Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4755Btlr/Mmmh
Stock Number:
042033-MU
Citation ID:
RRID:MMRRC_042033-MU
Other Names:
R4755 (G1), C57BL/6J-MtgxR4755Btlr
Major Collection:

Strain Information

Sphk2
Name: sphingosine kinase 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56632
Homologene: 32456
Sipa1l1
Name: signal-induced proliferation-associated 1 like 1
Synonyms: 4931426N11Rik, Spar
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217692
VEGA: 12
Homologene: 9189
Rps23rg1
Name: ribosomal protein S23, retrogene 1
Synonyms: C330021F23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 546049
Homologene: 134322
Trp53bp1
Name: transformation related protein 53 binding protein 1
Synonyms: 53BP1, p53BP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27223
Homologene: 4137
Wnk1
Name: WNK lysine deficient protein kinase 1
Synonyms: 6430573H23Rik, Prkwnk1, EG406236, Hsn2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232341
Homologene: 14253
Shroom3
Name: shroom family member 3
Synonyms: D5Ertd287e, Shrm, Shrm3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 27428
Homologene: 9263
Rangap1
Name: RAN GTPase activating protein 1
Synonyms: Fug1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 19387
VEGA: 15
HGNC: HGNC:9854
Homologene: 55700
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 74,928,361 bp
  • T to C, chromosome 1 at 82,541,174 bp
  • T to A, chromosome 1 at 130,210,264 bp
  • T to A, chromosome 1 at 140,088,808 bp
  • A to T, chromosome 1 at 156,687,496 bp
  • T to C, chromosome 1 at 162,888,805 bp
  • G to A, chromosome 1 at 171,607,238 bp
  • T to C, chromosome 2 at 41,269,273 bp
  • T to A, chromosome 2 at 41,471,016 bp
  • T to C, chromosome 2 at 52,220,209 bp
  • T to A, chromosome 2 at 62,296,988 bp
  • T to C, chromosome 2 at 93,841,337 bp
  • T to A, chromosome 2 at 121,228,606 bp
  • T to A, chromosome 2 at 154,319,694 bp
  • G to A, chromosome 2 at 155,299,186 bp
  • A to G, chromosome 2 at 181,234,224 bp
  • A to G, chromosome 3 at 36,080,188 bp
  • T to A, chromosome 3 at 59,825,859 bp
  • C to T, chromosome 3 at 59,936,314 bp
  • G to A, chromosome 3 at 82,094,795 bp
  • T to C, chromosome 3 at 93,938,786 bp
  • A to G, chromosome 3 at 102,158,292 bp
  • C to G, chromosome 4 at 41,610,269 bp
  • A to G, chromosome 4 at 70,238,425 bp
  • A to G, chromosome 4 at 101,174,157 bp
  • C to T, chromosome 4 at 101,550,799 bp
  • C to T, chromosome 4 at 117,003,321 bp
  • C to T, chromosome 4 at 129,578,342 bp
  • A to T, chromosome 4 at 141,928,483 bp
  • C to T, chromosome 4 at 156,173,522 bp
  • A to T, chromosome 5 at 14,714,348 bp
  • A to T, chromosome 5 at 31,145,982 bp
  • A to G, chromosome 5 at 52,404,151 bp
  • A to T, chromosome 5 at 72,246,166 bp
  • G to T, chromosome 5 at 92,943,086 bp
  • A to T, chromosome 5 at 104,435,215 bp
  • T to A, chromosome 5 at 108,801,700 bp
  • T to C, chromosome 5 at 110,841,461 bp
  • G to A, chromosome 5 at 112,874,474 bp
  • A to G, chromosome 5 at 124,747,745 bp
  • G to A, chromosome 5 at 144,546,440 bp
  • T to C, chromosome 5 at 145,715,506 bp
  • A to C, chromosome 5 at 150,398,254 bp
  • T to A, chromosome 5 at 150,559,987 bp
  • A to G, chromosome 6 at 13,205,852 bp
  • G to A, chromosome 6 at 43,174,043 bp
  • T to A, chromosome 6 at 53,818,464 bp
  • A to G, chromosome 6 at 63,908,988 bp
  • T to G, chromosome 6 at 83,711,397 bp
  • C to T, chromosome 6 at 113,842,142 bp
  • C to A, chromosome 6 at 119,963,470 bp
  • G to A, chromosome 6 at 121,325,049 bp
  • G to A, chromosome 6 at 122,456,406 bp
  • A to T, chromosome 7 at 5,147,026 bp
  • T to A, chromosome 7 at 25,225,639 bp
  • T to G, chromosome 7 at 27,703,505 bp
  • T to A, chromosome 7 at 32,325,531 bp
  • T to A, chromosome 7 at 43,590,793 bp
  • G to A, chromosome 7 at 45,713,634 bp
  • A to G, chromosome 7 at 99,925,723 bp
  • T to C, chromosome 7 at 101,843,799 bp
  • T to A, chromosome 7 at 104,580,061 bp
  • A to G, chromosome 7 at 143,806,913 bp
  • A to T, chromosome 8 at 3,583,922 bp
  • A to G, chromosome 8 at 23,104,974 bp
  • A to T, chromosome 8 at 82,769,386 bp
  • C to A, chromosome 8 at 93,535,677 bp
  • A to G, chromosome 8 at 105,452,144 bp
  • A to T, chromosome 9 at 18,857,180 bp
  • A to G, chromosome 9 at 38,665,832 bp
  • C to A, chromosome 9 at 75,597,212 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • C to T, chromosome 9 at 97,445,673 bp
  • A to T, chromosome 9 at 102,720,480 bp
  • C to A, chromosome 9 at 108,814,739 bp
  • A to G, chromosome 10 at 21,055,047 bp
  • A to T, chromosome 10 at 30,834,304 bp
  • A to C, chromosome 10 at 76,186,564 bp
  • A to T, chromosome 10 at 79,549,197 bp
  • A to T, chromosome 10 at 93,846,906 bp
  • A to G, chromosome 10 at 127,715,688 bp
  • A to T, chromosome 11 at 3,244,016 bp
  • A to C, chromosome 11 at 61,490,843 bp
  • A to T, chromosome 11 at 73,345,756 bp
  • A to G, chromosome 11 at 83,429,367 bp
  • A to T, chromosome 11 at 87,771,663 bp
  • T to C, chromosome 11 at 90,685,116 bp
  • G to A, chromosome 11 at 94,653,833 bp
  • C to T, chromosome 11 at 102,406,666 bp
  • C to T, chromosome 11 at 105,364,476 bp
  • T to A, chromosome 12 at 31,869,406 bp
  • T to A, chromosome 12 at 51,610,216 bp
  • A to G, chromosome 12 at 55,712,748 bp
  • C to A, chromosome 12 at 76,327,807 bp
  • T to G, chromosome 12 at 81,950,294 bp
  • G to A, chromosome 12 at 82,372,386 bp
  • G to A, chromosome 12 at 115,623,558 bp
  • C to A, chromosome 13 at 13,189,385 bp
  • T to A, chromosome 13 at 21,468,287 bp
  • A to T, chromosome 13 at 24,979,688 bp
  • T to A, chromosome 13 at 24,979,692 bp
  • A to T, chromosome 13 at 52,641,986 bp
  • A to T, chromosome 13 at 104,230,871 bp
  • A to T, chromosome 13 at 104,249,512 bp
  • G to A, chromosome 14 at 53,506,061 bp
  • G to A, chromosome 14 at 53,640,780 bp
  • A to C, chromosome 14 at 57,618,181 bp
  • A to T, chromosome 14 at 64,030,070 bp
  • A to T, chromosome 14 at 70,184,099 bp
  • T to A, chromosome 15 at 58,640,211 bp
  • T to C, chromosome 15 at 76,249,242 bp
  • T to C, chromosome 15 at 81,712,917 bp
  • C to A, chromosome 16 at 26,722,782 bp
  • T to C, chromosome 16 at 36,722,021 bp
  • T to A, chromosome 17 at 36,118,945 bp
  • T to A, chromosome 17 at 57,052,794 bp
  • T to G, chromosome 19 at 10,897,790 bp
  • A to T, chromosome 19 at 26,654,483 bp
  • T to A, chromosome 19 at 44,301,352 bp
  • T to C, chromosome 19 at 58,453,244 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4755 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042033-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.