Strain Name:
C57BL/6J-MtgxR4755Btlr/Mmmh
Stock Number:
042033-MU
Citation ID:
RRID:MMRRC_042033-MU
Other Names:
R4755 (G1), C57BL/6J-MtgxR4755Btlr
Major Collection:

Strain Information

Sphk2
Name: sphingosine kinase 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 56632
Homologene: 32456
Sipa1l1
Name: signal-induced proliferation-associated 1 like 1
Synonyms: 4931426N11Rik, Spar
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217692
VEGA: 12
Homologene: 9189
Rps23rg1
Name: ribosomal protein S23, retrogene 1
Synonyms: C330021F23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 546049
Homologene: 134322
Trp53bp1
Name: transformation related protein 53 binding protein 1
Synonyms: 53BP1, p53BP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 27223
Homologene: 4137
Wnk1
Name: WNK lysine deficient protein kinase 1
Synonyms: 6430573H23Rik, Prkwnk1, EG406236, Hsn2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232341
Homologene: 14253
Shroom3
Name: shroom family member 3
Synonyms: D5Ertd287e, Shrm, Shrm3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 27428
Homologene: 9263
Rangap1
Name: RAN GTPase activating protein 1
Synonyms: Fug1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 19387
VEGA: 15
HGNC: HGNC:9854
Homologene: 55700
Agrn
Name: agrin
Synonyms: NMF380, Agrin, nmf380
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 11603
HGNC: HGNC:329
Homologene: 27907
Vangl1
Name: VANGL planar cell polarity 1
Synonyms: Lpp2, mStbm, stbm, KITENIN
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229658
Homologene: 44540
Fry
Name: FRY microtubule binding protein
Synonyms: cg003, 9330186A19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 320365
Homologene: 113770
Cdk5rap2
Name: CDK5 regulatory subunit associated protein 2
Synonyms: 2900018K03Rik, an
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 214444
Homologene: 49533
Eif4enif1
Name: eukaryotic translation initiation factor 4E nuclear import factor 1
Synonyms: Clast4, 2610509L04Rik, D11Ertd166e, A930019J01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 74203
Homologene: 10522
Xpo4
Name: exportin 4
Synonyms: B430309A01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 57258
Homologene: 10733
Rnf169
Name: ring finger protein 169
Synonyms: 2900057K09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 108937
Homologene: 47510
Cog5
Name: component of oligomeric golgi complex 5
Synonyms: GOLTC1, GTC90, 5430405C01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238123
VEGA: 12
Homologene: 42221
Chek2
Name: checkpoint kinase 2
Synonyms: CHK2, Rad53
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 50883
Homologene: 38289
Ralgapa1
Name: Ral GTPase activating protein, alpha subunit 1
Synonyms: 4930400K19Rik, Tulip1, 2310003F20Rik, Garnl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 56784
VEGA: 12
Homologene: 84805
Strn3
Name: striatin, calmodulin binding protein 3
Synonyms: SG2NA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 94186
VEGA: 12
Homologene: 82078
Zfp719
Name: zinc finger protein 719
Synonyms: C630016O21Rik, mszf6, 9430094P17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 210105
Ahi1
Name: Abelson helper integration site 1
Synonyms: Ahi-1, 1700015F03Rik, D10Bwg0629e, Jouberin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 52906
VEGA: 10
Homologene: 9762
Mier2
Name: MIER family member 2
Synonyms: 2700087H15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 70427
Homologene: 18941
Gucy1a1
Name: guanylate cyclase 1, soluble, alpha 1
Synonyms: alpha 1 sGC, 1200016O07Rik, sGC-alpha1, Gucy1a3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 60596
HGNC: HGNC:4685
Homologene: 37360
Hey2
Name: hairy/enhancer-of-split related with YRPW motif 2
Synonyms: CHF1, Hrt2, Herp1, Hesr2, bHLHb32
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 15214
HGNC: HGNC:4881
Homologene: 22705
Jak1
Name: Janus kinase 1
Synonyms: C130039L05Rik, BAP004
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 16451
HGNC: HGNC:6190
Homologene: 1678
Nptx2
Name: neuronal pentraxin 2
Synonyms: np2, narp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 53324
HGNC: HGNC:7953
Homologene: 1892
Akap5
Name: A kinase anchor protein 5
Synonyms: LOC238276, AKAP150, 3526401B18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238276
HGNC: HGNC:375
Homologene: 15854
Brca2
Name: breast cancer 2, early onset
Synonyms: RAB163, Fancd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 12190
HGNC: HGNC:1101
Homologene: 41
Hectd3
Name: HECT domain E3 ubiquitin protein ligase 3
Synonyms: 1700064K09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 76608
Homologene: 18426
Cenpk
Name: centromere protein K
Synonyms: C530004N04Rik, B130045K24Rik, Solt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 60411
VEGA: 13
Homologene: 11035
Amotl2
Name: angiomotin-like 2
Synonyms: Lccp, MASCOT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 56332
Homologene: 9420
Atp2b2
Name: ATPase, Ca++ transporting, plasma membrane 2
Synonyms: PMCA2, D6Abb2e, wms, jog, Tmy, Gena300
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 11941
HGNC: HGNC:815
Homologene: 56150
Col4a4
Name: collagen, type IV, alpha 4
Synonyms: [a]4(IV), E130010M05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12829
HGNC: HGNC:2206
Homologene: 20071
Grina
Name: glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)
Synonyms: 1110025J15Rik, Tmbim3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 66168
VEGA: 15
HGNC: HGNC:4589
Homologene: 41517
Syk
Name: spleen tyrosine kinase
Synonyms: Sykb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 20963
Homologene: 2390
Dnajc6
Name: DnaJ heat shock protein family (Hsp40) member C6
Synonyms: 2810027M23Rik, auxilin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 72685
Homologene: 8865
Ank1
Name: ankyrin 1, erythroid
Synonyms: Ank-1, pale
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 11733
HGNC: HGNC:492
Homologene: 55427
Scd2
Name: stearoyl-Coenzyme A desaturase 2
Synonyms: Scd-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 20250
VEGA: 19
Homologene: 136612
Dnah10
Name: dynein, axonemal, heavy chain 10
Synonyms: Dnahc10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 56087
HGNC: HGNC:2941
Homologene: 25816
Fer1l6
Name: fer-1 like family member 6
Synonyms: EG631797
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 631797
Homologene: 53396
Helz2
Name: helicase with zinc finger 2, transcriptional coactivator
Synonyms: BC006779
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 229003
Homologene: 14118
Neb
Name: nebulin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Fhad1
Name: forkhead-associated phosphopeptide binding domain 1
Synonyms: 2900090M10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 329977
Homologene: 77947
Gpld1
Name: glycosylphosphatidylinositol specific phospholipase D1
Synonyms: 6330541J12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 14756
HGNC: HGNC:4459
Homologene: 1152
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Nadsyn1
Name: NAD synthetase 1
Synonyms: 9130012B15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 78914
Homologene: 6098
Tril
Name: TLR4 interactor with leucine-rich repeats
Synonyms: 1200009O22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 66873
Homologene: 69404
Accs
Name: 1-aminocyclopropane-1-carboxylate synthase (inactive)
Synonyms: 2610203E10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 329470
Homologene: 75335
Gas2l2
Name: growth arrest-specific 2 like 2
Synonyms: OTTMUSG00000000934
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237891
Homologene: 16409
Cd109
Name: CD109 antigen
Synonyms: Gov platelet alloantigens, 9930012E15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235505
Homologene: 25183
Slc5a4a
Name: solute carrier family 5, member 4a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 64452
VEGA: 10
Tom1l1
Name: target of myb1-like 1 (chicken)
Synonyms: 2310045L10Rik, Srcasm
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 71943
Homologene: 38055
Fmo2
Name: flavin containing monooxygenase 2
Synonyms: 2310008D08Rik, 2310042I22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 55990
HGNC: HGNC:3770
Homologene: 86882
Slc25a39
Name: solute carrier family 25, member 39
Synonyms: 3010027G13Rik, D11Ertd333e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 68066
Homologene: 69200
Cfap65
Name: cilia and flagella associated protein 65
Synonyms: B230363K08Rik, Ccdc108
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241116
Homologene: 28093
Slc4a10
Name: solute carrier family 4, sodium bicarbonate cotransporter-like, member 10
Synonyms: NCBE
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 94229
Homologene: 23340
Rp1l1
Name: retinitis pigmentosa 1 homolog like 1
Synonyms: Dcdc4, Rp1hl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 271209
VEGA: 14
Homologene: 105870
Pcnx
Name: pecanex homolog
Synonyms: 3526401J03Rik, 2900024E21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 54604
VEGA: 12
Homologene: 40997
Vwde
Name: von Willebrand factor D and EGF domains
Synonyms: LOC232585
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232585
Homologene: 35456
Acad9
Name: acyl-Coenzyme A dehydrogenase family, member 9
Synonyms: NPD002, 2600017P15Rik, C630012L17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229211
Homologene: 8539
Aadacl2fm1
Name: AADACL2 family member 1
Synonyms: C130079G13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229333
Fam20b
Name: FAM20B, glycosaminoglycan xylosylkinase
Synonyms: C530043G21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 215015
Homologene: 8909
Myo1a
Name: myosin IA
Synonyms: BBM-I, brush border myosin 1, Myhl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 432516
VEGA: 10
HGNC: HGNC:7595
Homologene: 21113
Dnai1
Name: dynein axonemal intermediate chain 1
Synonyms: 1110066F04Rik, Dnaic1, b2b1526Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 68922
HGNC: HGNC:2954
Homologene: 8122
Ces5a
Name: carboxylesterase 5A
Synonyms: LOC244598, 1700081L16Rik, 1700122C07Rik, cauxin, Ces7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 67935
Homologene: 74305
Grid2
Name: glutamate receptor, ionotropic, delta 2
Synonyms: GluRdelta2, tpr, B230104L07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 14804
HGNC: HGNC:4576
Homologene: 74399
Or7g17
Name: olfactory receptor family 7 subfamily G member 17
Synonyms: GA_x6K02T2PVTD-12599710-12600648, MOR147-1, Olfr829
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 259070
Homologene: 138324
Spata22
Name: spermatogenesis associated 22
Synonyms: LOC380709
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 380709
Homologene: 13076
Ildr1
Name: immunoglobulin-like domain containing receptor 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 106347
Homologene: 15892
Prl2c5
Name: prolactin family 2, subfamily c, member 5
Synonyms: MRP-4, PLF-4, Mrpplf4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 107849
HGNC: HGNC:9445
Homologene: 40763
Prpf19
Name: pre-mRNA processing factor 19
Synonyms: PSO4, D19Wsu55e, Prp19, Snev
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 28000
Homologene: 6421
Thsd7b
Name: thrombospondin, type I, domain containing 7B
Synonyms: 1700074E13Rik, D130067I03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 210417
Homologene: 18180
Smarca2
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
Synonyms: brm, Snf2l2, 2610209L14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 67155
Homologene: 2308
Marchf10
Name: membrane associated ring-CH-type finger 10
Synonyms: 4933417C16Rik, Rnf190, OTTMUSG00000002847, March10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 632687
Homologene: 34988
Slc6a13
Name: solute carrier family 6 (neurotransmitter transporter, GABA), member 13
Synonyms: Gabt3, Gat2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 14412
Homologene: 9592
Ccdc149
Name: coiled-coil domain containing 149
Synonyms: LOC242997, Gm447
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100503884
Homologene: 65264
Bpifb9b
Name: BPI fold containing family B, member 9B
Synonyms: OTTMUSG00000015915, 5430413K10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 433492
Homologene: 128535
Rimklb
Name: ribosomal modification protein rimK-like family member B
Synonyms: 4931417E21Rik, 4933426K21Rik, NAAGS
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 108653
Homologene: 18968
Gfra1
Name: glial cell line derived neurotrophic factor family receptor alpha 1
Synonyms: GDNFR-alpha, GFR alpha-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 14585
HGNC: HGNC:4243
Homologene: 3855
Cfh
Name: complement component factor h
Synonyms: Mud-1, Sas-1, Sas1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12628
Homologene: 20086
Myo18b
Name: myosin XVIIIb
Synonyms: 4932408L24Rik, 4933411E19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 74376
Homologene: 53435
Or2a7
Name: olfactory receptor family 2 subfamily A member 7
Synonyms: MOR261-6, GA_x6K02T2P3E9-4384160-4383228, Olfr13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 18310
Homologene: 27232
Il1rap
Name: interleukin 1 receptor accessory protein
Synonyms: IL-1R AcP, IL-1RAcP, 6430709H04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 16180
HGNC: HGNC:5995
Homologene: 1643
H2-T10
Name: histocompatibility 2, T region locus 10
Synonyms: H-2T10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 15024
Vax2
Name: ventral anterior homeobox 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 24113
Homologene: 8048
Vmn2r8
Name: vomeronasal 2, receptor 8
Synonyms: EG627479
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 627479
Homologene: 129606
Or52d3
Name: olfactory receptor family 52 subfamily D member 3
Synonyms: GA_x6K02T2PBJ9-7206970-7207923, MOR33-1, Olfr653
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 57250
Homologene: 115518
Tspoap1
Name: TSPO associated protein 1
Synonyms: peripheral, Bzrap1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 207777
Homologene: 37961
Zfp330
Name: zinc finger protein 330
Synonyms: nucleolar autoantigen 36, NOA 36, Noa36
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 30932
Homologene: 8714
Zfp526
Name: zinc finger protein 526
Synonyms: D030024H03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 210172
Homologene: 18447
Usp44
Name: ubiquitin specific peptidase 44
Synonyms: E430004F17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 327799
VEGA: 10
Homologene: 12961
Cyp3a41a
Name: cytochrome P450, family 3, subfamily a, polypeptide 41A
Synonyms: steroid inducible, Cyp3a41
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 53973
Homologene: 133568
Or8b52
Name: olfactory receptor family 8 subfamily B member 52
Synonyms: GA_x6K02T2PVTD-32368166-32367237, MOR168-2P, Olfr917
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258183
VEGA: 9
Sorbs3
Name: sorbin and SH3 domain containing 3
Synonyms: SH3P3, vinexin alpha, vinexin beta, Sh3d4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 20410
VEGA: 14
Homologene: 4218
Tmod2
Name: tropomodulin 2
Synonyms: NTMOD, N-Tmod, neural tropomodulin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 50876
VEGA: 9
Homologene: 22817
Ly9
Name: lymphocyte antigen 9
Synonyms: T100, Lgp100, CD229, SLAMF3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 17085
HGNC: HGNC:6730
Homologene: 1759
Fam167b
Name: family with sequence similarity 167, member B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230766
Homologene: 13085
Clstn2
Name: calsyntenin 2
Synonyms: CS2, 2900042C18Rik, Cst-2, CSTN2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 64085
Homologene: 49698
Nckipsd
Name: NCK interacting protein with SH3 domain
Synonyms: WISH, SPIN90, AF3P21, ORF1, DIP1, Wasbp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 80987
Homologene: 9514
Nkapl
Name: NFKB activating protein-like
Synonyms: 4921504I05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 66707
Homologene: 57034
Zfp607b
Name: zinc finger protein 607B
Synonyms: C030039L03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 112415
Homologene: 134321
Slc25a23
Name: solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23
Synonyms: 2310067G05Rik, SCaMC-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 66972
Homologene: 11467
Atp10d
Name: ATPase, class V, type 10D
Synonyms: IMAGE:1069176, D5Buc24e, 9830145H18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231287
Mrpl27
Name: mitochondrial ribosomal protein L27
Synonyms: D11Moh47
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 94064
Homologene: 9543
Mapk7
Name: mitogen-activated protein kinase 7
Synonyms: ERK5, BMK1, big MAP kinase 1, Erk5-T, b2b2346Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 23939
HGNC: HGNC:6880
Homologene: 2060
Lrrc36
Name: leucine rich repeat containing 36
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 270091
Homologene: 23090
Pigu
Name: phosphatidylinositol glycan anchor biosynthesis, class U
Synonyms: 5430426F17Rik, Cdc91l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228812
Homologene: 6553
Mpv17
Name: MpV17 mitochondrial inner membrane protein
Synonyms: Tg.Mpv17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 17527
HGNC: HGNC:7224
Homologene: 39746
Vmn1r55
Name: vomeronasal 1 receptor 55
Synonyms: LOC236535, LOC384522, V1rd5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 384522
Homologene: 41799
Scgb2b12
Name: secretoglobin, family 2B, member 12
Synonyms: Gm9138, Abpbg12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 668379
Homologene: 83171
Folr2
Name: folate receptor beta
Synonyms: FBP2, FR-P3, Folbp2, Folbp2, Folbp-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 14276
Homologene: 627
4930449A18Rik
Name: RIKEN cDNA 4930449A18 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Gm26954
Name: predicted gene, 26954
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Trav10
Name: T cell receptor alpha variable 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 667765
Tdpoz9-ps1
Name: TD and POZ domain containing 9, pseudogene 1
Synonyms: Gm9117
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 668346
RP24-299A7.2
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Ighv1-69
Name: immunoglobulin heavy variable 1-69
Synonyms: Gm16708
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 619833
Trav14-2
Name: T cell receptor alpha variable 14-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 667567
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 74,928,361 bp
  • T to C, chromosome 1 at 82,541,174 bp
  • T to A, chromosome 1 at 130,210,264 bp
  • T to A, chromosome 1 at 140,088,808 bp
  • A to T, chromosome 1 at 156,687,496 bp
  • T to C, chromosome 1 at 162,888,805 bp
  • G to A, chromosome 1 at 171,607,238 bp
  • T to C, chromosome 2 at 41,269,273 bp
  • T to A, chromosome 2 at 41,471,016 bp
  • T to C, chromosome 2 at 52,220,209 bp
  • T to A, chromosome 2 at 62,296,988 bp
  • T to C, chromosome 2 at 93,841,337 bp
  • T to A, chromosome 2 at 121,228,606 bp
  • T to A, chromosome 2 at 154,319,694 bp
  • G to A, chromosome 2 at 155,299,186 bp
  • A to G, chromosome 2 at 181,234,224 bp
  • A to G, chromosome 3 at 36,080,188 bp
  • T to A, chromosome 3 at 59,825,859 bp
  • C to T, chromosome 3 at 59,936,314 bp
  • G to A, chromosome 3 at 82,094,795 bp
  • T to C, chromosome 3 at 93,938,786 bp
  • A to G, chromosome 3 at 102,158,292 bp
  • C to G, chromosome 4 at 41,610,269 bp
  • A to G, chromosome 4 at 70,238,425 bp
  • A to G, chromosome 4 at 101,174,157 bp
  • C to T, chromosome 4 at 101,550,799 bp
  • C to T, chromosome 4 at 117,003,321 bp
  • C to T, chromosome 4 at 129,578,342 bp
  • A to T, chromosome 4 at 141,928,483 bp
  • C to T, chromosome 4 at 156,173,522 bp
  • A to T, chromosome 5 at 14,714,348 bp
  • A to T, chromosome 5 at 31,145,982 bp
  • A to G, chromosome 5 at 52,404,151 bp
  • A to T, chromosome 5 at 72,246,166 bp
  • G to T, chromosome 5 at 92,943,086 bp
  • A to T, chromosome 5 at 104,435,215 bp
  • T to A, chromosome 5 at 108,801,700 bp
  • T to C, chromosome 5 at 110,841,461 bp
  • G to A, chromosome 5 at 112,874,474 bp
  • A to G, chromosome 5 at 124,747,745 bp
  • G to A, chromosome 5 at 144,546,440 bp
  • T to C, chromosome 5 at 145,715,506 bp
  • A to C, chromosome 5 at 150,398,254 bp
  • T to A, chromosome 5 at 150,559,987 bp
  • A to G, chromosome 6 at 13,205,852 bp
  • G to A, chromosome 6 at 43,174,043 bp
  • T to A, chromosome 6 at 53,818,464 bp
  • A to G, chromosome 6 at 63,908,988 bp
  • T to G, chromosome 6 at 83,711,397 bp
  • C to T, chromosome 6 at 113,842,142 bp
  • C to A, chromosome 6 at 119,963,470 bp
  • G to A, chromosome 6 at 121,325,049 bp
  • G to A, chromosome 6 at 122,456,406 bp
  • A to T, chromosome 7 at 5,147,026 bp
  • T to A, chromosome 7 at 25,225,639 bp
  • T to G, chromosome 7 at 27,703,505 bp
  • T to A, chromosome 7 at 32,325,531 bp
  • T to A, chromosome 7 at 43,590,793 bp
  • G to A, chromosome 7 at 45,713,634 bp
  • A to G, chromosome 7 at 99,925,723 bp
  • T to C, chromosome 7 at 101,843,799 bp
  • T to A, chromosome 7 at 104,580,061 bp
  • A to G, chromosome 7 at 143,806,913 bp
  • A to T, chromosome 8 at 3,583,922 bp
  • A to G, chromosome 8 at 23,104,974 bp
  • A to T, chromosome 8 at 82,769,386 bp
  • C to A, chromosome 8 at 93,535,677 bp
  • A to G, chromosome 8 at 105,452,144 bp
  • A to T, chromosome 9 at 18,857,180 bp
  • A to G, chromosome 9 at 38,665,832 bp
  • C to A, chromosome 9 at 75,597,212 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • C to T, chromosome 9 at 97,445,673 bp
  • A to T, chromosome 9 at 102,720,480 bp
  • C to A, chromosome 9 at 108,814,739 bp
  • A to G, chromosome 10 at 21,055,047 bp
  • A to T, chromosome 10 at 30,834,304 bp
  • A to C, chromosome 10 at 76,186,564 bp
  • A to T, chromosome 10 at 79,549,197 bp
  • A to T, chromosome 10 at 93,846,906 bp
  • A to G, chromosome 10 at 127,715,688 bp
  • A to T, chromosome 11 at 3,244,016 bp
  • A to C, chromosome 11 at 61,490,843 bp
  • A to T, chromosome 11 at 73,345,756 bp
  • A to G, chromosome 11 at 83,429,367 bp
  • A to T, chromosome 11 at 87,771,663 bp
  • T to C, chromosome 11 at 90,685,116 bp
  • G to A, chromosome 11 at 94,653,833 bp
  • C to T, chromosome 11 at 102,406,666 bp
  • C to T, chromosome 11 at 105,364,476 bp
  • T to A, chromosome 12 at 31,869,406 bp
  • T to A, chromosome 12 at 51,610,216 bp
  • A to G, chromosome 12 at 55,712,748 bp
  • C to A, chromosome 12 at 76,327,807 bp
  • T to G, chromosome 12 at 81,950,294 bp
  • G to A, chromosome 12 at 82,372,386 bp
  • G to A, chromosome 12 at 115,623,558 bp
  • C to A, chromosome 13 at 13,189,385 bp
  • T to A, chromosome 13 at 21,468,287 bp
  • A to T, chromosome 13 at 24,979,688 bp
  • T to A, chromosome 13 at 24,979,692 bp
  • A to T, chromosome 13 at 52,641,986 bp
  • A to T, chromosome 13 at 104,230,871 bp
  • A to T, chromosome 13 at 104,249,512 bp
  • G to A, chromosome 14 at 53,506,061 bp
  • G to A, chromosome 14 at 53,640,780 bp
  • A to C, chromosome 14 at 57,618,181 bp
  • A to T, chromosome 14 at 64,030,070 bp
  • A to T, chromosome 14 at 70,184,099 bp
  • T to A, chromosome 15 at 58,640,211 bp
  • T to C, chromosome 15 at 76,249,242 bp
  • T to C, chromosome 15 at 81,712,917 bp
  • C to A, chromosome 16 at 26,722,782 bp
  • T to C, chromosome 16 at 36,722,021 bp
  • T to A, chromosome 17 at 36,118,945 bp
  • T to A, chromosome 17 at 57,052,794 bp
  • T to G, chromosome 19 at 10,897,790 bp
  • A to T, chromosome 19 at 26,654,483 bp
  • T to A, chromosome 19 at 44,301,352 bp
  • T to C, chromosome 19 at 58,453,244 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4755 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042033-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.