Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4880Btlr/Mmmh
Stock Number:
042489-MU
Citation ID:
RRID:MMRRC_042489-MU
Other Names:
R4880 (G1), C57BL/6J-MtgxR4880Btlr
Major Collection:

Strain Information

Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: Myhc-b, Myhcb, beta-MHC, B-MHC, MYH-beta/slow, MyHC-I, betaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
Rprd2
Name: regulation of nuclear pre-mRNA domain containing 2
Synonyms: 6720469I21Rik, 2810036A19Rik, 4930535B03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 75137
Homologene: 19997
Slc4a7
Name: solute carrier family 4, sodium bicarbonate cotransporter, member 7
Synonyms: E430014N10Rik, NBC3, NBCn1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218756
VEGA: 14
Homologene: 2680
Eif4a2
Name: eukaryotic translation initiation factor 4A2
Synonyms: Eif4, 4833432N07Rik, BM-010, Ddx2b
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13682
HGNC: HGNC:3284
Homologene: 1487
Srpk1
Name: serine/arginine-rich protein specific kinase 1
Synonyms: SR protein-specific kinase 1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20815
Homologene: 110962
Nsfl1c
Name: NSFL1 (p97) cofactor (p47)
Synonyms: p47
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 386649
Homologene: 41114
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 72,162,336 bp
  • TGGGGTGGACATCGAACTGAAGGAG to TG, chromosome 1 at 82,287,732 bp
  • A to G, chromosome 1 at 83,288,817 bp
  • T to A, chromosome 1 at 171,216,382 bp
  • C to A, chromosome 1 at 172,187,489 bp
  • T to A, chromosome 1 at 173,929,150 bp
  • T to A, chromosome 1 at 173,935,040 bp
  • A to T, chromosome 2 at 32,778,249 bp
  • T to A, chromosome 2 at 41,770,919 bp
  • C to A, chromosome 2 at 55,060,572 bp
  • G to A, chromosome 2 at 76,818,775 bp
  • A to T, chromosome 2 at 111,537,353 bp
  • C to A, chromosome 2 at 119,783,865 bp
  • T to A, chromosome 2 at 151,506,310 bp
  • T to C, chromosome 2 at 153,054,953 bp
  • C to T, chromosome 2 at 168,894,377 bp
  • C to A, chromosome 2 at 180,177,068 bp
  • A to G, chromosome 3 at 93,443,823 bp
  • G to A, chromosome 3 at 95,787,321 bp
  • A to T, chromosome 3 at 127,046,826 bp
  • A to G, chromosome 3 at 138,152,211 bp
  • T to C, chromosome 4 at 19,540,827 bp
  • T to A, chromosome 4 at 45,022,280 bp
  • A to T, chromosome 4 at 52,856,411 bp
  • G to A, chromosome 4 at 94,686,837 bp
  • T to C, chromosome 4 at 141,822,287 bp
  • G to A, chromosome 4 at 145,537,920 bp
  • T to C, chromosome 5 at 24,549,752 bp
  • T to C, chromosome 5 at 65,158,901 bp
  • T to C, chromosome 5 at 145,244,358 bp
  • T to G, chromosome 6 at 41,614,408 bp
  • A to G, chromosome 6 at 52,217,034 bp
  • A to G, chromosome 6 at 60,976,439 bp
  • G to T, chromosome 6 at 90,357,537 bp
  • G to A, chromosome 6 at 91,899,591 bp
  • C to T, chromosome 6 at 113,336,180 bp
  • A to T, chromosome 6 at 146,609,860 bp
  • C to A, chromosome 7 at 27,844,317 bp
  • T to C, chromosome 7 at 41,627,105 bp
  • T to A, chromosome 7 at 89,407,901 bp
  • T to A, chromosome 7 at 96,905,818 bp
  • T to A, chromosome 7 at 105,755,730 bp
  • A to G, chromosome 7 at 110,629,119 bp
  • T to A, chromosome 7 at 130,962,083 bp
  • T to A, chromosome 8 at 106,210,615 bp
  • G to T, chromosome 8 at 128,716,150 bp
  • T to A, chromosome 9 at 38,775,547 bp
  • C to A, chromosome 9 at 44,508,710 bp
  • A to T, chromosome 9 at 59,436,885 bp
  • T to C, chromosome 9 at 62,912,798 bp
  • A to G, chromosome 9 at 92,354,612 bp
  • A to G, chromosome 9 at 108,484,027 bp
  • A to G, chromosome 9 at 110,501,635 bp
  • T to A, chromosome 10 at 33,471,579 bp
  • C to T, chromosome 10 at 88,432,551 bp
  • T to C, chromosome 10 at 88,892,024 bp
  • T to A, chromosome 10 at 130,453,615 bp
  • G to A, chromosome 11 at 58,720,281 bp
  • A to G, chromosome 11 at 76,076,471 bp
  • T to A, chromosome 11 at 87,486,295 bp
  • G to T, chromosome 11 at 102,457,722 bp
  • C to T, chromosome 12 at 72,217,458 bp
  • A to G, chromosome 12 at 75,979,819 bp
  • A to G, chromosome 12 at 84,337,675 bp
  • A to G, chromosome 13 at 6,662,797 bp
  • A to T, chromosome 13 at 8,940,666 bp
  • G to A, chromosome 13 at 11,752,218 bp
  • G to T, chromosome 13 at 24,913,746 bp
  • G to T, chromosome 14 at 14,757,342 bp
  • T to C, chromosome 14 at 50,425,301 bp
  • C to A, chromosome 14 at 54,978,588 bp
  • T to A, chromosome 15 at 74,587,022 bp
  • C to A, chromosome 15 at 82,392,105 bp
  • A to C, chromosome 15 at 98,722,657 bp
  • C to T, chromosome 15 at 102,112,039 bp
  • G to T, chromosome 16 at 23,108,900 bp
  • A to C, chromosome 16 at 58,926,100 bp
  • T to C, chromosome 17 at 17,374,654 bp
  • A to G, chromosome 17 at 28,591,225 bp
  • A to G, chromosome 17 at 34,654,555 bp
  • A to G, chromosome 17 at 34,817,277 bp
  • T to A, chromosome 17 at 57,105,433 bp
  • C to T, chromosome 18 at 37,342,231 bp
  • T to G, chromosome 18 at 37,732,588 bp
  • C to T, chromosome 18 at 67,401,316 bp
  • T to A, chromosome 19 at 17,447,690 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4880 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042489-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.