-2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 171531
Homologene: 11465
Ptpn13
Name: protein tyrosine phosphatase, non-receptor type 13
Synonyms: PTPL1, PTP-BL, Ptpri
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 19249
HGNC: HGNC:9646
Homologene: 7909
Dchs1
Name: dachsous cadherin related 1
Synonyms: C130033F22Rik, 3110041P15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 233651
Homologene: 2771
Agbl1
Name: ATP/GTP binding protein-like 1
Synonyms: EG244071, Nna1-l1, Ccp4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 244071
Homologene: 17552
Ush2a
Name: usherin
Synonyms: Ush2a, Ushrn, MUSH2A, A930037M10Rik, A930011D15Rik, LOC269160, LOC381317
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 22283
Homologene: 66151
Vmn2r103
Name: vomeronasal 2, receptor 103
Synonyms: EG627636
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 627636
HGNC: null
Homologene: 115024
Pkhd1l1
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: PKHDL1, fibrocystin L, D86 mRNA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 192190
Homologene: 16332
Pik3r4
Name: phosphoinositide-3-kinase regulatory subunit 4
Synonyms: p150, Vps15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 75669
HGNC: HGNC:8982
Homologene: 24678
Vmn2r100
Name: vomeronasal 2, receptor 100
Synonyms: EG627537
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 627537
HGNC: null
Homologene: 129750
Oog3
Name: oogenesin 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 100012
HGNC: null
Homologene: 129883
Ppfia2
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
Synonyms: Liprin-alpha2, E130120L08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 327814
VEGA: 10
HGNC: HGNC:9246
Homologene: 27953
Csmd3
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 239420
Homologene: 65982
Ankar
Name: ankyrin and armadillo repeat containing
Synonyms: 4932422E22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 319695
Homologene: 85163
Lrriq1
Name: leucine-rich repeats and IQ motif containing 1
Synonyms: LOC380658, 4930503E15Rik, Gm1557
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 74978
Homologene: 46007
Fzd1
Name: frizzled class receptor 1
Synonyms: FZ-1, Fz1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 14362
HGNC: HGNC:4038
Homologene: 20750
Dnm3
Name: dynamin 3
Synonyms: 9630020E24Rik, B230343F03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 103967
Homologene: 22906
Hykk
Name: hydroxylysine kinase 1
Synonyms: Agphd1, C630028N24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 235386
Homologene: 16057
Krt13
Name: keratin 13
Synonyms: K13, Krt1-13, Krt-1.13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 16663
HGNC: HGNC:6415
Homologene: 40740
Olfm5
Name: olfactomedin 5
Synonyms: E030002O03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 244180
Homologene: 18253
Oas2
Name: 2'-5' oligoadenylate synthetase 2
Synonyms: 2'-5' oligoadenylate synthetase-like 11, Oasl11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 246728
HGNC: HGNC:8087
Homologene: 49478
Kcnt2
Name: potassium channel, subfamily T, member 2
Synonyms: E330038N15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 240776
Homologene: 16121
Alkbh2
Name: alkB homolog 2, alpha-ketoglutarate-dependent dioxygenase
Synonyms: Abh2, mABH2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 231642
Homologene: 18393
Olfr15
Name: olfactory receptor 15
Synonyms: OR3, GA_x54KRFPKG5P-348087-349025, MOR256-17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 18312
HGNC: HGNC:8242
Homologene: 7459
Krt1
Name: keratin 1
Synonyms: Krt-2.1, Krt2-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 16678
VEGA: 15
HGNC: HGNC:6412
Homologene: 38146
Kcnd3
Name: potassium voltage-gated channel, Shal-related family, member 3
Synonyms: potassium channel Kv4.3M, Kv4.3, potassium channel Kv4.3L
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 56543
HGNC: HGNC:6239
Homologene: 21036
Pknox2
Name: Pbx/knotted 1 homeobox 2
Synonyms: D230005H23Rik, Prep2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 208076
Homologene: 32527
Prss33
Name: protease, serine 33
Synonyms: mT6, Eos, tryptase-6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 353130
Homologene: 77185
Tas2r139
Name: taste receptor, type 2, member 139
Synonyms: Tas2r39, mt2r34
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 353148
Homologene: 52214
Tmem69
Name: transmembrane protein 69
Synonyms: A630048M13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 230657
Homologene: 9531
Gnat3
Name: guanine nucleotide binding protein, alpha transducing 3
Synonyms: alpha-gustducin, Ggust, Gtn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 242851
Homologene: 24284
Gm609
Name: predicted gene 609
Synonyms: LOC385647, LOC208166
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 208166
HGNC: null
Homologene: 86707
Adora2b
Name: adenosine A2b receptor
Synonyms: A2b, A2b, Rs, AA2BR, A2BR, A2BAR, ARA2B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 11541
HGNC: HGNC:264
Homologene: 20167
Galntl6
Name: UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6
Synonyms: 1700021K10Rik, 4930431L04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 270049
Homologene: 65137
Nabp1
Name: nucleic acid binding protein 1
Synonyms: Nbp1, 4933440J18Rik, 5830411E10Rik, Obfc2a, 4930434H03Rik, 4930488J04Rik, 4930442A21Rik, Ssb2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 109019
Homologene: 57094
Dusp7
Name: dual specificity phosphatase 7
Synonyms: MKP-X, PYST2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 235584
HGNC: HGNC:3073
Homologene: 1468
Svs2
Name: seminal vesicle secretory protein 2
Synonyms: SVS II, semenoclotin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 53878
HGNC: null
Homologene: 49325
Tmem37
Name: transmembrane protein 37
Synonyms: Pr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 170706
Homologene: 10447
Tex101
Name: testis expressed gene 101
Synonyms: 1700008H15Rik, TES101RP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 56746
Homologene: 10555
Proscos
Name: proline synthetase co-transcribed, opposite strand
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: null
HGNC: null
Homologene: null
Krtap4-13
Name: keratin associated protein 4-13
Synonyms: 2300006N05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 69464
Homologene: 124486
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 36,778,458 bp
  • A to T, chromosome 1 at 51,474,602 bp
  • A to G, chromosome 1 at 53,427,951 bp
  • T to A, chromosome 1 at 72,647,184 bp
  • G to A, chromosome 1 at 90,939,386 bp
  • A to T, chromosome 1 at 120,068,249 bp
  • A to G, chromosome 1 at 140,523,148 bp
  • G to A, chromosome 1 at 162,134,480 bp
  • G to A, chromosome 1 at 172,325,809 bp
  • T to A, chromosome 1 at 188,395,874 bp
  • T to A, chromosome 2 at 4,896,760 bp
  • C to T, chromosome 2 at 29,148,615 bp
  • G to A, chromosome 2 at 34,727,243 bp
  • C to A, chromosome 2 at 59,795,835 bp
  • A to G, chromosome 2 at 69,489,129 bp
  • G to T, chromosome 2 at 164,237,747 bp
  • C to T, chromosome 3 at 105,658,766 bp
  • G to T, chromosome 3 at 108,346,678 bp
  • A to G, chromosome 3 at 157,962,302 bp
  • T to C, chromosome 4 at 55,012,981 bp
  • T to C, chromosome 4 at 116,553,038 bp
  • C to T, chromosome 4 at 116,741,712 bp
  • A to G, chromosome 4 at 144,158,128 bp
  • A to G, chromosome 4 at 148,951,855 bp
  • T to A, chromosome 4 at 155,955,258 bp
  • A to T, chromosome 5 at 4,755,865 bp
  • G to A, chromosome 5 at 18,015,366 bp
  • A to G, chromosome 5 at 24,591,831 bp
  • A to G, chromosome 5 at 103,569,860 bp
  • A to G, chromosome 5 at 104,177,406 bp
  • C to T, chromosome 5 at 114,124,226 bp
  • T to C, chromosome 5 at 120,733,481 bp
  • G to A, chromosome 5 at 131,472,275 bp
  • T to A, chromosome 6 at 42,141,498 bp
  • G to T, chromosome 7 at 24,668,368 bp
  • A to T, chromosome 7 at 58,807,438 bp
  • G to T, chromosome 7 at 75,666,553 bp
  • A to G, chromosome 7 at 76,413,685 bp
  • ATGGCG to ATGGCGACGGTGGCG, chromosome 7 at 97,579,904 bp
  • T to C, chromosome 7 at 104,160,893 bp
  • T to A, chromosome 7 at 105,754,355 bp
  • C to T, chromosome 8 at 27,042,985 bp
  • T to A, chromosome 8 at 58,427,823 bp
  • T to C, chromosome 8 at 110,978,713 bp
  • A to G, chromosome 8 at 117,447,411 bp
  • A to G, chromosome 9 at 36,894,413 bp
  • T to C, chromosome 9 at 54,946,516 bp
  • G to A, chromosome 9 at 59,869,664 bp
  • A to T, chromosome 9 at 65,279,880 bp
  • T to C, chromosome 9 at 70,579,369 bp
  • A to G, chromosome 9 at 105,654,899 bp
  • T to A, chromosome 9 at 106,370,766 bp
  • G to A, chromosome 9 at 121,454,425 bp
  • A to G, chromosome 10 at 88,778,261 bp
  • C to T, chromosome 10 at 103,221,427 bp
  • A to G, chromosome 10 at 106,836,044 bp
  • TGGACCACTCCAGGACCACTC to TGGACCACTC, chromosome 11 at 62,265,382 bp
  • C to T, chromosome 11 at 76,509,019 bp
  • T to C, chromosome 11 at 78,957,591 bp
  • G to A, chromosome 11 at 87,231,530 bp
  • A to C, chromosome 11 at 99,809,528 bp
  • A to G, chromosome 11 at 100,121,224 bp
  • C to T, chromosome 11 at 118,303,772 bp
  • A to G, chromosome 11 at 120,465,784 bp
  • T to A, chromosome 12 at 38,781,314 bp
  • A to T, chromosome 12 at 84,325,736 bp
  • T to C, chromosome 13 at 63,068,092 bp
  • A to T, chromosome 13 at 75,769,574 bp
  • A to T, chromosome 15 at 4,759,868 bp
  • A to G, chromosome 15 at 44,484,400 bp
  • A to G, chromosome 15 at 48,011,209 bp
  • T to A, chromosome 15 at 53,719,671 bp
  • C to T, chromosome 15 at 89,146,376 bp
  • C to T, chromosome 15 at 101,846,187 bp
  • C to T, chromosome 16 at 3,839,087 bp
  • T to G, chromosome 16 at 45,417,908 bp
  • C to G, chromosome 17 at 12,232,504 bp
  • C to T, chromosome 17 at 19,531,954 bp
  • T to C, chromosome 17 at 19,793,696 bp
  • A to T, chromosome 17 at 23,835,491 bp
  • T to C, chromosome 17 at 31,064,473 bp
  • T to C, chromosome 17 at 85,083,231 bp
  • A to G, chromosome 19 at 55,314,309 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4632 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
041897-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.