Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4821Btlr/Mmmh
Stock Number:
042437-MU
Citation ID:
RRID:MMRRC_042437-MU
Other Names:
R4821 (G1), C57BL/6J-MtgxR4821Btlr
Major Collection:

Strain Information

Chd7
Name: chromodomain helicase DNA binding protein 7
Synonyms: GENA 60, GENA 47, Gena 52, Cyn, A730019I05Rik, WBE1, Whi, Todo, Obt, Mt, Lda, Flo, Edy, Dz, Cycn
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320790
Homologene: 19067
Nae1
Name: NEDD8 activating enzyme E1 subunit 1
Synonyms: Appbp1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234664
HGNC: HGNC:621
Homologene: 68370
Ccdc88c
Name: coiled-coil domain containing 88C
Synonyms: Daple, 0610010D24Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68339
VEGA: 12
Homologene: 18903
Ppcdc
Name: phosphopantothenoylcysteine decarboxylase
Synonyms: 8430432M10Rik, 1810057I13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66812
VEGA: 9
Homologene: 11049
Ddx1
Name: DEAD box helicase 1
Synonyms: DEAD (Asp-Glu-Ala-Asp) box polypeptide 1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104721
VEGA: 12
HGNC: HGNC:2734
Homologene: 3627
Ncapg2
Name: non-SMC condensin II complex, subunit G2
Synonyms: Mtb, 5830426I05Rik, Luzp5, mCAP-G2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76044
VEGA: 12
Homologene: 9820
Baz2a
Name: bromodomain adjacent to zinc finger domain, 2A
Synonyms: Tip5, Walp3, C030005G16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 116848
VEGA: 10
HGNC: HGNC:962
Homologene: 8393
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to G, chromosome 1 at 43,030,453 bp
  • A to G, chromosome 1 at 74,591,985 bp
  • A to G, chromosome 1 at 93,574,470 bp
  • T to C, chromosome 1 at 188,753,651 bp
  • T to C, chromosome 2 at 18,672,528 bp
  • G to A, chromosome 2 at 25,577,177 bp
  • T to A, chromosome 2 at 25,680,810 bp
  • T to A, chromosome 2 at 27,098,592 bp
  • T to C, chromosome 2 at 37,532,519 bp
  • T to C, chromosome 2 at 69,782,108 bp
  • T to C, chromosome 2 at 111,204,145 bp
  • T to C, chromosome 2 at 111,409,225 bp
  • T to C, chromosome 2 at 113,289,757 bp
  • G to A, chromosome 2 at 130,307,045 bp
  • G to A, chromosome 2 at 131,061,195 bp
  • A to T, chromosome 2 at 147,185,843 bp
  • C to T, chromosome 2 at 153,869,466 bp
  • C to A, chromosome 3 at 29,985,351 bp
  • G to A, chromosome 3 at 75,081,747 bp
  • C to T, chromosome 3 at 122,173,788 bp
  • TAAAACAAAACAAAACAAAACAAAACAAAACAAAACAAAACA to TAAAACAAAACAAAACAAAACAAAACAAAACAAAACAAAACAAAACA, chromosome 3 at 129,737,343 bp
  • T to C, chromosome 3 at 152,358,673 bp
  • T to A, chromosome 4 at 8,844,706 bp
  • T to C, chromosome 4 at 103,235,674 bp
  • T to C, chromosome 4 at 137,712,129 bp
  • C to T, chromosome 4 at 146,467,519 bp
  • C to T, chromosome 5 at 14,677,243 bp
  • T to A, chromosome 5 at 31,036,884 bp
  • C to A, chromosome 5 at 43,233,474 bp
  • C to T, chromosome 5 at 106,854,740 bp
  • T to C, chromosome 5 at 124,090,149 bp
  • T to A, chromosome 6 at 41,152,002 bp
  • T to A, chromosome 6 at 69,544,403 bp
  • T to C, chromosome 6 at 86,850,189 bp
  • T to C, chromosome 6 at 118,696,425 bp
  • A to G, chromosome 7 at 75,677,507 bp
  • T to A, chromosome 7 at 102,107,178 bp
  • T to C, chromosome 8 at 36,219,972 bp
  • A to G, chromosome 8 at 100,031,363 bp
  • A to C, chromosome 8 at 104,519,784 bp
  • C to T, chromosome 9 at 57,434,911 bp
  • G to A, chromosome 9 at 64,897,249 bp
  • A to T, chromosome 9 at 79,715,340 bp
  • T to C, chromosome 10 at 34,484,237 bp
  • C to T, chromosome 10 at 59,467,689 bp
  • T to C, chromosome 10 at 88,548,865 bp
  • A to G, chromosome 10 at 128,111,109 bp
  • C to T, chromosome 11 at 59,006,826 bp
  • A to T, chromosome 11 at 59,040,467 bp
  • C to T, chromosome 11 at 74,084,207 bp
  • T to C, chromosome 11 at 76,846,237 bp
  • A to G, chromosome 11 at 84,294,987 bp
  • A to G, chromosome 11 at 120,860,399 bp
  • T to A, chromosome 12 at 3,237,322 bp
  • T to C, chromosome 12 at 13,239,147 bp
  • T to C, chromosome 12 at 21,417,511 bp
  • A to T, chromosome 12 at 83,067,411 bp
  • C to T, chromosome 12 at 90,204,709 bp
  • T to C, chromosome 12 at 100,938,079 bp
  • T to G, chromosome 12 at 116,415,457 bp
  • C to A, chromosome 13 at 46,610,110 bp
  • T to C, chromosome 13 at 49,193,750 bp
  • G to T, chromosome 13 at 55,113,813 bp
  • A to G, chromosome 14 at 43,544,641 bp
  • A to G, chromosome 14 at 50,424,749 bp
  • A to G, chromosome 14 at 52,684,428 bp
  • G to A, chromosome 14 at 75,962,777 bp
  • A to G, chromosome 15 at 38,933,180 bp
  • G to A, chromosome 15 at 101,423,431 bp
  • A to T, chromosome 15 at 102,460,685 bp
  • T to C, chromosome 16 at 32,753,802 bp
  • C to A, chromosome 16 at 32,755,053 bp
  • T to A, chromosome 17 at 18,257,031 bp
  • G to A, chromosome 17 at 34,841,147 bp
  • A to G, chromosome 17 at 55,672,885 bp
  • C to A, chromosome 18 at 37,334,328 bp
  • G to A, chromosome 18 at 46,593,413 bp
  • T to A, chromosome 19 at 12,098,746 bp
  • A to G, chromosome 19 at 39,072,191 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4821 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042437-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.