Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4726Btlr/Mmmh
Stock Number:
041989-MU
Citation ID:
RRID:MMRRC_041989-MU
Other Names:
R4726 (G1), C57BL/6J-MtgxR4726Btlr
Major Collection:

Strain Information

Kcnj10
Name: potassium inwardly-rectifying channel, subfamily J, member 10
Synonyms: Kir1.2, BIRK-1, BIR10, Kir4.1, Kir4.1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16513
HGNC: HGNC:6256
Homologene: 1689
Mtmr3
Name: myotubularin related protein 3
Synonyms: FYVE-DSP1, 1700092A20Rik, ZFYVE10
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74302
HGNC: HGNC:7451
Homologene: 23662
Nae1
Name: NEDD8 activating enzyme E1 subunit 1
Synonyms: Appbp1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234664
HGNC: HGNC:621
Homologene: 68370
Ptprf
Name: protein tyrosine phosphatase receptor type F
Synonyms: LAR, RPTP-LAR
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19268
HGNC: HGNC:9670
Homologene: 20623
Scrib
Name: scribbled planar cell polarity
Synonyms: Scrb1, Crc
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105782
Homologene: 44228
Adgrl3
Name: adhesion G protein-coupled receptor L3
Synonyms: lectomedin 3, LEC3, D130075K09Rik, 5430402I23Rik, Lphn3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319387
Homologene: 22878
Map3k4
Name: mitogen-activated protein kinase kinase kinase 4
Synonyms: MTK1, MAPKKK4, D17Rp17, RP17, D17Rp17e, Mekk4, T-associated sex reversal, Tas
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 26407
VEGA: 17
HGNC: HGNC:6856
Homologene: 31346
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 93,301,749 bp
  • A to G, chromosome 1 at 172,369,072 bp
  • G to A, chromosome 2 at 25,408,945 bp
  • T to A, chromosome 2 at 68,263,303 bp
  • T to A, chromosome 2 at 79,662,757 bp
  • A to G, chromosome 2 at 86,456,236 bp
  • T to A, chromosome 2 at 91,204,277 bp
  • T to C, chromosome 2 at 121,361,231 bp
  • A to G, chromosome 3 at 88,336,451 bp
  • A to G, chromosome 3 at 90,393,777 bp
  • A to T, chromosome 3 at 130,519,781 bp
  • GAAGTTGTTTGGAGATTCTTATCTTA to GA, chromosome 3 at 158,318,408 bp
  • C to T, chromosome 4 at 49,654,579 bp
  • A to G, chromosome 4 at 58,844,191 bp
  • C to A, chromosome 4 at 88,842,282 bp
  • A to G, chromosome 4 at 118,212,217 bp
  • T to C, chromosome 4 at 133,277,664 bp
  • C to T, chromosome 4 at 135,807,275 bp
  • C to A, chromosome 4 at 139,482,579 bp
  • T to C, chromosome 5 at 36,608,008 bp
  • C to A, chromosome 5 at 81,646,578 bp
  • A to G, chromosome 5 at 92,411,143 bp
  • A to G, chromosome 6 at 24,633,111 bp
  • A to T, chromosome 6 at 65,075,041 bp
  • T to C, chromosome 6 at 89,322,816 bp
  • C to A, chromosome 6 at 130,157,663 bp
  • A to G, chromosome 6 at 130,580,171 bp
  • A to C, chromosome 7 at 4,237,958 bp
  • A to T, chromosome 7 at 13,472,995 bp
  • G to A, chromosome 7 at 44,190,396 bp
  • T to C, chromosome 8 at 80,789,053 bp
  • A to G, chromosome 8 at 104,511,191 bp
  • A to T, chromosome 8 at 104,616,032 bp
  • T to C, chromosome 8 at 106,878,086 bp
  • A to T, chromosome 9 at 18,444,960 bp
  • T to C, chromosome 9 at 44,243,666 bp
  • A to G, chromosome 9 at 62,920,489 bp
  • T to A, chromosome 9 at 89,089,485 bp
  • T to A, chromosome 9 at 92,263,168 bp
  • A to G, chromosome 9 at 102,723,819 bp
  • A to G, chromosome 10 at 63,397,308 bp
  • G to A, chromosome 10 at 127,694,593 bp
  • A to G, chromosome 10 at 129,261,176 bp
  • A to T, chromosome 11 at 4,507,634 bp
  • G to T, chromosome 11 at 71,181,406 bp
  • C to T, chromosome 12 at 3,501,872 bp
  • T to A, chromosome 12 at 7,990,267 bp
  • T to C, chromosome 12 at 86,721,875 bp
  • C to A, chromosome 12 at 117,247,773 bp
  • T to C, chromosome 13 at 54,718,539 bp
  • A to T, chromosome 13 at 120,173,637 bp
  • T to C, chromosome 14 at 25,643,674 bp
  • T to C, chromosome 14 at 30,889,835 bp
  • G to T, chromosome 14 at 66,148,896 bp
  • A to G, chromosome 14 at 70,313,599 bp
  • A to G, chromosome 15 at 75,326,728 bp
  • A to T, chromosome 15 at 76,072,334 bp
  • T to A, chromosome 15 at 82,306,054 bp
  • A to G, chromosome 15 at 101,678,085 bp
  • G to A, chromosome 16 at 21,448,404 bp
  • G to T, chromosome 16 at 43,822,801 bp
  • A to G, chromosome 16 at 49,014,070 bp
  • A to G, chromosome 16 at 62,822,132 bp
  • G to A, chromosome 16 at 72,972,043 bp
  • T to C, chromosome 17 at 12,232,964 bp
  • A to G, chromosome 17 at 18,316,698 bp
  • T to A, chromosome 17 at 55,898,260 bp
  • T to C, chromosome 17 at 64,834,453 bp
  • A to C, chromosome 17 at 65,970,324 bp
  • T to C, chromosome 18 at 57,287,792 bp
  • C to A, chromosome 19 at 5,719,176 bp
  • T to A, chromosome 19 at 13,411,105 bp
  • T to A, chromosome 19 at 34,611,460 bp
  • T to C, chromosome 19 at 43,832,114 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4726 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The submitter or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041989-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.