Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4890Btlr/Mmmh
Stock Number:
042495-MU
Citation ID:
RRID:MMRRC_042495-MU
Other Names:
R4890 (G1), C57BL/6J-MtgxR4890Btlr
Major Collection:

Strain Information

Pik3r1
Name: phosphoinositide-3-kinase regulatory subunit 1
Synonyms: p85alpha, p50alpha, p55alpha, PI3K
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18708
HGNC: HGNC:8979
Homologene: 7889
Ptprz1
Name: protein tyrosine phosphatase receptor type Z, polypeptide 1
Synonyms: DSD-1-PG, phosphacan, PTPzeta, PTPbeta, Rptpbeta, Ptpz, Ptprz, RPTPz
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19283
HGNC: HGNC:9685
Homologene: 2136
Itga8
Name: integrin alpha 8
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241226
HGNC: HGNC:6144
Homologene: 37396
Sema3c
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C
Synonyms: Semae, 1110036B02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20348
Homologene: 36201
Nrxn2
Name: neurexin II
Synonyms: neurexin II beta, neurexin II alpha, 6430591O13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18190
HGNC: HGNC:8009
Homologene: 86984
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Tns3
Name: tensin 3
Synonyms: TEM6, F830010I22Rik, Tens1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 319939
Homologene: 49713
Mapt
Name: microtubule-associated protein tau
Synonyms: Mtapt, Tau
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17762
HGNC: HGNC:6893
Homologene: 74962
Mbd4
Name: methyl-CpG binding domain protein 4
Synonyms: Med1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17193
HGNC: HGNC:6919
Homologene: 2916
Sgsm1
Name: small G protein signaling modulator 1
Synonyms: 2410098H20Rik, D5Bwg1524e, Rutbc2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52850
Homologene: 64485
Kansl1
Name: KAT8 regulatory NSL complex subunit 1
Synonyms: 1700081L11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76719
Homologene: 9140
Kdsr
Name: 3-ketodihydrosphingosine reductase
Synonyms: 6330410P18Rik, 9430079B08Rik, Fvt1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70750
HGNC: HGNC:4021
Homologene: 1539
Sec23ip
Name: Sec23 interacting protein
Synonyms: D7Ertd373e, p125
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 207352
Homologene: 38288
Msh2
Name: mutS homolog 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17685
HGNC: HGNC:7325
Homologene: 210
Cit
Name: citron
Synonyms: CRIK-SK, citron-N, citron kinase, Cit-k, C030025P15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12704
HGNC: HGNC:1985
Homologene: 21404
Adcy4
Name: adenylate cyclase 4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 104110
VEGA: 14
HGNC: HGNC:235
Homologene: 23149
C2cd2l
Name: C2 calcium-dependent domain containing 2-like
Synonyms: 1300006O23Rik, Tmem24
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71764
VEGA: 9
Homologene: 8876
Ccsap
Name: centriole, cilia and spindle associated protein
Synonyms: 1700054N08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 73420
Homologene: 17056
Chsy1
Name: chondroitin sulfate synthase 1
Synonyms: skt
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269941
Homologene: 8950
Shisal2a
Name: shisa like 2A
Synonyms: OTTMUSG00000008243, Fam159a
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 545667
Homologene: 82675
Hepacam2
Name: HEPACAM family member 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101202
Homologene: 18724
Rhpn2
Name: rhophilin, Rho GTPase binding protein 2
Synonyms: 1300002E07Rik, D7Ertd784e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 52428
Homologene: 12407
Lbr
Name: lamin B receptor
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98386
HGNC: HGNC:6518
Homologene: 2455
Osgin2
Name: oxidative stress induced growth inhibitor family member 2
Synonyms: C230027H09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 209212
HGNC: HGNC:1355
Homologene: 3201
Gak
Name: cyclin G associated kinase
Synonyms: D130045N16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231580
HGNC: HGNC:4113
Homologene: 3846
Baz2b
Name: bromodomain adjacent to zinc finger domain, 2B
Synonyms: D2Ertd794e, 5830435C13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 407823
HGNC: HGNC:963
Homologene: 8394
Dennd1a
Name: DENN domain containing 1A
Synonyms: 6030446I19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227801
Homologene: 17141
Zfp940
Name: zinc finger protein 940
Synonyms: BC027344
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233057
Homologene: 138421
Dnhd1
Name: dynein heavy chain domain 1
Synonyms: 8030491N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77505
Homologene: 131117
Slc39a5
Name: solute carrier family 39 (metal ion transporter), member 5
Synonyms: 2010205A06Rik, 1810013D05Rik, Zip5
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 72002
VEGA: 10
Homologene: 57083
Tsc2
Name: TSC complex subunit 2
Synonyms: tuberin, Nafld, tuberous sclerosis 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22084
VEGA: 17
Homologene: 462
Nek10
Name: NIMA (never in mitosis gene a)- related kinase 10
Synonyms: LOC238944
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 674895
Homologene: 130947
Rbm15b
Name: RNA binding motif protein 15B
Synonyms: 1810017N16Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 109095
Homologene: 8325
Adgrb3
Name: adhesion G protein-coupled receptor B3
Synonyms: A830096D10Rik, Bai3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210933
HGNC: HGNC:945
Homologene: 1289
Pde5a
Name: phosphodiesterase 5A, cGMP-specific
Synonyms: PDE5A1, Pde5
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242202
HGNC: HGNC:8784
Homologene: 842
Aox2
Name: aldehyde oxidase 2
Synonyms: Aox3l1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213043
Homologene: 84622
Dclk1
Name: doublecortin-like kinase 1
Synonyms: CPG16, DCLK, 1700113D08Rik, 2810480F11Rik, Dcl, Click-I, Dcamkl1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13175
HGNC: HGNC:2700
Homologene: 130530
Tubd1
Name: tubulin, delta 1
Synonyms: 4930550G19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56427
Homologene: 9443
Vsig8
Name: V-set and immunoglobulin domain containing 8
Synonyms: EG240916
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240916
Homologene: 18616
Insr
Name: insulin receptor
Synonyms: IR, CD220, 4932439J01Rik, D630014A15Rik, IR-B, IR-A
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16337
HGNC: HGNC:6091
Homologene: 20090
Ttc21a
Name: tetratricopeptide repeat domain 21A
Synonyms: 4921538N17Rik, Thm2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74052
Homologene: 14728
Or6z5
Name: olfactory receptor family 6 subfamily Z member 5
Synonyms: GA_x6K02T2QGBW-3203957-3204898, MOR103-6, Olfr1346
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258918
Homologene: 74134
Cfap251
Name: cilia and flagella associated protein 251
Synonyms: 4930415N18Rik, 4933428F06Rik, Wdr66
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269701
Homologene: 16964
Or6c1b
Name: olfactory receptor family 6 subfamily C member 1B
Synonyms: GA_x6K02T2PULF-11116958-11117896, MOR111-5, Olfr786
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258542
HGNC: HGNC:8355
Homologene: 133582
Il1rl2
Name: interleukin 1 receptor-like 2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 107527
HGNC: HGNC:5999
Homologene: 2860
Kif14
Name: kinesin family member 14
Synonyms: N-3 kinesin, D1Ertd367e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381293
Homologene: 8916
Tmcc2
Name: transmembrane and coiled-coil domains 2
Synonyms: 1110063G11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68875
Homologene: 8905
Sipa1l2
Name: signal-induced proliferation-associated 1 like 2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244668
Homologene: 18956
Myorg
Name: myogenesis regulating glycosidase (putative)
Synonyms: NET37, AI464131
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329828
Homologene: 19853
Or5m12
Name: olfactory receptor family 5 subfamily M member 12
Synonyms: GA_x6K02T2Q125-47384320-47383337, MOR197-1, Olfr1024
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257900
Homologene: 128271
Sult2a5
Name: sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 5
Synonyms: EG434264, Gm15438
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434264
Homologene: 37741
Cfap221
Name: cilia and flagella associated protein 221
Synonyms: Pcdp1, Gm101
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226356
Homologene: 88578
Pcare
Name: photoreceptor cilium actin regulator
Synonyms: BC027072
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 225004
VEGA: 17
Homologene: 19792
Cnnm4
Name: cyclin M4
Synonyms: Acdp4, 5430430O18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 94220
HGNC: HGNC:105
Homologene: 75662
Or52e15
Name: olfactory receptor family 52 subfamily E member 15
Synonyms: GA_x6K02T2PBJ9-7625746-7624808, MOR32-4, Olfr672
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258755
Homologene: 138317
Or8c15
Name: olfactory receptor family 8 subfamily C member 15
Synonyms: GA_x6K02T2PVTD-31889215-31890153, MOR170-11, Olfr893
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258333
Homologene: 133626
Rusc1
Name: RUN and SH3 domain containing 1
Synonyms: 2210403N08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72296
Homologene: 75028
Zbtb42
Name: zinc finger and BTB domain containing 42
Synonyms: simiRP58, Gm5188
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 382639
Homologene: 20003
Otud3
Name: OTU domain containing 3
Synonyms: 3110030K17Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 73162
Homologene: 66103
Ugt1a2
Name: UDP glucuronosyltransferase 1 family, polypeptide A2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22236
Homologene: 86211
Vmn2r-ps158
Name: vomeronasal 2, receptor, pseudogene 158
Synonyms: Gm9268, Vmn2r126
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 668612
Homologene: 104832
Mylk2
Name: myosin, light polypeptide kinase 2, skeletal muscle
Synonyms: 9830004H17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228785
Homologene: 13223
Nudt16l2
Name: nudix hydrolase 16 like 2
Synonyms: 1700080E11Rik, nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73532
Homologene: 87061
Ctsz
Name: cathepsin Z
Synonyms: CTSX, cathepsin X, D2Wsu143e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 64138
HGNC: HGNC:2547
Homologene: 1022
Zfp612
Name: zinc finger protein 612
Synonyms: B230354B21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234725
Homologene: 27083
Prokr1
Name: prokineticin receptor 1
Synonyms: Pkr1, EG-VEGFR1, Gpr73
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 58182
HGNC: HGNC:4524
Homologene: 10968
Rfc5
Name: replication factor C (activator 1) 5
Synonyms: 2610020K06Rik, 2610209F07Rik, 36.5kDa, 36kDa, Recc5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72151
HGNC: HGNC:9973
Homologene: 6730
Cept1
Name: choline/ethanolaminephosphotransferase 1
Synonyms: 9930118K05Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99712
Homologene: 81624
Pcdhga12
Name: protocadherin gamma subfamily A, 12
Synonyms: pc2c, Pcdh13
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93724
HGNC: HGNC:8699
Homologene: 134588
Tomm6os
Name: translocase of outer mitochondrial membrane 6, opposite strand
Synonyms: Prickle4os, Gm14872
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 100415787
Smim22
Name: small integral membrane protein 22
Synonyms: Gm5480
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 432995
Homologene: 133207
Mroh9
Name: maestro heat-like repeat family member 9
Synonyms: Armc11, 4921528O07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 78258
Homologene: 123521
Gm28857
Name: predicted gene 28857
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 102640440
Gm20539
Name: predicted gene 20539
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Cntf
Name: ciliary neurotrophic factor
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12803
HGNC: HGNC:2169
Homologene: 8288
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 25,221,827 bp
  • T to A, chromosome 1 at 36,472,264 bp
  • CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT to CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT, chromosome 1 at 40,327,310 bp
  • T to C, chromosome 1 at 58,334,703 bp
  • T to A, chromosome 1 at 88,200,812 bp
  • T to C, chromosome 1 at 106,753,234 bp
  • T to C, chromosome 1 at 119,955,746 bp
  • T to C, chromosome 1 at 130,740,988 bp
  • C to A, chromosome 1 at 132,380,779 bp
  • T to C, chromosome 1 at 136,487,130 bp
  • T to C, chromosome 1 at 163,026,524 bp
  • T to A, chromosome 1 at 172,561,575 bp
  • C to A, chromosome 1 at 181,817,568 bp
  • G to A, chromosome 2 at 12,193,291 bp
  • A to G, chromosome 2 at 18,742,777 bp
  • A to T, chromosome 2 at 38,176,226 bp
  • A to T, chromosome 2 at 59,926,039 bp
  • C to T, chromosome 2 at 85,904,748 bp
  • A to G, chromosome 2 at 152,920,354 bp
  • C to A, chromosome 2 at 174,428,600 bp
  • T to C, chromosome 3 at 55,521,932 bp
  • T to C, chromosome 3 at 89,088,270 bp
  • T to A, chromosome 3 at 106,505,807 bp
  • T to C, chromosome 3 at 122,748,159 bp
  • G to A, chromosome 4 at 16,013,739 bp
  • G to A, chromosome 4 at 41,498,877 bp
  • A to G, chromosome 4 at 101,941,591 bp
  • A to G, chromosome 4 at 108,367,801 bp
  • C to A, chromosome 4 at 123,448,238 bp
  • G to A, chromosome 4 at 138,913,749 bp
  • A to T, chromosome 5 at 17,675,159 bp
  • A to T, chromosome 5 at 108,580,876 bp
  • G to A, chromosome 5 at 113,280,462 bp
  • C to T, chromosome 5 at 115,988,123 bp
  • G to A, chromosome 5 at 117,386,820 bp
  • A to G, chromosome 5 at 123,324,328 bp
  • A to T, chromosome 6 at 3,487,231 bp
  • G to A, chromosome 6 at 23,024,958 bp
  • G to A, chromosome 6 at 87,588,696 bp
  • G to A, chromosome 6 at 115,845,429 bp
  • T to A, chromosome 7 at 6,474,849 bp
  • A to G, chromosome 7 at 13,625,386 bp
  • A to G, chromosome 7 at 29,845,399 bp
  • A to T, chromosome 7 at 35,390,803 bp
  • A to G, chromosome 7 at 43,047,600 bp
  • A to G, chromosome 7 at 66,110,226 bp
  • G to A, chromosome 7 at 104,996,104 bp
  • A to G, chromosome 7 at 105,656,957 bp
  • A to G, chromosome 7 at 128,752,910 bp
  • T to A, chromosome 8 at 3,198,234 bp
  • T to A, chromosome 8 at 110,089,944 bp
  • T to G, chromosome 8 at 123,845,421 bp
  • T to A, chromosome 8 at 125,491,867 bp
  • G to T, chromosome 9 at 38,209,290 bp
  • A to G, chromosome 9 at 44,311,133 bp
  • A to T, chromosome 9 at 105,144,587 bp
  • A to T, chromosome 9 at 106,885,829 bp
  • A to G, chromosome 9 at 119,959,037 bp
  • T to C, chromosome 10 at 128,398,447 bp
  • C to T, chromosome 10 at 129,437,079 bp
  • G to A, chromosome 11 at 8,451,108 bp
  • G to A, chromosome 11 at 69,967,092 bp
  • G to C, chromosome 11 at 86,552,795 bp
  • G to A, chromosome 11 at 104,328,149 bp
  • A to T, chromosome 11 at 104,343,042 bp
  • C to A, chromosome 12 at 112,680,427 bp
  • T to C, chromosome 13 at 101,757,610 bp
  • T to A, chromosome 14 at 14,860,986 bp
  • C to T, chromosome 14 at 55,779,029 bp
  • G to A, chromosome 16 at 5,007,858 bp
  • A to T, chromosome 17 at 24,600,035 bp
  • AAGAGAGAGAGAGAGA to AAGAGAGAGAGAGA, chromosome 17 at 47,689,881 bp
  • C to T, chromosome 17 at 71,752,311 bp
  • C to T, chromosome 17 at 87,678,284 bp
  • T to A, chromosome 18 at 37,768,237 bp
  • A to T, chromosome 19 at 6,448,278 bp
  • A to T, chromosome 19 at 12,763,962 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4890 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042495-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.