Strain Name:
C57BL/6J-MtgxR4880Btlr/Mmmh
Stock Number:
042489-MU
Citation ID:
RRID:MMRRC_042489-MU
Other Names:
R4880 (G1), C57BL/6J-MtgxR4880Btlr
Major Collection:

Strain Information

Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: MyHC-I, Myhcb, Myhc-b, beta-MHC, betaMHC, B-MHC, MYH-beta/slow
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
Ifi203
Name: interferon activated gene 203
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 15950
Homologene: 115929
Rprd2
Name: regulation of nuclear pre-mRNA domain containing 2
Synonyms: 2810036A19Rik, 4930535B03Rik, 6720469I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 75137
Homologene: 19997
Slc4a7
Name: solute carrier family 4, sodium bicarbonate cotransporter, member 7
Synonyms: E430014N10Rik, NBCn1, NBC3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 218756
VEGA: 14
Homologene: 2680
Eif4a2
Name: eukaryotic translation initiation factor 4A2
Synonyms: 4833432N07Rik, Ddx2b, Eif4, BM-010
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 13682
HGNC: HGNC:3284
Homologene: 1487
Srpk1
Name: serine/arginine-rich protein specific kinase 1
Synonyms: SR protein-specific kinase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 20815
Homologene: 110962
Nsfl1c
Name: NSFL1 (p97) cofactor (p47)
Synonyms: p47
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 386649
Homologene: 41114
Cpne3
Name: copine III
Synonyms: PRO1071, 5730450C07Rik, CPN3, 5430428M23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 70568
HGNC: HGNC:2316
Homologene: 20839
Rpap1
Name: RNA polymerase II associated protein 1
Synonyms: A730023M06Rik, 1190005L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 68925
Homologene: 32269
Arih1
Name: ariadne RBR E3 ubiquitin protein ligase 1
Synonyms: UIP77
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 23806
HGNC: HGNC:689
Homologene: 111871
Vps53
Name: VPS53 GARP complex subunit
Synonyms: 2010002A08Rik, 3100002B05Rik, 2310040I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 68299
Homologene: 6264
2610021A01Rik
Name: RIKEN cDNA 2610021A01 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Dcaf8
Name: DDB1 and CUL4 associated factor 8
Synonyms: Wdr42a, D1Dau35e, D1Ucla4, H326
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98193
Homologene: 56725
Zfp64
Name: zinc finger protein 64
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22722
Homologene: 7604
Mreg
Name: melanoregulin
Synonyms: Wdt2, LOC381269, dsu
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 381269
Homologene: 9954
Pias1
Name: protein inhibitor of activated STAT 1
Synonyms: Ddxbp1, 2900068C24Rik, GBP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 56469
VEGA: 9
HGNC: HGNC:2752
Homologene: 22953
Lamb2
Name: laminin, beta 2
Synonyms: npht, Lamb-2, Lams
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 16779
HGNC: HGNC:6487
Homologene: 1723
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Slc7a6os
Name: solute carrier family 7, member 6 opposite strand
Synonyms: 2010007L18Rik, 2400002F02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 66432
Homologene: 41853
Ift74
Name: intraflagellar transport 74
Synonyms: Cmg1, 1700029H06Rik, b2b796Clo, Ccdc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 67694
Homologene: 11831
Rtn1
Name: reticulon 1
Synonyms: Rtn1-b, 0710005K15Rik, Rtn1-c, 4930441F12Rik, Rtn1-a, Nsp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 104001
Homologene: 49654
Lama5
Name: laminin, alpha 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16776
HGNC: HGNC:6485
Homologene: 4060
Itgb1
Name: integrin beta 1 (fibronectin receptor beta)
Synonyms: beta1 integrin, CD29, Fnrb, Gm9863, 4633401G24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 16412
HGNC: HGNC:6153
Homologene: 22999
Zfp59
Name: zinc finger protein 59
Synonyms: Mfg2, Mfg-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 22717
Homologene: 137243
Zfp410
Name: zinc finger protein 410
Synonyms: D12Ertd748e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 52708
VEGA: 12
Homologene: 10918
Riok2
Name: RIO kinase 2
Synonyms: 2010110K24Rik, 2410085M17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 67045
VEGA: 17
Homologene: 6760
Tm7sf3
Name: transmembrane 7 superfamily member 3
Synonyms: 2010003B14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 67623
Homologene: 9560
Tubb6
Name: tubulin, beta 6 class V
Synonyms: 2310057H16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 67951
VEGA: 18
Homologene: 69414
Zfp655
Name: zinc finger protein 655
Synonyms: 2700038I16Rik, 9030409O18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 72611
Homologene: 12473
Ccdc174
Name: coiled-coil domain containing 174
Synonyms: C130022K22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232236
Homologene: 9523
Camk1
Name: calcium/calmodulin-dependent protein kinase I
Synonyms: D6Ertd263e, Camk, CaMKIalpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 52163
HGNC: HGNC:1459
Homologene: 117458
Tns2
Name: tensin 2
Synonyms: Tenc1, nep, nph
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 209039
VEGA: 15
Homologene: 37077
Ttn
Name: titin
Synonyms: L56, 1100001C23Rik, D330041I19Rik, 2310057K23Rik, D830007G01Rik, 2310074I15Rik, 2310036G12Rik, mdm, connectin, shru
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Dchs1
Name: dachsous cadherin related 1
Synonyms: C130033F22Rik, 3110041P15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233651
Homologene: 2771
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: Cpfl8, Nesp2g, 6820443O06Rik, D12Ertd777e, nesprin-2, syne-2, dice, diminished cone electroretinogram
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 319565
Homologene: 56700
Tnfsf9
Name: tumor necrosis factor (ligand) superfamily, member 9
Synonyms: 4-1BB-L, 4-1BB ligand, 4-1BBL, Cd137l, Ly63l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 21950
VEGA: 17
Homologene: 137221
Zfp990
Name: zinc finger protein 990
Synonyms: Gm13225
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 101056073
Pcsk5
Name: proprotein convertase subtilisin/kexin type 5
Synonyms: b2b585Clo, SPC6, b2b1549Clo, PC6, PC5/6A, PC5A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 18552
VEGA: 19
HGNC: HGNC:8747
Homologene: 21244
Slc5a8
Name: solute carrier family 5 (iodide transporter), member 8
Synonyms: SMCT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216225
VEGA: 10
Homologene: 64832
Irs1
Name: insulin receptor substrate 1
Synonyms: IRS-1, G972R
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16367
HGNC: HGNC:6125
Homologene: 4049
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Ephb6
Name: Eph receptor B6
Synonyms: Cekl, Mep
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 13848
HGNC: HGNC:3396
Homologene: 20940
Hoxa7
Name: homeobox A7
Synonyms: Hox-1.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 15404
HGNC: HGNC:5108
Homologene: 56001
Nr1i3
Name: nuclear receptor subfamily 1, group I, member 3
Synonyms: mCAR, CAR1, CAR, ESTM32, Care2, MB67
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12355
HGNC: HGNC:7969
Homologene: 3759
Or8b54
Name: olfactory receptor family 8 subfamily B member 54
Synonyms: GA_x6K02T2PVTD-32478047-32478988, Olfr921, MOR165-8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258778
VEGA: 9
Homologene: 128138
Uroc1
Name: urocanase domain containing 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243537
Homologene: 76629
Kif9
Name: kinesin family member 9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 16578
Homologene: 65620
Htra1
Name: HtrA serine peptidase 1
Synonyms: RSPP11, HtrA1, insulin-like growth factor binding protein 5 protease, Prss11, L56
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 56213
HGNC: HGNC:9476
Homologene: 31114
Or13c3
Name: olfactory receptor family 13 subfamily C member 3
Synonyms: GA_x6K02T2N78B-7137430-7138383, MOR262-8, Olfr273
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 258821
Homologene: 73999
Klhl5
Name: kelch-like 5
Synonyms: 1300013C10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 71778
HGNC: HGNC:6356
Homologene: 56736
Cyp2d11
Name: cytochrome P450, family 2, subfamily d, polypeptide 11
Synonyms: P450-2D, Cyp2d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 545123
VEGA: 15
HGNC: HGNC:2625
Homologene: 86099
Bcl9l
Name: B cell CLL/lymphoma 9-like
Synonyms: DLNB11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 80288
VEGA: 9
Homologene: 65615
Gnptab
Name: N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
Synonyms: EG432486
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 432486
Homologene: 32576
Atf6b
Name: activating transcription factor 6 beta
Synonyms: Crebl1, ATF6beta, Creb-rp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 12915
HGNC: HGNC:2349
Homologene: 31238
Xkr7
Name: X-linked Kx blood group related 7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228787
Homologene: 19390
Rpl10a-ps2
Name: ribosomal protein L10A, pseudogene 2
Synonyms: Gm5192
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 382723
Tex14
Name: testis expressed gene 14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 83560
Homologene: 12838
Galnt13
Name: polypeptide N-acetylgalactosaminyltransferase 13
Synonyms: pp-GalNAc-T13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 271786
Homologene: 62167
Mmrn1
Name: multimerin 1
Synonyms: 4921530G03Rik, Emilin4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 70945
HGNC: HGNC:7178
Homologene: 49134
Pcdhb7
Name: protocadherin beta 7
Synonyms: Pcdhb4B, PcdhbG
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93878
HGNC: HGNC:8689
Homologene: 87123
Adgrb1
Name: adhesion G protein-coupled receptor B1
Synonyms: Bai1, B830018M07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 107831
HGNC: HGNC:943
Homologene: 1287
Polr1e
Name: polymerase (RNA) I polypeptide E
Synonyms: Praf1, Paf53, 53kDa, D030019D19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 64424
Homologene: 41486
Itga2b
Name: integrin alpha 2b
Synonyms: GP IIb, CD41, alphaIIb, platelet glycoprotein IIb, GpIIb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 16399
HGNC: HGNC:6138
Homologene: 37304
Sphkap
Name: SPHK1 interactor, AKAP domain containing
Synonyms: SKIP, A930009L15Rik, 4930544G21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 77629
Homologene: 18172
Cela2a
Name: chymotrypsin-like elastase family, member 2A
Synonyms: Ela2a, Ela-2, Ela2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 13706
Homologene: 40598
Iqca1l
Name: IQ motif containing with AAA domain 1 like
Synonyms: 4931409K22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231045
Homologene: 18602
Tchh
Name: trichohyalin
Synonyms: Thh, AHF
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 99681
Homologene: 136273
Vmn2r86
Name: vomeronasal 2, receptor 86
Synonyms: EG625109
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 625109
Homologene: 129606
Or4k44
Name: olfactory receptor family 4 subfamily K member 44
Synonyms: MOR248-7, GA_x6K02T2Q125-72589785-72588847, Olfr1294
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258887
Homologene: 74216
Or11g24
Name: olfactory receptor family 11 subfamily G member 24
Synonyms: Olfr739, MOR106-2, GA_x6K02T2PMLR-6121675-6122604
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 258663
Homologene: 121549
Trdn
Name: triadin
Synonyms: triadin-1, triadin-3, triadin-2, triadin 3, triadin 2, triadin 1, 2310045H21Rik, EG432451
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 76757
VEGA: 10
Homologene: 38137
Ccdc65
Name: coiled-coil domain containing 65
Synonyms: 4933417K04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 105833
VEGA: 15
Homologene: 13226
Adm
Name: adrenomedullin
Synonyms: AM
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11535
HGNC: HGNC:259
Homologene: 873
Or5k17
Name: olfactory receptor family 5 subfamily K member 17
Synonyms: Olfr181, GA_x54KRFPKG5P-55145984-55145034, MOR184-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 259001
Homologene: 74112
Or2ak5
Name: olfactory receptor family 2 subfamily AK member 5
Synonyms: GA_x6K02T2NKPP-692816-693736, MOR285-1, Olfr318
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 258494
Homologene: 133825
Cfap157
Name: cilia and flagella associated protein 157
Synonyms: 1700019L03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227736
Homologene: 53056
1700057G04Rik
Name: RIKEN cDNA 1700057G04 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 78459
Homologene: 134508
Trmt10a
Name: tRNA methyltransferase 10A
Synonyms: Rg9mtd2, 3110023L08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 108943
Homologene: 6886
C4a
Name: complement component 4A (Rodgers blood group)
Synonyms: Slp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 625018
Homologene: 36030
Fzd4
Name: frizzled class receptor 4
Synonyms: Fz4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 14366
HGNC: HGNC:4042
Homologene: 7325
Pcdhgb5
Name: protocadherin gamma subfamily B, 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93702
HGNC: HGNC:8712
Homologene: 55773
RP24-423L4.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Gm15415
Name: predicted gene 15415
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Gm10029
Name: predicted gene 10029
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 100039532
VEGA: 13
Homologene: 138686
4932702P03Rik
Name: RIKEN cDNA 4932702P03 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 73326
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 72,162,336 bp
  • TGGGGTGGACATCGAACTGAAGGAG to TG, chromosome 1 at 82,287,732 bp
  • A to G, chromosome 1 at 83,288,817 bp
  • T to A, chromosome 1 at 171,216,382 bp
  • C to A, chromosome 1 at 172,187,489 bp
  • T to A, chromosome 1 at 173,929,150 bp
  • T to A, chromosome 1 at 173,935,040 bp
  • A to T, chromosome 2 at 32,778,249 bp
  • T to A, chromosome 2 at 41,770,919 bp
  • C to A, chromosome 2 at 55,060,572 bp
  • G to A, chromosome 2 at 76,818,775 bp
  • A to T, chromosome 2 at 111,537,353 bp
  • C to A, chromosome 2 at 119,783,865 bp
  • T to A, chromosome 2 at 151,506,310 bp
  • T to C, chromosome 2 at 153,054,953 bp
  • C to T, chromosome 2 at 168,894,377 bp
  • C to A, chromosome 2 at 180,177,068 bp
  • A to G, chromosome 3 at 93,443,823 bp
  • G to A, chromosome 3 at 95,787,321 bp
  • A to T, chromosome 3 at 127,046,826 bp
  • A to G, chromosome 3 at 138,152,211 bp
  • T to C, chromosome 4 at 19,540,827 bp
  • T to A, chromosome 4 at 45,022,280 bp
  • A to T, chromosome 4 at 52,856,411 bp
  • G to A, chromosome 4 at 94,686,837 bp
  • T to C, chromosome 4 at 141,822,287 bp
  • G to A, chromosome 4 at 145,537,920 bp
  • T to C, chromosome 5 at 24,549,752 bp
  • T to C, chromosome 5 at 65,158,901 bp
  • T to C, chromosome 5 at 145,244,358 bp
  • T to G, chromosome 6 at 41,614,408 bp
  • A to G, chromosome 6 at 52,217,034 bp
  • A to G, chromosome 6 at 60,976,439 bp
  • G to T, chromosome 6 at 90,357,537 bp
  • G to A, chromosome 6 at 91,899,591 bp
  • C to T, chromosome 6 at 113,336,180 bp
  • A to T, chromosome 6 at 146,609,860 bp
  • C to A, chromosome 7 at 27,844,317 bp
  • T to C, chromosome 7 at 41,627,105 bp
  • T to A, chromosome 7 at 89,407,901 bp
  • T to A, chromosome 7 at 96,905,818 bp
  • T to A, chromosome 7 at 105,755,730 bp
  • A to G, chromosome 7 at 110,629,119 bp
  • T to A, chromosome 7 at 130,962,083 bp
  • T to A, chromosome 8 at 106,210,615 bp
  • G to T, chromosome 8 at 128,716,150 bp
  • T to A, chromosome 9 at 38,775,547 bp
  • C to A, chromosome 9 at 44,508,710 bp
  • A to T, chromosome 9 at 59,436,885 bp
  • T to C, chromosome 9 at 62,912,798 bp
  • A to G, chromosome 9 at 92,354,612 bp
  • A to G, chromosome 9 at 108,484,027 bp
  • A to G, chromosome 9 at 110,501,635 bp
  • T to A, chromosome 10 at 33,471,579 bp
  • C to T, chromosome 10 at 88,432,551 bp
  • T to C, chromosome 10 at 88,892,024 bp
  • T to A, chromosome 10 at 130,453,615 bp
  • G to A, chromosome 11 at 58,720,281 bp
  • A to G, chromosome 11 at 76,076,471 bp
  • T to A, chromosome 11 at 87,486,295 bp
  • G to T, chromosome 11 at 102,457,722 bp
  • C to T, chromosome 12 at 72,217,458 bp
  • A to G, chromosome 12 at 75,979,819 bp
  • A to G, chromosome 12 at 84,337,675 bp
  • A to G, chromosome 13 at 6,662,797 bp
  • A to T, chromosome 13 at 8,940,666 bp
  • G to A, chromosome 13 at 11,752,218 bp
  • G to T, chromosome 13 at 24,913,746 bp
  • G to T, chromosome 14 at 14,757,342 bp
  • T to C, chromosome 14 at 50,425,301 bp
  • C to A, chromosome 14 at 54,978,588 bp
  • T to A, chromosome 15 at 74,587,022 bp
  • C to A, chromosome 15 at 82,392,105 bp
  • A to C, chromosome 15 at 98,722,657 bp
  • C to T, chromosome 15 at 102,112,039 bp
  • G to T, chromosome 16 at 23,108,900 bp
  • A to C, chromosome 16 at 58,926,100 bp
  • T to C, chromosome 17 at 17,374,654 bp
  • A to G, chromosome 17 at 28,591,225 bp
  • A to G, chromosome 17 at 34,654,555 bp
  • A to G, chromosome 17 at 34,817,277 bp
  • T to A, chromosome 17 at 57,105,433 bp
  • C to T, chromosome 18 at 37,342,231 bp
  • T to G, chromosome 18 at 37,732,588 bp
  • C to T, chromosome 18 at 67,401,316 bp
  • T to A, chromosome 19 at 17,447,690 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4880 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042489-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.