Strain Name:
C57BL/6J-MtgxR4821Btlr/Mmmh
Stock Number:
042437-MU
Citation ID:
RRID:MMRRC_042437-MU
Other Names:
R4821 (G1), C57BL/6J-MtgxR4821Btlr
Major Collection:

Strain Information

Chd7
Name: chromodomain helicase DNA binding protein 7
Synonyms: GENA 47, Gena 52, GENA 60, Cyn, A730019I05Rik, WBE1, Whi, Todo, Obt, Mt, Lda, Flo, Edy, Dz, Cycn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 320790
Homologene: 19067
Nae1
Name: NEDD8 activating enzyme E1 subunit 1
Synonyms: Appbp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234664
HGNC: HGNC:621
Homologene: 68370
Ccdc88c
Name: coiled-coil domain containing 88C
Synonyms: Daple, 0610010D24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 68339
VEGA: 12
Homologene: 18903
Ppcdc
Name: phosphopantothenoylcysteine decarboxylase
Synonyms: 8430432M10Rik, 1810057I13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 66812
VEGA: 9
Homologene: 11049
Ddx1
Name: DEAD box helicase 1
Synonyms: DEAD (Asp-Glu-Ala-Asp) box polypeptide 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 104721
VEGA: 12
HGNC: HGNC:2734
Homologene: 3627
Ncapg2
Name: non-SMC condensin II complex, subunit G2
Synonyms: Mtb, 5830426I05Rik, Luzp5, mCAP-G2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 76044
VEGA: 12
Homologene: 9820
Baz2a
Name: bromodomain adjacent to zinc finger domain, 2A
Synonyms: Tip5, Walp3, C030005G16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 116848
VEGA: 10
HGNC: HGNC:962
Homologene: 8393
Akap13
Name: A kinase anchor protein 13
Synonyms: AKAP-Lbc, PROTO-LBC, PROTO-LB, Ht31, 5730522G15Rik, 1700026G02Rik, 5830460E08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Rabgap1
Name: RAB GTPase activating protein 1
Synonyms: Gapcena
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227800
Homologene: 49301
Ywhaq
Name: tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta
Synonyms: 14-3-3 theta, 2700028P07Rik, 14-3-3 tau
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 22630
Homologene: 105677
Prr13
Name: proline rich 13
Synonyms: 2010324E22Rik, 1110020C13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 66151
Homologene: 134002
Pot1b
Name: protection of telomeres 1B
Synonyms: 2810458H16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 72836
VEGA: 17
Homologene: 87058
Kctd4
Name: potassium channel tetramerisation domain containing 4
Synonyms: 2210017A09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 67516
VEGA: 14
Homologene: 36441
Acaca
Name: acetyl-Coenzyme A carboxylase alpha
Synonyms: acetyl-CoA carboxylase, Acc1, LOC327983, Acac, A530025K05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 107476
HGNC: HGNC:84
Homologene: 31015
Zfp992
Name: zinc finger protein 992
Synonyms: Gm13251
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 433791
Homologene: 133076
Adam33
Name: a disintegrin and metallopeptidase domain 33
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 110751
Homologene: 11881
Lcn6
Name: lipocalin 6
Synonyms: 9230101D24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 620709
Homologene: 45707
Aak1
Name: AP2 associated kinase 1
Synonyms: 5530400K14Rik, D6Ertd245e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 269774
Homologene: 128746
Zfp346
Name: zinc finger protein 346
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 26919
Homologene: 8073
Usp33
Name: ubiquitin specific peptidase 33
Synonyms: Vdu1, 9830169D19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 170822
Homologene: 8996
Lonrf1
Name: LON peptidase N-terminal domain and ring finger 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244421
Homologene: 34980
Mecom
Name: MDS1 and EVI1 complex locus
Synonyms: ZNFPR1B1, Prdm3, MDS1-EVI1, Evi-1, D630039M04Rik, Jbo, Evi1, Mds1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 14013
HGNC: HGNC:3498
Homologene: 21086
Skic2
Name: SKI2 subunit of superkiller complex
Synonyms: Ski2w, 4930534J06Rik, Skiv2l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 108077
Homologene: 123971
Mcu
Name: mitochondrial calcium uniporter
Synonyms: 2010012O16Rik, D130073L02Rik, Ccdc109a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 215999
Homologene: 9916
Nkx2-2
Name: NK2 homeobox 2
Synonyms: tinman, Nkx-2.2, Nkx2.2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18088
HGNC: HGNC:7835
Homologene: 1879
Cacna1c
Name: calcium channel, voltage-dependent, L type, alpha 1C subunit
Synonyms: (alpha)1 subunit, Cchl1a1, Cav1.2, L-type Cav1.2, D930026N18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 12288
HGNC: HGNC:1390
Homologene: 55484
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Acz, Pico
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 26875
Homologene: 69111
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Col12a1
Name: collagen, type XII, alpha 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12816
HGNC: HGNC:2188
Homologene: 3217
Abca4
Name: ATP-binding cassette, sub-family A member 4
Synonyms: Rim protein, RmP, Abc10, D430003I15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 11304
HGNC: HGNC:34
Homologene: 298
Ush2a
Name: usherin
Synonyms: MUSH2A, A930011D15Rik, LOC381317, LOC269160, A930037M10Rik, Ushrn, Ush2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 22283
Homologene: 66151
Dennd4a
Name: DENN domain containing 4A
Synonyms: F730015K02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 102442
VEGA: 9
Homologene: 55933
Hfm1
Name: HFM1, ATP-dependent DNA helicase homolog
Synonyms: LOC381663, A330009G12Rik, Sec63d1, Mer3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 330149
Homologene: 87103
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 380698
Homologene: 70869
Farp2
Name: FERM, RhoGEF and pleckstrin domain protein 2
Synonyms: Fir, D030026M03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227377
Homologene: 8877
Baalc
Name: brain and acute leukemia, cytoplasmic
Synonyms: 2810457D07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 118452
VEGA: 15
Homologene: 11732
Abcb9
Name: ATP-binding cassette, sub-family B member 9
Synonyms: TAPL
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 56325
HGNC: HGNC:50
Homologene: 10491
Cpd
Name: carboxypeptidase D
Synonyms: D830034L15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 12874
HGNC: HGNC:2301
Homologene: 999
Or4k39
Name: olfactory receptor family 4 subfamily K member 39, pseudogene 1
Synonyms: GA_x6K02T2Q125-72459956-72460837, MOR248-25_p, MOR248-17P, Olfr1285
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 545447
Commd3
Name: COMM domain containing 3
Synonyms: D2Ertd542e, Bup
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 12238
Homologene: 15693
Cap2
Name: cyclase associated actin cytoskeleton regulatory protein 2
Synonyms: 2810452G09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 67252
Homologene: 101397
Mybpc1
Name: myosin binding protein C, slow-type
Synonyms: Slow-type C-protein, 8030451F13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 109272
HGNC: HGNC:7549
Homologene: 1846
Nrxn3
Name: neurexin III
Synonyms: neurexin III beta, neurexin III alpha, neurexin III beta, neurexin III alpha, 9330112C09Rik, D12Bwg0831e, 4933401A11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 18191
HGNC: HGNC:8010
Homologene: 83225
Vmn2r94
Name: vomeronasal 2, receptor 94
Synonyms: EG665227
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 665227
Homologene: 129751
Rap1gap
Name: Rap1 GTPase-activating protein
Synonyms: 2310004O14Rik, 1300019I11Rik, Rap1ga1, Gap
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 110351
HGNC: HGNC:9858
Homologene: 2163
Cpeb2
Name: cytoplasmic polyadenylation element binding protein 2
Synonyms: A630055H10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231207
Homologene: 17995
Cyp2c65
Name: cytochrome P450, family 2, subfamily c, polypeptide 65
Synonyms: 2210009K14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 72303
Homologene: 133566
Zbbx
Name: zinc finger, B-box domain containing
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 213234
Homologene: 11661
Zfp616
Name: zinc finger protein 616
Synonyms: Gm12330
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 327963
Homologene: 88945
Krt7
Name: keratin 7
Synonyms: K7, D15Wsu77e, Cytokeratin 7, Krt2-7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 110310
HGNC: HGNC:6445
Homologene: 4058
Ccdc57
Name: coiled-coil domain containing 57
Synonyms: 4933434G05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 71276
Homologene: 52351
Rgs6
Name: regulator of G-protein signaling 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 50779
Homologene: 68385
Frk
Name: fyn-related kinase
Synonyms: BSK/IYK, GTK
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 14302
VEGA: 10
HGNC: HGNC:3955
Homologene: 48065
Ebf4
Name: early B cell factor 4
Synonyms: Olf-1/EBF-like 4, O/E-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228598
Homologene: 65064
Or4z4
Name: olfactory receptor family 4 subfamily Z member 4
Synonyms: GA_x6K02T2RE5P-2458473-2457538, MOR239-4, Olfr1427
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 258674
Homologene: 128080
Gpr45
Name: G protein-coupled receptor 45
Synonyms: PSP24alpha, 9230112G11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 93690
HGNC: HGNC:4503
Homologene: 5228
Sun5
Name: Sad1 and UNC84 domain containing 5
Synonyms: 1700021O15Rik, Spag4l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 76407
Homologene: 12640
4921539E11Rik
Name: RIKEN cDNA 4921539E11 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 70941
Homologene: 52843
Or11g24
Name: olfactory receptor family 11 subfamily G member 24
Synonyms: GA_x6K02T2PMLR-6121675-6122604, MOR106-2, Olfr739
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 258663
Homologene: 121549
Bcs1l
Name: BCS1 homolog, ubiquinol-cytochrome c reductase complex chaperone
Synonyms: 9130022O19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 66821
HGNC: HGNC:1020
Homologene: 3193
Cfap210
Name: cilia and flagella associated protein 210
Synonyms: 4930525K21Rik, 4930578N16Rik, Ccdc173
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 75051
Homologene: 18989
Pcdhb6
Name: protocadherin beta 6
Synonyms: Pcdhb5B, PcdhbF
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93877
HGNC: HGNC:8690
Homologene: 62177
Potefam1
Name: POTE ankyrin domain family member 1
Synonyms: Pote1, 4930430A15Rik, A26c3, Potea
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 67575
Homologene: 69410
Adamtsl2
Name: ADAMTS-like 2
Synonyms: A930008K15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 77794
Homologene: 8798
Art1
Name: ADP-ribosyltransferase 1
Synonyms: ADPRT, Yac-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11870
HGNC: HGNC:723
Homologene: 128621
Trbv16
Name: T cell receptor beta, variable 16
Synonyms: Gm16776, Tcrb-V11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 100124680
Slc5a6
Name: solute carrier family 5 (sodium-dependent vitamin transporter), member 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 330064
Homologene: 23277
Tmco5b
Name: transmembrane and coiled-coil domains 5B
Synonyms: 4930563P21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 75275
Homologene: 52839
Tmed7
Name: transmembrane p24 trafficking protein 7
Synonyms: 5830493P14Rik, 3930401E15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 66676
Homologene: 45644
Gm5799
Name: predicted gene 5799
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 108168155
Ninj1
Name: ninjurin 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 18081
HGNC: HGNC:7824
Homologene: 88815
Gm26702
Name: predicted gene, 26702
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Gm10435
Name: predicted gene 10435
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Impdh2-ps
Name: inosine monophosphate dehydrogenase 2, pseudogene
Synonyms: ENSMUSG00000071041, Gm15210
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 100042069
Homologene: 48919
RP23-3L20.6
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Igkv4-57-1
Name: immunoglobulin kappa variable 4-57-1
Synonyms: LOC384514
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 384514
Rab10os
Name: RAB10, member RAS oncogene family, opposite strand
Synonyms: 1810036A22Rik, 1700012B15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 74173
Trav7d-2
Name: T cell receptor alpha variable 7D-2
Synonyms: Gm16483
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 100042410
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to G, chromosome 1 at 43,030,453 bp
  • A to G, chromosome 1 at 74,591,985 bp
  • A to G, chromosome 1 at 93,574,470 bp
  • T to C, chromosome 1 at 188,753,651 bp
  • T to C, chromosome 2 at 18,672,528 bp
  • G to A, chromosome 2 at 25,577,177 bp
  • T to A, chromosome 2 at 25,680,810 bp
  • T to A, chromosome 2 at 27,098,592 bp
  • T to C, chromosome 2 at 37,532,519 bp
  • T to C, chromosome 2 at 69,782,108 bp
  • T to C, chromosome 2 at 111,204,145 bp
  • T to C, chromosome 2 at 111,409,225 bp
  • T to C, chromosome 2 at 113,289,757 bp
  • G to A, chromosome 2 at 130,307,045 bp
  • G to A, chromosome 2 at 131,061,195 bp
  • A to T, chromosome 2 at 147,185,843 bp
  • C to T, chromosome 2 at 153,869,466 bp
  • C to A, chromosome 3 at 29,985,351 bp
  • G to A, chromosome 3 at 75,081,747 bp
  • C to T, chromosome 3 at 122,173,788 bp
  • TAAAACAAAACAAAACAAAACAAAACAAAACAAAACAAAACA to TAAAACAAAACAAAACAAAACAAAACAAAACAAAACAAAACAAAACA, chromosome 3 at 129,737,343 bp
  • T to C, chromosome 3 at 152,358,673 bp
  • T to A, chromosome 4 at 8,844,706 bp
  • T to C, chromosome 4 at 103,235,674 bp
  • T to C, chromosome 4 at 137,712,129 bp
  • C to T, chromosome 4 at 146,467,519 bp
  • C to T, chromosome 5 at 14,677,243 bp
  • T to A, chromosome 5 at 31,036,884 bp
  • C to A, chromosome 5 at 43,233,474 bp
  • C to T, chromosome 5 at 106,854,740 bp
  • T to C, chromosome 5 at 124,090,149 bp
  • T to A, chromosome 6 at 41,152,002 bp
  • T to A, chromosome 6 at 69,544,403 bp
  • T to C, chromosome 6 at 86,850,189 bp
  • T to C, chromosome 6 at 118,696,425 bp
  • A to G, chromosome 7 at 75,677,507 bp
  • T to A, chromosome 7 at 102,107,178 bp
  • T to C, chromosome 8 at 36,219,972 bp
  • A to G, chromosome 8 at 100,031,363 bp
  • A to C, chromosome 8 at 104,519,784 bp
  • C to T, chromosome 9 at 57,434,911 bp
  • G to A, chromosome 9 at 64,897,249 bp
  • A to T, chromosome 9 at 79,715,340 bp
  • T to C, chromosome 10 at 34,484,237 bp
  • C to T, chromosome 10 at 59,467,689 bp
  • T to C, chromosome 10 at 88,548,865 bp
  • A to G, chromosome 10 at 128,111,109 bp
  • C to T, chromosome 11 at 59,006,826 bp
  • A to T, chromosome 11 at 59,040,467 bp
  • C to T, chromosome 11 at 74,084,207 bp
  • T to C, chromosome 11 at 76,846,237 bp
  • A to G, chromosome 11 at 84,294,987 bp
  • A to G, chromosome 11 at 120,860,399 bp
  • T to A, chromosome 12 at 3,237,322 bp
  • T to C, chromosome 12 at 13,239,147 bp
  • T to C, chromosome 12 at 21,417,511 bp
  • A to T, chromosome 12 at 83,067,411 bp
  • C to T, chromosome 12 at 90,204,709 bp
  • T to C, chromosome 12 at 100,938,079 bp
  • T to G, chromosome 12 at 116,415,457 bp
  • C to A, chromosome 13 at 46,610,110 bp
  • T to C, chromosome 13 at 49,193,750 bp
  • G to T, chromosome 13 at 55,113,813 bp
  • A to G, chromosome 14 at 43,544,641 bp
  • A to G, chromosome 14 at 50,424,749 bp
  • A to G, chromosome 14 at 52,684,428 bp
  • G to A, chromosome 14 at 75,962,777 bp
  • A to G, chromosome 15 at 38,933,180 bp
  • G to A, chromosome 15 at 101,423,431 bp
  • A to T, chromosome 15 at 102,460,685 bp
  • T to C, chromosome 16 at 32,753,802 bp
  • C to A, chromosome 16 at 32,755,053 bp
  • T to A, chromosome 17 at 18,257,031 bp
  • G to A, chromosome 17 at 34,841,147 bp
  • A to G, chromosome 17 at 55,672,885 bp
  • C to A, chromosome 18 at 37,334,328 bp
  • G to A, chromosome 18 at 46,593,413 bp
  • T to A, chromosome 19 at 12,098,746 bp
  • A to G, chromosome 19 at 39,072,191 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4821 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042437-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.