Strain Name:
Stock Number:
Citation ID:
Other Names:
R4880 (G1), C57BL/6J-MtgxR4880Btlr
Major Collection:

Gene Information

Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: Myhc-b, Myhcb, MYH-beta/slow, beta-MHC, B-MHC, MyHC-I, betaMHC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 140781
Homologene: 68044
Name: interferon activated gene 203
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 15950
Homologene: 115929
Name: regulation of nuclear pre-mRNA domain containing 2
Synonyms: 6720469I21Rik, 2810036A19Rik, 4930535B03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 75137
Homologene: 19997
Name: solute carrier family 4, sodium bicarbonate cotransporter, member 7
Synonyms: E430014N10Rik, NBC3, NBCn1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 218756
VEGA: 14
Homologene: 2680
Name: eukaryotic translation initiation factor 4A2
Synonyms: Eif4, 4833432N07Rik, BM-010, Ddx2b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 13682
Homologene: 1487
Name: serine/arginine-rich protein specific kinase 1
Synonyms: SR protein-specific kinase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 20815
Homologene: 110962
Name: NSFL1 (p97) cofactor (p47)
Synonyms: p47
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 386649
Homologene: 41114
Name: copine III
Synonyms: PRO1071, CPN3, 5730450C07Rik, 5430428M23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 70568
Homologene: 20839
Name: RNA polymerase II associated protein 1
Synonyms: 1190005L06Rik, A730023M06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 68925
Homologene: 32269
Name: ariadne RBR E3 ubiquitin protein ligase 1
Synonyms: UIP77
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 23806
Homologene: 111871
Name: VPS53 GARP complex subunit
Synonyms: 2310040I21Rik, 2010002A08Rik, 3100002B05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 68299
Homologene: 6264
Name: RIKEN cDNA 2610021A01 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 668572
Name: DDB1 and CUL4 associated factor 8
Synonyms: H326, D1Ucla4, D1Dau35e, Wdr42a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98193
Homologene: 56725
Name: zinc finger protein 64
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22722
Homologene: 7604
Name: melanoregulin
Synonyms: LOC381269, dsu, Wdt2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 381269
Homologene: 9954
Name: protein inhibitor of activated STAT 1
Synonyms: 2900068C24Rik, GBP, Ddxbp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 56469
Homologene: 22953
Name: laminin, beta 2
Synonyms: Lamb-2, Lams, npht
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 16779
Homologene: 1723
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Name: solute carrier family 7, member 6 opposite strand
Synonyms: 2010007L18Rik, 2400002F02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 66432
Homologene: 41853
Name: intraflagellar transport 74
Synonyms: 1700029H06Rik, Cmg1, Ccdc2, b2b796Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 67694
Homologene: 11831
Name: reticulon 1
Synonyms: Nsp, Rtn1-b, Rtn1-c, 0710005K15Rik, Rtn1-a, 4930441F12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 104001
Homologene: 49654
Name: laminin, alpha 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16776
Homologene: 4060
Name: integrin beta 1 (fibronectin receptor beta)
Synonyms: CD29, beta1 integrin, 4633401G24Rik, Fnrb, Gm9863
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 16412
Homologene: 22999
Name: zinc finger protein 59
Synonyms: Mfg-2, Mfg2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 22717
Homologene: 137243
Name: zinc finger protein 410
Synonyms: D12Ertd748e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 52708
VEGA: 12
Homologene: 10918
Name: RIO kinase 2
Synonyms: 2010110K24Rik, 2410085M17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 67045
VEGA: 17
Homologene: 6760
Name: transmembrane 7 superfamily member 3
Synonyms: 2010003B14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 67623
Homologene: 9560
Name: tubulin, beta 6 class V
Synonyms: 2310057H16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 67951
VEGA: 18
Homologene: 69414
Name: zinc finger protein 655
Synonyms: 9030409O18Rik, 2700038I16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 72611
Homologene: 12473
Name: coiled-coil domain containing 174
Synonyms: C130022K22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232236
Homologene: 9523
Name: calcium/calmodulin-dependent protein kinase I
Synonyms: D6Ertd263e, CaMKIalpha, Camk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 52163
Homologene: 117458
Name: tensin 2
Synonyms: nep, nph, Tenc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 209039
VEGA: 15
Homologene: 37077
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Name: dachsous cadherin related 1
Synonyms: C130033F22Rik, 3110041P15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233651
Homologene: 2771
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: nesprin-2, syne-2, D12Ertd777e, 6820443O06Rik, Nesp2g, Cpfl8, diminished cone electroretinogram, dice
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 319565
Homologene: 56700
Name: tumor necrosis factor (ligand) superfamily, member 9
Synonyms: 4-1BB ligand, Ly63l, Cd137l, 4-1BB-L, 4-1BBL
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 21950
VEGA: 17
Homologene: 137221
Name: zinc finger protein 990
Synonyms: Gm13225
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 101056073
Name: proprotein convertase subtilisin/kexin type 5
Synonyms: PC6, SPC6, PC5A, PC5/6A, b2b585Clo, b2b1549Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 18552
VEGA: 19
Homologene: 21244
Name: solute carrier family 5 (iodide transporter), member 8
Synonyms: SMCT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216225
VEGA: 10
Homologene: 64832
Name: insulin receptor substrate 1
Synonyms: IRS-1, G972R
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16367
Homologene: 4049
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 94217
Homologene: 56810
Name: Eph receptor B6
Synonyms: Mep, Cekl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 13848
Homologene: 20940
Name: homeobox A7
Synonyms: Hox-1.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 15404
Homologene: 56001
Name: nuclear receptor subfamily 1, group I, member 3
Synonyms: CAR1, MB67, Care2, ESTM32, mCAR, CAR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12355
Homologene: 3759
Name: olfactory receptor 921
Synonyms: GA_x6K02T2PVTD-32478047-32478988, MOR165-8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258778
Homologene: 128138
Name: urocanase domain containing 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243537
Homologene: 76629
Name: kinesin family member 9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 16578
Homologene: 65620
Name: HtrA serine peptidase 1
Synonyms: insulin-like growth factor binding protein 5 protease, RSPP11, L56, HtrA1, Prss11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 56213
Homologene: 31114
Name: olfactory receptor 273
Synonyms: GA_x6K02T2N78B-7137430-7138383, MOR262-8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 258821
Homologene: 73999
Name: kelch-like 5
Synonyms: 1300013C10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 71778
Homologene: 56736
Name: cytochrome P450, family 2, subfamily d, polypeptide 11
Synonyms: P450-2D, Cyp2d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 545123
VEGA: 15
Homologene: 86099
Name: B cell CLL/lymphoma 9-like
Synonyms: DLNB11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 80288
Homologene: 65615
Name: N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
Synonyms: EG432486
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 432486
Homologene: 32576
Name: activating transcription factor 6 beta
Synonyms: Creb-rp, ATF6beta, Crebl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 12915
Homologene: 31238
Name: X-linked Kx blood group related 7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228787
Homologene: 19390
Name: ribosomal protein L10A, pseudogene 2
Synonyms: Gm5192
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 382723
Name: testis expressed gene 14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 83560
Homologene: 12838
Name: polypeptide N-acetylgalactosaminyltransferase 13
Synonyms: pp-GalNAc-T13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 271786
Homologene: 62167
Name: multimerin 1
Synonyms: 4921530G03Rik, Emilin4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 70945
Homologene: 49134
Name: protocadherin beta 7
Synonyms: Pcdhb4B, PcdhbG
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93878
Homologene: 87123
Name: adhesion G protein-coupled receptor B1
Synonyms: B830018M07Rik, Bai1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 107831
Homologene: 1287
Name: polymerase (RNA) I polypeptide E
Synonyms: 53kDa, D030019D19Rik, Paf53, Praf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 64424
Homologene: 41486
Name: integrin alpha 2b
Synonyms: platelet glycoprotein IIb, GpIIb, alphaIIb, CD41, GP IIb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 16399
Homologene: 37304
Name: SPHK1 interactor, AKAP domain containing
Synonyms: A930009L15Rik, 4930544G21Rik, SKIP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 77629
Homologene: 18172
Name: chymotrypsin-like elastase family, member 2A
Synonyms: Ela-2, Ela2, Ela2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 13706
Homologene: 40598
Name: IQ motif containing with AAA domain 1 like
Synonyms: 4931409K22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231045
Homologene: 18602
Name: trichohyalin
Synonyms: Thh, AHF
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 99681
Homologene: 136273
Name: vomeronasal 2, receptor 86
Synonyms: EG625109
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 625109
Homologene: 129606
Name: olfactory receptor 1294
Synonyms: GA_x6K02T2Q125-72589785-72588847, MOR248-7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258887
Homologene: 74216
Name: olfactory receptor 739
Synonyms: GA_x6K02T2PMLR-6121675-6122604, MOR106-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 258663
Homologene: 121549
Name: triadin
Synonyms: 2310045H21Rik, triadin-3, triadin-2, triadin-1, triadin 3, triadin 2, triadin 1, EG432451
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 76757
VEGA: 10
Homologene: 38137
Name: coiled-coil domain containing 65
Synonyms: 4933417K04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 105833
VEGA: 15
Homologene: 13226
Name: adrenomedullin
Synonyms: AM
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11535
Homologene: 873
Name: olfactory receptor 181
Synonyms: GA_x54KRFPKG5P-55145984-55145034, MOR184-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 259001
Homologene: 74112
Name: olfactory receptor 318
Synonyms: GA_x6K02T2NKPP-692816-693736, MOR285-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 258494
Homologene: 133825
Name: cilia and flagella associated protein 157
Synonyms: 1700019L03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227736
Homologene: 53056
Name: RIKEN cDNA 1700057G04 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 78459
Homologene: 134508
Name: tRNA methyltransferase 10A
Synonyms: 3110023L08Rik, Rg9mtd2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 108943
Homologene: 6886
Name: complement component 4A (Rodgers blood group)
Synonyms: Slp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 625018
Homologene: 36030
Name: frizzled class receptor 4
Synonyms: Fz4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 14366
Homologene: 7325
Name: protocadherin gamma subfamily B, 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93702
Homologene: 55773
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Name: predicted gene 15415
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Name: predicted gene 10029
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 100039532
VEGA: 13
Homologene: 138686
Name: RIKEN cDNA 4932702P03 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 73326
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 72,162,336 bp
  • TGGGGTGGACATCGAACTGAAGGAG to TG, chromosome 1 at 82,287,732 bp
  • A to G, chromosome 1 at 83,288,817 bp
  • T to A, chromosome 1 at 171,216,382 bp
  • C to A, chromosome 1 at 172,187,489 bp
  • T to A, chromosome 1 at 173,929,150 bp
  • T to A, chromosome 1 at 173,935,040 bp
  • A to T, chromosome 2 at 32,778,249 bp
  • T to A, chromosome 2 at 41,770,919 bp
  • C to A, chromosome 2 at 55,060,572 bp
  • G to A, chromosome 2 at 76,818,775 bp
  • A to T, chromosome 2 at 111,537,353 bp
  • C to A, chromosome 2 at 119,783,865 bp
  • T to A, chromosome 2 at 151,506,310 bp
  • T to C, chromosome 2 at 153,054,953 bp
  • C to T, chromosome 2 at 168,894,377 bp
  • C to A, chromosome 2 at 180,177,068 bp
  • A to G, chromosome 3 at 93,443,823 bp
  • G to A, chromosome 3 at 95,787,321 bp
  • A to T, chromosome 3 at 127,046,826 bp
  • A to G, chromosome 3 at 138,152,211 bp
  • T to C, chromosome 4 at 19,540,827 bp
  • T to A, chromosome 4 at 45,022,280 bp
  • A to T, chromosome 4 at 52,856,411 bp
  • G to A, chromosome 4 at 94,686,837 bp
  • T to C, chromosome 4 at 141,822,287 bp
  • G to A, chromosome 4 at 145,537,920 bp
  • T to C, chromosome 5 at 24,549,752 bp
  • T to C, chromosome 5 at 65,158,901 bp
  • T to C, chromosome 5 at 145,244,358 bp
  • T to G, chromosome 6 at 41,614,408 bp
  • A to G, chromosome 6 at 52,217,034 bp
  • A to G, chromosome 6 at 60,976,439 bp
  • G to T, chromosome 6 at 90,357,537 bp
  • G to A, chromosome 6 at 91,899,591 bp
  • C to T, chromosome 6 at 113,336,180 bp
  • A to T, chromosome 6 at 146,609,860 bp
  • C to A, chromosome 7 at 27,844,317 bp
  • T to C, chromosome 7 at 41,627,105 bp
  • T to A, chromosome 7 at 89,407,901 bp
  • T to A, chromosome 7 at 96,905,818 bp
  • T to A, chromosome 7 at 105,755,730 bp
  • A to G, chromosome 7 at 110,629,119 bp
  • T to A, chromosome 7 at 130,962,083 bp
  • T to A, chromosome 8 at 106,210,615 bp
  • G to T, chromosome 8 at 128,716,150 bp
  • T to A, chromosome 9 at 38,775,547 bp
  • C to A, chromosome 9 at 44,508,710 bp
  • A to T, chromosome 9 at 59,436,885 bp
  • T to C, chromosome 9 at 62,912,798 bp
  • A to G, chromosome 9 at 92,354,612 bp
  • A to G, chromosome 9 at 108,484,027 bp
  • A to G, chromosome 9 at 110,501,635 bp
  • T to A, chromosome 10 at 33,471,579 bp
  • C to T, chromosome 10 at 88,432,551 bp
  • T to C, chromosome 10 at 88,892,024 bp
  • T to A, chromosome 10 at 130,453,615 bp
  • G to A, chromosome 11 at 58,720,281 bp
  • A to G, chromosome 11 at 76,076,471 bp
  • T to A, chromosome 11 at 87,486,295 bp
  • G to T, chromosome 11 at 102,457,722 bp
  • C to T, chromosome 12 at 72,217,458 bp
  • A to G, chromosome 12 at 75,979,819 bp
  • A to G, chromosome 12 at 84,337,675 bp
  • A to G, chromosome 13 at 6,662,797 bp
  • A to T, chromosome 13 at 8,940,666 bp
  • G to A, chromosome 13 at 11,752,218 bp
  • G to T, chromosome 13 at 24,913,746 bp
  • G to T, chromosome 14 at 14,757,342 bp
  • T to C, chromosome 14 at 50,425,301 bp
  • C to A, chromosome 14 at 54,978,588 bp
  • T to A, chromosome 15 at 74,587,022 bp
  • C to A, chromosome 15 at 82,392,105 bp
  • A to C, chromosome 15 at 98,722,657 bp
  • C to T, chromosome 15 at 102,112,039 bp
  • G to T, chromosome 16 at 23,108,900 bp
  • A to C, chromosome 16 at 58,926,100 bp
  • T to C, chromosome 17 at 17,374,654 bp
  • A to G, chromosome 17 at 28,591,225 bp
  • A to G, chromosome 17 at 34,654,555 bp
  • A to G, chromosome 17 at 34,817,277 bp
  • T to A, chromosome 17 at 57,105,433 bp
  • C to T, chromosome 18 at 37,342,231 bp
  • T to G, chromosome 18 at 37,732,588 bp
  • C to T, chromosome 18 at 67,401,316 bp
  • T to A, chromosome 19 at 17,447,690 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4880 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
042489-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.