Strain Name:
C57BL/6J-MtgxR4726Btlr/Mmmh
Stock Number:
041989-MU
Citation ID:
RRID:MMRRC_041989-MU
Other Names:
R4726 (G1), C57BL/6J-MtgxR4726Btlr
Major Collection:

Gene Information

Kcnj10
Name: potassium inwardly-rectifying channel, subfamily J, member 10
Synonyms: Kir1.2, BIR10, BIRK-1, Kir4.1, Kir4.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16513
HGNC: HGNC:6256
Homologene: 1689
Mtmr3
Name: myotubularin related protein 3
Synonyms: 1700092A20Rik, FYVE-DSP1, ZFYVE10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 74302
HGNC: HGNC:7451
Homologene: 23662
Nae1
Name: NEDD8 activating enzyme E1 subunit 1
Synonyms: Appbp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234664
HGNC: HGNC:621
Homologene: 68370
Ptprf
Name: protein tyrosine phosphatase, receptor type, F
Synonyms: RPTP-LAR, LAR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 19268
HGNC: HGNC:9670
Homologene: 20623
Scrib
Name: scribbled planar cell polarity
Synonyms: Crc, Scrb1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 105782
Homologene: 44228
Adgrl3
Name: adhesion G protein-coupled receptor L3
Synonyms: Lphn3, LEC3, lectomedin 3, 5430402I23Rik, D130075K09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 319387
Homologene: 22878
Map3k4
Name: mitogen-activated protein kinase kinase kinase 4
Synonyms: MAPKKK4, RP17, D17Rp17e, Tas, Mekk4, MTK1, D17Rp17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 26407
VEGA: 17
HGNC: HGNC:6856
Homologene: 31346
Smarcad1
Name: SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1
Synonyms: Etl1, D6Pas1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 13990
Homologene: 5301
Ankrd12
Name: ankyrin repeat domain 12
Synonyms: GAC-1, ANCO-2, 2900001A12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 106585
Homologene: 9059
Asxl2
Name: additional sex combs like 2, transcriptional regulator
Synonyms: 4930556B16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 75302
Homologene: 10102
Ints3
Name: integrator complex subunit 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229543
Homologene: 11309
Plxna1
Name: plexin A1
Synonyms: NOV, 2600013D04Rik, Plxn1, PlexA1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 18844
HGNC: HGNC:9099
Homologene: 56426
Rnf20
Name: ring finger protein 20
Synonyms: 4833430L21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 109331
Homologene: 5571
Wasl
Name: WASP like actin nucleation promoting factor
Synonyms: 2900021I12Rik, Wiskott-Aldrich syndrome-like (human), N-WASP, 3110031I02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 73178
Homologene: 135996
Itprid2
Name: ITPR interacting domain containing 2
Synonyms: CS1, SPAG13, Ssfa2, KRAP, CS-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 70599
Homologene: 4912
Gab1
Name: growth factor receptor bound protein 2-associated protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 14388
HGNC: HGNC:4066
Homologene: 1542
Pias1
Name: protein inhibitor of activated STAT 1
Synonyms: Ddxbp1, 2900068C24Rik, GBP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 56469
VEGA: 9
HGNC: HGNC:2752
Homologene: 22953
Cip2a
Name: cell proliferation regulating inhibitor of protein phosphatase 2A
Synonyms: C330027C09Rik, Cip2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 224171
Homologene: 10842
Stk39
Name: serine/threonine kinase 39
Synonyms: SPAK, DCHT, RF005, Rnl5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 53416
Homologene: 22739
Vps8
Name: VPS8 CORVET complex subunit
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 209018
Homologene: 44592
Ecpas
Name: Ecm29 proteasome adaptor and scaffold
Synonyms: AI314180
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230249
Homologene: 6056
Robo1
Name: roundabout guidance receptor 1
Synonyms: DUTT1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 19876
Homologene: 2206
Ckmt1
Name: creatine kinase, mitochondrial 1, ubiquitous
Synonyms: mi-CK, UbCKmit, Mt-CK
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 12716
Homologene: 69058
Chrna2
Name: cholinergic receptor, nicotinic, alpha polypeptide 2 (neuronal)
Synonyms: Acra2, Acra-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 110902
HGNC: HGNC:1956
Homologene: 20193
Apob
Name: apolipoprotein B
Synonyms: apob-100, apob-48
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238055
HGNC: HGNC:603
Homologene: 328
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: D930005K06Rik, p600, LOC381562, 1810009A16Rik, A930005E13Rik, Zubr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 69116
Homologene: 10804
Slc39a14
Name: solute carrier family 39 (zinc transporter), member 14
Synonyms: Zip14, G630015O18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 213053
Homologene: 15037
D5Ertd579e
Name: DNA segment, Chr 5, ERATO Doi 579, expressed
Synonyms: A930018H20Rik, 9030221A05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 320661
Homologene: 19716
Drd3
Name: dopamine receptor D3
Synonyms: D3R, D3 receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 13490
VEGA: 16
HGNC: HGNC:3024
Homologene: 623
Amotl2
Name: angiomotin-like 2
Synonyms: MASCOT, Lccp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 56332
Homologene: 9420
Smg5
Name: Smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229512
Homologene: 9095
Dnajc12
Name: DnaJ heat shock protein family (Hsp40) member C12
Synonyms: Jdp1, J domain protein 1, mJDP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 30045
Homologene: 8492
Zmiz1
Name: zinc finger, MIZ-type containing 1
Synonyms: Zimp10, Rai17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 328365
Homologene: 10667
Bsph1
Name: binder of sperm protein homolog 1
Synonyms: LOC330470
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 330470
Homologene: 86818
Has3
Name: hyaluronan synthase 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 15118
HGNC: HGNC:4820
Homologene: 68461
Nlrp1b
Name: NLR family, pyrin domain containing 1B
Synonyms: Nalp1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 637515
Homologene: 19080
Art3
Name: ADP-ribosyltransferase 3
Synonyms: 4930569O04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 109979
HGNC: HGNC:725
Homologene: 911
Cdh16
Name: cadherin 16
Synonyms: KSP-cadherin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12556
HGNC: HGNC:1755
Homologene: 2997
Megf10
Name: multiple EGF-like-domains 10
Synonyms: 3000002B06Rik, LOC240312
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 70417
Homologene: 23771
Lrrc7
Name: leucine rich repeat containing 7
Synonyms: densin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 242274
Homologene: 10817
Cdhr2
Name: cadherin-related family member 2
Synonyms: Pcdh24, LOC268663
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 268663
Homologene: 134510
Ptprn2
Name: protein tyrosine phosphatase, receptor type, N polypeptide 2
Synonyms: IA-2 beta, IA-2beta, phogrin, 4930425H11Rik, PTP-NP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 19276
HGNC: HGNC:9677
Homologene: 2134
Vmn2r93
Name: vomeronasal 2, receptor 93
Synonyms: EG627132
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 627132
Homologene: 129750
Zfp959
Name: zinc finger protein 959
Synonyms: BC011426
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224893
Homologene: 138295
Wbp2nl
Name: WBP2 N-terminal like
Synonyms: 4930521I23Rik, PAWP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 74716
VEGA: 15
Homologene: 17633
Abcc2
Name: ATP-binding cassette, sub-family C (CFTR/MRP), member 2
Synonyms: multidrug resistance protein 2, Cmoat, Mrp2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 12780
HGNC: HGNC:53
Homologene: 68052
Myom3
Name: myomesin family, member 3
Synonyms: 8430427K15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242702
Homologene: 19432
Itih4
Name: inter alpha-trypsin inhibitor, heavy chain 4
Synonyms: Itih-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 16427
HGNC: HGNC:6169
Homologene: 1670
Ehbp1l1
Name: EH domain binding protein 1-like 1
Synonyms: G430002G23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 114601
VEGA: 19
Homologene: 136059
Olfr1066
Name: olfactory receptor 1066
Synonyms: GA_x6K02T2Q125-47925557-47924616, MOR188-8, MOR256-52P
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 257880
Homologene: 79468
Lilra5
Name: leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5
Synonyms: Gm4878
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 232801
Homologene: 83297
Trim43b
Name: tripartite motif-containing 43B
Synonyms: Gm8269
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 666747
Homologene: 105432
Tmem222
Name: transmembrane protein 222
Synonyms: 5730406H10Rik, D4Ertd196e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 52174
Homologene: 11999
Krt6b
Name: keratin 6B
Synonyms: Krt2-6b, mK6[b]
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 16688
VEGA: 15
Homologene: 136794
Angel1
Name: angel homolog 1
Synonyms: 1110030H02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 68737
Homologene: 32251
Col25a1
Name: collagen, type XXV, alpha 1
Synonyms: 2700062B08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 77018
Homologene: 57111
Plscr1
Name: phospholipid scramblase 1
Synonyms: MmTRA1a, MmTRA1b, TRA1, Tras1, MuPLSCR2, Tras2, NOR1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 22038
HGNC: HGNC:9092
Homologene: 41418
Npdc1
Name: neural proliferation, differentiation and control 1
Synonyms: NPDC-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18146
HGNC: HGNC:7899
Homologene: 32050
Stx19
Name: syntaxin 19
Synonyms: A030009B12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 68159
Homologene: 55777
Olfr1469
Name: olfactory receptor 1469
Synonyms: MOR202-11, GA_x6K02T2RE5P-3743369-3744289
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 258690
HGNC: HGNC:8324
Homologene: 133675
Acp2
Name: acid phosphatase 2, lysosomal
Synonyms: Acp-2, LAP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 11432
HGNC: HGNC:123
Homologene: 1217
Nemp1
Name: nuclear envelope integral membrane protein 1
Synonyms: Tmem194
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 210035
Homologene: 18346
Ccdc153
Name: coiled-coil domain containing 153
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 270150
VEGA: 9
Homologene: 26818
Klk1b24
Name: kallikrein 1-related peptidase b24
Synonyms: mGk-24, Klk24
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16617
HGNC: HGNC:6364
Homologene: 68141
Ifna4
Name: interferon alpha 4
Synonyms: Ifa4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 15967
Ifit3b
Name: interferon-induced protein with tetratricopeptide repeats 3B
Synonyms: I830012O16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 667370
HGNC: HGNC:5411
Homologene: 1189
Olfr776
Name: olfactory receptor 776
Synonyms: MOR111-12, GA_x6K02T2PULF-10947193-10948131
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 404321
Homologene: 115559
4930583I09Rik
Name: RIKEN cDNA 4930583I09 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 78057
VEGA: 17
Mbd3l2
Name: methyl-CpG binding domain protein 3-like 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 234988
VEGA: 9
Homologene: 44896
Klra14-ps
Name: killer cell lectin-like receptor subfamily A, member 14, pseudogene
Synonyms: Gm15858, Ly49N, Klra14, EG654449
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 654449
Mterf4
Name: mitochondrial transcription termination factor 4
Synonyms: 4933412H03Rik, Mterfd2, 1810059A23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 69821
Homologene: 45600
Gm26996
Name: predicted gene, 26996
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Gm21818
Name: predicted gene, 21818
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 102640804
VEGA: 13
Gm28113
Name: predicted gene 28113
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 93,301,749 bp
  • A to G, chromosome 1 at 172,369,072 bp
  • G to A, chromosome 2 at 25,408,945 bp
  • T to A, chromosome 2 at 68,263,303 bp
  • T to A, chromosome 2 at 79,662,757 bp
  • A to G, chromosome 2 at 86,456,236 bp
  • T to A, chromosome 2 at 91,204,277 bp
  • T to C, chromosome 2 at 121,361,231 bp
  • A to G, chromosome 3 at 88,336,451 bp
  • A to G, chromosome 3 at 90,393,777 bp
  • A to T, chromosome 3 at 130,519,781 bp
  • GAAGTTGTTTGGAGATTCTTATCTTA to GA, chromosome 3 at 158,318,408 bp
  • C to T, chromosome 4 at 49,654,579 bp
  • A to G, chromosome 4 at 58,844,191 bp
  • C to A, chromosome 4 at 88,842,282 bp
  • A to G, chromosome 4 at 118,212,217 bp
  • T to C, chromosome 4 at 133,277,664 bp
  • C to T, chromosome 4 at 135,807,275 bp
  • C to A, chromosome 4 at 139,482,579 bp
  • T to C, chromosome 5 at 36,608,008 bp
  • C to A, chromosome 5 at 81,646,578 bp
  • A to G, chromosome 5 at 92,411,143 bp
  • A to G, chromosome 6 at 24,633,111 bp
  • A to T, chromosome 6 at 65,075,041 bp
  • T to C, chromosome 6 at 89,322,816 bp
  • C to A, chromosome 6 at 130,157,663 bp
  • A to G, chromosome 6 at 130,580,171 bp
  • A to C, chromosome 7 at 4,237,958 bp
  • A to T, chromosome 7 at 13,472,995 bp
  • G to A, chromosome 7 at 44,190,396 bp
  • T to C, chromosome 8 at 80,789,053 bp
  • A to G, chromosome 8 at 104,511,191 bp
  • A to T, chromosome 8 at 104,616,032 bp
  • T to C, chromosome 8 at 106,878,086 bp
  • A to T, chromosome 9 at 18,444,960 bp
  • T to C, chromosome 9 at 44,243,666 bp
  • A to G, chromosome 9 at 62,920,489 bp
  • T to A, chromosome 9 at 89,089,485 bp
  • T to A, chromosome 9 at 92,263,168 bp
  • A to G, chromosome 9 at 102,723,819 bp
  • A to G, chromosome 10 at 63,397,308 bp
  • G to A, chromosome 10 at 127,694,593 bp
  • A to G, chromosome 10 at 129,261,176 bp
  • A to T, chromosome 11 at 4,507,634 bp
  • G to T, chromosome 11 at 71,181,406 bp
  • C to T, chromosome 12 at 3,501,872 bp
  • T to A, chromosome 12 at 7,990,267 bp
  • T to C, chromosome 12 at 86,721,875 bp
  • C to A, chromosome 12 at 117,247,773 bp
  • T to C, chromosome 13 at 54,718,539 bp
  • A to T, chromosome 13 at 120,173,637 bp
  • T to C, chromosome 14 at 25,643,674 bp
  • T to C, chromosome 14 at 30,889,835 bp
  • G to T, chromosome 14 at 66,148,896 bp
  • A to G, chromosome 14 at 70,313,599 bp
  • A to G, chromosome 15 at 75,326,728 bp
  • A to T, chromosome 15 at 76,072,334 bp
  • T to A, chromosome 15 at 82,306,054 bp
  • A to G, chromosome 15 at 101,678,085 bp
  • G to A, chromosome 16 at 21,448,404 bp
  • G to T, chromosome 16 at 43,822,801 bp
  • A to G, chromosome 16 at 49,014,070 bp
  • A to G, chromosome 16 at 62,822,132 bp
  • G to A, chromosome 16 at 72,972,043 bp
  • T to C, chromosome 17 at 12,232,964 bp
  • A to G, chromosome 17 at 18,316,698 bp
  • T to A, chromosome 17 at 55,898,260 bp
  • T to C, chromosome 17 at 64,834,453 bp
  • A to C, chromosome 17 at 65,970,324 bp
  • T to C, chromosome 18 at 57,287,792 bp
  • C to A, chromosome 19 at 5,719,176 bp
  • T to A, chromosome 19 at 13,411,105 bp
  • T to A, chromosome 19 at 34,611,460 bp
  • T to C, chromosome 19 at 43,832,114 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4726 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
041989-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.