Strain Name:
Stock Number:
Citation ID:
Other Names:
R4632 (G1), C57BL/6J-MtgxR4632Btlr
Major Collection:

Gene Information

Name: dentin sialophosphoprotein
Synonyms: Dsp, Dmp3, Dpp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 666279
Name: sortilin 1
Synonyms: Ntr3, Ntsr3, neurotensin receptor 3, 2900053A11Rik, sortilin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 20661
Homologene: 136097
Name: ets variant 1
Synonyms: Etsrp81, ER81
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 14009
Homologene: 3636
Name: nitric oxide synthase 2, inducible
Synonyms: Nos-2, Nos2a, NOS-II, iNOS
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 18126
Homologene: 55473
Name: tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Synonyms: 1200003E16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 66860
Homologene: 18946
Name: UTP20 small subunit processome component
Synonyms: DRIM, 3830408P06Rik, mDRIM
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14725
Homologene: 20952
Name: aminopeptidase O
Synonyms: 2010111I01Rik, ApO
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 72061
Homologene: 66273
Name: testis-specific kinase 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230661
Homologene: 5188
Name: prolyl endopeptidase-like
Synonyms: 2810457N15Rik, 9530014L06Rik, D030028O16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 213760
VEGA: 17
Homologene: 15481
Name: protein phosphatase 1E (PP2C domain containing)
Synonyms: PP2CH, POPX1, B930008A12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 320472
Homologene: 22848
Name: mitogen-activated protein kinase kinase kinase 4
Synonyms: MAPKKK4, RP17, D17Rp17e, Tas, Mekk4, MTK1, D17Rp17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 26407
VEGA: 17
Homologene: 31346
Name: selenophosphate synthetase 1
Synonyms: 1110046B24Rik, SPS1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 109079
Homologene: 56558
Name: ubiquitin-conjugating enzyme E2J 2
Synonyms: Ubc6, 1200007B18Rik, 5730472G04Rik, 2400008G19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 140499
Homologene: 10975
Name: senataxin
Synonyms: Als4, A930037J23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 269254
Homologene: 41003
Name: autism susceptibility candidate 2
Synonyms: 2700063G02Rik, A730011F23Rik, D830032G16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 319974
Homologene: 22907
Name: DEAD box helicase 19a
Synonyms: DBP5, Eif4a-rs1, Ddx19, DEAD (Asp-Glu-Ala-Asp) box polypeptide 19a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 13680
Homologene: 5240
Name: zinc finger protein 462
Synonyms: 9430078C22Rik, Zfpip, Gt4-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242466
Homologene: 41430
Name: A kinase (PRKA) anchor protein 13
Synonyms: PROTO-LBC, 1700026G02Rik, 5730522G15Rik, 5830460E08Rik, PROTO-LB, Ht31, AKAP-Lbc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 75547
Homologene: 4903
Name: remodeling and spacing factor 1
Synonyms: 4832420A03Rik, C030033M12Rik, p325, XAP8, Hbxap
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233532
Homologene: 41142
Name: GTPase activating protein and VPS9 domains 1
Synonyms: 2010005B09Rik, 4432404J10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 66691
Homologene: 32637
Name: SAFB-like, transcription modulator
Synonyms: 5730555F13Rik, 9130215G10Rik, 5730455C01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 66660
Homologene: 11696
Name: ATP binding cassette subfamily G member 1
Synonyms: White, Abc8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 11307
Homologene: 21022
Name: myosin IXa
Synonyms: 4732465J09Rik, C130068I12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 270163
Homologene: 21371
Name: active BCR-related gene
Synonyms: 6330400K15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 109934
Homologene: 11081
Name: trafficking protein, kinesin binding 1
Synonyms: hyrt, 2310001H13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 67095
Homologene: 25103
Name: dynein, axonemal, heavy chain 7A
Synonyms: Dnahc7, LOC381341, Dnahc7a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 627872
Homologene: 41287
Name: complement component 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 12274
Homologene: 47
Name: zinc finger, DHHC domain containing 6
Synonyms: 5930409M18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 66980
VEGA: 19
Homologene: 41487
Name: ankyrin repeat domain 13c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 433667
Homologene: 41804
Name: castor zinc finger 1
Synonyms: Cst, D4Ertd432e, 2410019P08Rik, castor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 69743
Homologene: 9824
Name: zeta-chain (TCR) associated protein kinase
Synonyms: Srk, TZK, ZAP-70
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 22637
Homologene: 839
Name: potassium inwardly-rectifying channel, subfamily J, member 9
Synonyms: 1700085N21Rik, Kir3.3, Girk3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16524
Homologene: 37989
Name: tissue inhibitor of metalloproteinase 2
Synonyms: D11Bwg1104e, Timp-2, TIMP-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 21858
Homologene: 2444
Name: chondroitin polymerizing factor 2
Synonyms: 2010209O12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100910
Homologene: 14763
Name: zinc finger protein 410
Synonyms: D12Ertd748e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 52708
VEGA: 12
Homologene: 10918
Name: ADP-ribosylation factor-like 16
Synonyms: 2600005N12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 70317
Homologene: 53461
Name: c-Maf inducing protein
Synonyms: 4933407C03Rik, 5830471E12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 74440
Homologene: 18869
Name: sterile alpha motif domain containing 12
Synonyms: A830094I09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 320679
Homologene: 35979
Name: elongation factor for RNA polymerase II 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 192657
VEGA: 13
Homologene: 8094
Name: mitogen-activated protein kinase 11
Synonyms: Prkm11, Sapk2, P38b, p38beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 19094
VEGA: 15
Homologene: 55684
Name: cartilage intermediate layer protein, nucleotide pyrophosphohydrolase
Synonyms: C130036G17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 214425
Homologene: 2679
Name: ATPase, class V, type 10A
Synonyms: pfatp, Atp10c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11982
Homologene: 56461
Name: melanophilin
Synonyms: D1Wsu84e, Slac-2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 171531
Homologene: 11465
Name: protein tyrosine phosphatase, non-receptor type 13
Synonyms: PTPL1, PTP-BL, Ptpri
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 19249
Homologene: 7909
Name: dachsous cadherin related 1
Synonyms: 3110041P15Rik, C130033F22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233651
Homologene: 2771
Name: ATP/GTP binding protein-like 1
Synonyms: EG244071, Nna1-l1, Ccp4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 244071
Homologene: 17552
Name: usherin
Synonyms: Ushrn, A930011D15Rik, Ush2a, LOC269160, MUSH2A, A930037M10Rik, LOC381317
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 22283
Homologene: 66151
Name: vomeronasal 2, receptor 103
Synonyms: EG627636
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 627636
Homologene: 115024
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: D86 mRNA, PKHDL1, fibrocystin L
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 192190
Homologene: 16332
Name: phosphoinositide-3-kinase regulatory subunit 4
Synonyms: Vps15, p150
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 75669
Homologene: 24678
Name: vomeronasal 2, receptor 100
Synonyms: EG627537
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 627537
Homologene: 129750
Name: oogenesin 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 100012
Homologene: 129883
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
Synonyms: E130120L08Rik, Liprin-alpha2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 327814
VEGA: 10
Homologene: 27953
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 239420
Homologene: 65982
Name: ankyrin and armadillo repeat containing
Synonyms: 4932422E22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 319695
Homologene: 85163
Name: leucine-rich repeats and IQ motif containing 1
Synonyms: 4930503E15Rik, Gm1557, LOC380658
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 74978
Homologene: 46007
Name: frizzled class receptor 1
Synonyms: FZ-1, Fz1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 14362
Homologene: 20750
Name: dynamin 3
Synonyms: 9630020E24Rik, B230343F03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 103967
Homologene: 22906
Name: hydroxylysine kinase 1
Synonyms: Agphd1, C630028N24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235386
Homologene: 16057
Name: keratin 13
Synonyms: Krt1-13, Krt-1.13, K13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 16663
Homologene: 40740
Name: olfactomedin 5
Synonyms: E030002O03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 244180
Homologene: 18253
Name: 2'-5' oligoadenylate synthetase 2
Synonyms: Oasl11, 2'-5' oligoadenylate synthetase-like 11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 246728
Homologene: 49478
Name: potassium channel, subfamily T, member 2
Synonyms: E330038N15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240776
Homologene: 16121
Name: alkB homolog 2, alpha-ketoglutarate-dependent dioxygenase
Synonyms: Abh2, mABH2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231642
Homologene: 18393
Name: olfactory receptor 15
Synonyms: OR3, MOR256-17, GA_x54KRFPKG5P-348087-349025
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 18312
Homologene: 7459
Name: keratin 1
Synonyms: Krt-2.1, Krt2-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 16678
VEGA: 15
Homologene: 38146
Name: potassium voltage-gated channel, Shal-related family, member 3
Synonyms: potassium channel Kv4.3M, Kv4.3, potassium channel Kv4.3L
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 56543
Homologene: 21036
Name: Pbx/knotted 1 homeobox 2
Synonyms: D230005H23Rik, Prep2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 208076
Homologene: 32527
Name: protease, serine 33
Synonyms: tryptase-6, mT6, Eos
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 353130
Homologene: 77185
Name: taste receptor, type 2, member 139
Synonyms: mt2r34, Tas2r39
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 353148
Homologene: 52214
Name: transmembrane protein 69
Synonyms: A630048M13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230657
Homologene: 9531
Name: guanine nucleotide binding protein, alpha transducing 3
Synonyms: alpha-gustducin, Ggust, Gtn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 242851
Homologene: 24284
Name: predicted gene 609
Synonyms: LOC385647, LOC208166
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 208166
Homologene: 86707
Name: adenosine A2b receptor
Synonyms: A2BR, A2BAR, A2b, Rs, AA2BR, ARA2B, A2b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 11541
Homologene: 20167
Name: UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6
Synonyms: 4930431L04Rik, 1700021K10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 270049
Homologene: 65137
Name: nucleic acid binding protein 1
Synonyms: 4930434H03Rik, Ssb2, 5830411E10Rik, 4930442A21Rik, 4930488J04Rik, 4933440J18Rik, Nbp1, Obfc2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 109019
Homologene: 57094
Name: dual specificity phosphatase 7
Synonyms: PYST2, MKP-X
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235584
Homologene: 1468
Name: seminal vesicle secretory protein 2
Synonyms: semenoclotin, SVS II
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 53878
Homologene: 49325
Name: transmembrane protein 37
Synonyms: Pr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 170706
Homologene: 10447
Name: testis expressed gene 101
Synonyms: 1700008H15Rik, TES101RP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 56746
Homologene: 10555
Name: proline synthetase co-transcribed, opposite strand
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Name: keratin associated protein 4-13
Synonyms: 2300006N05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 69464
Homologene: 124486
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 36,778,458 bp
  • A to T, chromosome 1 at 51,474,602 bp
  • A to G, chromosome 1 at 53,427,951 bp
  • T to A, chromosome 1 at 72,647,184 bp
  • G to A, chromosome 1 at 90,939,386 bp
  • A to T, chromosome 1 at 120,068,249 bp
  • A to G, chromosome 1 at 140,523,148 bp
  • G to A, chromosome 1 at 162,134,480 bp
  • G to A, chromosome 1 at 172,325,809 bp
  • T to A, chromosome 1 at 188,395,874 bp
  • T to A, chromosome 2 at 4,896,760 bp
  • C to T, chromosome 2 at 29,148,615 bp
  • G to A, chromosome 2 at 34,727,243 bp
  • C to A, chromosome 2 at 59,795,835 bp
  • A to G, chromosome 2 at 69,489,129 bp
  • G to T, chromosome 2 at 164,237,747 bp
  • C to T, chromosome 3 at 105,658,766 bp
  • G to T, chromosome 3 at 108,346,678 bp
  • A to G, chromosome 3 at 157,962,302 bp
  • T to C, chromosome 4 at 55,012,981 bp
  • T to C, chromosome 4 at 116,553,038 bp
  • C to T, chromosome 4 at 116,741,712 bp
  • A to G, chromosome 4 at 144,158,128 bp
  • A to G, chromosome 4 at 148,951,855 bp
  • T to A, chromosome 4 at 155,955,258 bp
  • A to T, chromosome 5 at 4,755,865 bp
  • G to A, chromosome 5 at 18,015,366 bp
  • A to G, chromosome 5 at 24,591,831 bp
  • A to G, chromosome 5 at 103,569,860 bp
  • A to G, chromosome 5 at 104,177,406 bp
  • C to T, chromosome 5 at 114,124,226 bp
  • T to C, chromosome 5 at 120,733,481 bp
  • G to A, chromosome 5 at 131,472,275 bp
  • T to A, chromosome 6 at 42,141,498 bp
  • G to T, chromosome 7 at 24,668,368 bp
  • A to T, chromosome 7 at 58,807,438 bp
  • G to T, chromosome 7 at 75,666,553 bp
  • A to G, chromosome 7 at 76,413,685 bp
  • ATGGCG to ATGGCGACGGTGGCG, chromosome 7 at 97,579,904 bp
  • T to C, chromosome 7 at 104,160,893 bp
  • T to A, chromosome 7 at 105,754,355 bp
  • C to T, chromosome 8 at 27,042,985 bp
  • T to A, chromosome 8 at 58,427,823 bp
  • T to C, chromosome 8 at 110,978,713 bp
  • A to G, chromosome 8 at 117,447,411 bp
  • A to G, chromosome 9 at 36,894,413 bp
  • T to C, chromosome 9 at 54,946,516 bp
  • G to A, chromosome 9 at 59,869,664 bp
  • A to T, chromosome 9 at 65,279,880 bp
  • T to C, chromosome 9 at 70,579,369 bp
  • A to G, chromosome 9 at 105,654,899 bp
  • T to A, chromosome 9 at 106,370,766 bp
  • G to A, chromosome 9 at 121,454,425 bp
  • A to G, chromosome 10 at 88,778,261 bp
  • C to T, chromosome 10 at 103,221,427 bp
  • A to G, chromosome 10 at 106,836,044 bp
  • TGGACCACTCCAGGACCACTC to TGGACCACTC, chromosome 11 at 62,265,382 bp
  • C to T, chromosome 11 at 76,509,019 bp
  • T to C, chromosome 11 at 78,957,591 bp
  • G to A, chromosome 11 at 87,231,530 bp
  • A to C, chromosome 11 at 99,809,528 bp
  • A to G, chromosome 11 at 100,121,224 bp
  • C to T, chromosome 11 at 118,303,772 bp
  • A to G, chromosome 11 at 120,465,784 bp
  • T to A, chromosome 12 at 38,781,314 bp
  • A to T, chromosome 12 at 84,325,736 bp
  • T to C, chromosome 13 at 63,068,092 bp
  • A to T, chromosome 13 at 75,769,574 bp
  • A to T, chromosome 15 at 4,759,868 bp
  • A to G, chromosome 15 at 44,484,400 bp
  • A to G, chromosome 15 at 48,011,209 bp
  • T to A, chromosome 15 at 53,719,671 bp
  • C to T, chromosome 15 at 89,146,376 bp
  • C to T, chromosome 15 at 101,846,187 bp
  • C to T, chromosome 16 at 3,839,087 bp
  • T to G, chromosome 16 at 45,417,908 bp
  • C to G, chromosome 17 at 12,232,504 bp
  • C to T, chromosome 17 at 19,531,954 bp
  • T to C, chromosome 17 at 19,793,696 bp
  • A to T, chromosome 17 at 23,835,491 bp
  • T to C, chromosome 17 at 31,064,473 bp
  • T to C, chromosome 17 at 85,083,231 bp
  • A to G, chromosome 19 at 55,314,309 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4632 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
041897-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.