MMRRC:042503-MU

T to C, chromosome 1 at 74,147,663 bp
C to A, chromosome 1 at 90,802,427 bp
A to T, chromosome 1 at 132,324,986 bp
A to T, chromosome 1 at 184,845,624 bp
T to C, chromosome 2 at 22,823,349 bp
A to G, chromosome 2 at 36,786,798 bp
A to C, chromosome 2 at 88,988,110 bp
C to A, chromosome 2 at 128,783,925 bp
T to C, chromosome 2 at 130,544,436 bp
G to T, chromosome 2 at 156,339,221 bp
A to G, chromosome 2 at 172,427,869 bp
C to G, chromosome 3 at 40,905,869 bp
T to A, chromosome 3 at 69,031,811 bp
C to A, chromosome 3 at 97,709,558 bp
T to C, chromosome 3 at 141,840,683 bp
T to A, chromosome 3 at 144,737,961 bp
T to C, chromosome 4 at 41,190,794 bp
T to C, chromosome 4 at 59,062,640 bp
T to A, chromosome 4 at 116,163,366 bp
G to A, chromosome 4 at 128,934,653 bp
A to G, chromosome 5 at 21,683,440 bp
A to T, chromosome 5 at 35,280,361 bp
A to T, chromosome 5 at 90,264,601 bp
G to A, chromosome 5 at 92,574,669 bp
T to C, chromosome 5 at 95,801,727 bp
A to G, chromosome 5 at 109,003,458 bp
A to G, chromosome 5 at 115,863,028 bp
G to A, chromosome 5 at 122,284,717 bp
A to G, chromosome 5 at 145,977,671 bp
A to G, chromosome 6 at 29,446,843 bp
T to C, chromosome 6 at 66,716,565 bp
G to T, chromosome 6 at 67,861,397 bp
G to A, chromosome 6 at 119,268,196 bp
A to G, chromosome 6 at 128,675,824 bp
A to T, chromosome 7 at 10,388,750 bp
T to C, chromosome 7 at 29,161,833 bp
A to G, chromosome 7 at 45,154,527 bp
A to G, chromosome 7 at 103,893,465 bp
T to C, chromosome 7 at 127,611,018 bp
A to T, chromosome 7 at 132,564,222 bp
A to G, chromosome 8 at 46,987,083 bp
G to A, chromosome 9 at 7,131,921 bp
A to T, chromosome 9 at 8,022,493 bp
T to C, chromosome 9 at 15,969,799 bp
T to A, chromosome 9 at 49,545,251 bp
C to T, chromosome 9 at 108,063,680 bp
T to C, chromosome 9 at 109,330,853 bp
TTTGCGCATT to TTT, chromosome 10 at 27,043,643 bp
C to T, chromosome 10 at 41,922,219 bp
A to T, chromosome 10 at 78,879,207 bp
T to A, chromosome 11 at 50,900,014 bp
C to T, chromosome 11 at 60,709,568 bp
ACAGCAGCAGCAGCAGCAGCAGCAGCA to ACAGCAGCAGCAGCAGCAGCAGCA, chromosome 11 at 94,214,452 bp
T to A, chromosome 11 at 108,606,284 bp
T to C, chromosome 12 at 25,013,443 bp
T to A, chromosome 12 at 30,884,973 bp
T to A, chromosome 12 at 75,854,101 bp
T to C, chromosome 12 at 80,722,327 bp
A to G, chromosome 13 at 89,601,650 bp
T to C, chromosome 13 at 112,501,161 bp
A to T, chromosome 14 at 16,387,313 bp
G to T, chromosome 14 at 32,448,977 bp
G to A, chromosome 14 at 63,948,478 bp
G to A, chromosome 15 at 12,166,145 bp
A to G, chromosome 15 at 81,006,779 bp
A to G, chromosome 15 at 81,018,386 bp
G to A, chromosome 16 at 19,624,200 bp
G to A, chromosome 16 at 20,720,553 bp
A to G, chromosome 16 at 29,378,500 bp
A to T, chromosome 16 at 36,257,365 bp
A to G, chromosome 16 at 75,879,103 bp
A to T, chromosome 16 at 94,429,455 bp
A to G, chromosome 16 at 94,832,613 bp
T to C, chromosome 16 at 96,683,818 bp
C to T, chromosome 17 at 36,671,220 bp
C to T, chromosome 17 at 56,454,973 bp
C to G, chromosome 18 at 52,331,586 bp
T to C, chromosome 18 at 63,078,791 bp
T to A, chromosome 18 at 77,985,057 bp
T to C, chromosome 19 at 8,161,569 bp
T to G, chromosome 19 at 41,830,322 bp

Genotype Determination

Genotyping Protocol(s)
Center protocol and contact for technical support will be shipped with mice.

Strain Description [Including phenotype, strain background, strain development and suggested control mice]

Phenotype

G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.

Strain Development

C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Suggested Control Mice

Wild-type littermates or C57BL/6J mice

MMRRC Genetic QC

MMRRC Genetic QC Summary

The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.

Strain Origin

Donor

Bruce Beutler, M.D., University of Texas Southwestern Medical Center.

Primary Reference

MUTAGENETIX record for R4899 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information Expand All

Health Status Report

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .

Appearance

Coat Color

Black

Breeding

MMRRC Breeding System

Random intra-strain mating

Breeding Scheme(s)

When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.

Overall Breeding Performance

Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain

Reproductive Statistics

Average litter size

Undetermined

Recommended wean age

3 weeks

Order Request Information Expand All

Availability Level

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Conditions of Distribution [Including applicable technology transfer agreements]

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Fees

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)

MMRRC Item #	Description	Distribution Fee / Unit (US $) Shipping & Handling not included	Units	Notes
042503-MU-RESUS	Litter recovered from cryo-archive	$5,475.00 / Non-Profit	Litter	Recovered litter⁴; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

⁴ The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.

Strain Detail Sheet

Strain Information Expand All

Colony and Husbandry Information Expand All

Order Request Information Expand All