Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4899Btlr/Mmmh
Stock Number:
042503-MU
Citation ID:
RRID:MMRRC_042503-MU
Other Names:
R4899 (G1), C57BL/6J-MtgxR4899Btlr
Major Collection:

Strain Information

Hapln1
Name: hyaluronan and proteoglycan link protein 1
Synonyms: link protein, cartilage linking protein 1, Crtl1l, Crtl1, CLP, LP-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12950
VEGA: 13
HGNC: HGNC:2380
Homologene: 1420
Chat
Name: choline O-acetyltransferase
Synonyms: B230380D24Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12647
VEGA: 14
HGNC: HGNC:1912
Homologene: 40693
Mtarc2
Name: mitochondrial amidoxime reducing component 2
Synonyms: 2810484M10Rik, Mosc2, Marc2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67247
Homologene: 9904
Ptpra
Name: protein tyrosine phosphatase receptor type A
Synonyms: RPTRalpha, PTPalpha, PTP[a], Ptpa, RPTPalpha
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19262
HGNC: HGNC:9664
Homologene: 20621
Ankrd17
Name: ankyrin repeat domain 17
Synonyms: Gtar, 4933425K22Rik, A130069E23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 81702
Homologene: 82403
Ttc3
Name: tetratricopeptide repeat domain 3
Synonyms: TPRD, D16Ium21, 2610202A04Rik, D16Ium21e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 22129
Homologene: 2487
Zfr
Name: zinc finger RNA binding protein
Synonyms: C920030H05Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 22763
Homologene: 8009
Pptc7
Name: PTC7 protein phosphatase homolog
Synonyms: 9130017A15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320717
Homologene: 6100
Smc4
Name: structural maintenance of chromosomes 4
Synonyms: 2500002A22Rik, Smc4l1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70099
Homologene: 4015
Rnf123
Name: ring finger protein 123
Synonyms: KPC1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 84585
Homologene: 11112
Cit
Name: citron
Synonyms: CRIK-SK, citron-N, citron kinase, Cit-k, C030025P15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12704
HGNC: HGNC:1985
Homologene: 21404
Adra2c
Name: adrenergic receptor, alpha 2c
Synonyms: alpha2-C4, subtype alpha2-C4, [a]2C, alpha2C, Adra-2c
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11553
HGNC: HGNC:283
Homologene: 20170
Mrtfa
Name: myocardin related transcription factor A
Synonyms: Mal, Bsac, MRTF-A, Mkl1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223701
Homologene: 32487
Epg5
Name: ectopic P-granules 5 autophagy tethering factor
Synonyms: 5430411K18Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 100502841
VEGA: 18
Homologene: 14575
Ncam1
Name: neural cell adhesion molecule 1
Synonyms: CD56, NCAM-1, NCAM-120, NCAM-140, NCAM-180, E-NCAM, NCAM
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17967
HGNC: HGNC:7656
Homologene: 40754
Frat1
Name: frequently rearranged in advanced T cell lymphomas
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14296
HGNC: HGNC:3944
Homologene: 3999
Enpp6
Name: ectonucleotide pyrophosphatase/phosphodiesterase 6
Synonyms: B830047L21Rik, D8Ertd514e, 4833421B01Rik, Npp6
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 320981
Homologene: 62657
Atp13a5
Name: ATPase type 13A5
Synonyms: C630015F21Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 268878
Homologene: 77451
Il6st
Name: interleukin 6 signal transducer
Synonyms: gp130, CD130, D13Ertd699e, 5133400A03Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16195
HGNC: HGNC:6021
Homologene: 1645
Ptprs
Name: protein tyrosine phosphatase receptor type S
Synonyms: PTP-NU3, PTPsigma, RPTPsigma, Ptpt9
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19280
HGNC: HGNC:9681
Homologene: 20626
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, DHC2, 4432416O06Rik, D330044F14Rik, D030010H02Rik, Dnchc2, b2b414Clo, m407Asp, m152Asp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Tob1
Name: transducer of ErbB-2.1
Synonyms: Trob, Tob
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22057
Homologene: 31334
Lama2
Name: laminin, alpha 2
Synonyms: merosin, mer
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16773
HGNC: HGNC:6482
Homologene: 37306
Piezo2
Name: piezo-type mechanosensitive ion channel component 2
Synonyms: 9430028L06Rik, 9030411M15Rik, Fam38b2, Piezo2, Fam38b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 667742
Homologene: 49695
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: nesprin-2, syne-2, D12Ertd777e, 6820443O06Rik, Nesp2g, Cpfl8, diminished cone electroretinogram, dice
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319565
Homologene: 56700
Oat
Name: ornithine aminotransferase
Synonyms: rhg
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18242
HGNC: HGNC:8091
Homologene: 231
Kidins220
Name: kinase D-interacting substrate 220
Synonyms: 3110039L19Rik, C330002I19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 77480
VEGA: 12
Homologene: 14254
Fat3
Name: FAT atypical cadherin 3
Synonyms: LOC234973, LOC382129, D430038H04Rik, 9430076A06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270120
VEGA: 9
Homologene: 82252
Slc22a29
Name: solute carrier family 22. member 29
Synonyms: D630002G06Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 236293
Homologene: 77136
Col6a3
Name: collagen, type VI, alpha 3
Synonyms: Col6a-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12835
HGNC: HGNC:2213
Homologene: 37917
Zfp629
Name: zinc finger protein 629
Synonyms: 9330199A09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320683
Homologene: 65318
Dscam
Name: DS cell adhesion molecule
Synonyms: 4932410A21Rik, Down syndrome cell adhesion molecule
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13508
HGNC: HGNC:3039
Homologene: 74393
Bmpr1b
Name: bone morphogenetic protein receptor, type 1B
Synonyms: Alk6, CFK-43a, Acvrlk6, BMPR-IB
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12167
HGNC: HGNC:1077
Homologene: 20322
Cass4
Name: Cas scaffolding protein family member 4
Synonyms: F730031O20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320664
Homologene: 75128
Vmn2r10
Name: vomeronasal 2, receptor 10
Synonyms: VR16, V2r16
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22307
Homologene: 129606
Or4c109
Name: olfactory receptor family 4 subfamily C member 109
Synonyms: GA_x6K02T2Q125-50468705-50467770, MOR233-8, Olfr1214
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258899
Homologene: 73984
Or2aj6
Name: olfactory receptor family 2 subfamily AJ member 6
Synonyms: GA_x54KRFPKG5P-16071018-16070077, MOR273-1, MOR273-5, Olfr171
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258960
Homologene: 128058
Fbxw14
Name: F-box and WD-40 domain protein 14
Synonyms: Fbx12, E330009N23Rik, Fbxo12
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 50757
Homologene: 110776
Kcnj6
Name: potassium inwardly-rectifying channel, subfamily J, member 6
Synonyms: Kir3.2, GIRK2, KCNJ7
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16522
VEGA: 16
HGNC: HGNC:6267
Homologene: 1688
Shoc1
Name: shortage in chiasmata 1
Synonyms: LOC242489, Gm426, AI481877, Mzip2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100155
Homologene: 79783
Pde4dip
Name: phosphodiesterase 4D interacting protein (myomegalin)
Synonyms: D3Bwg1078e, 4732458A06Rik, D130016K21Rik, 9430063L05Rik, Usmg4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 83679
Homologene: 66961
Cfap300
Name: cilia and flagella associated protein 300
Synonyms: 9230110C19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 234912
VEGA: 9
Homologene: 13163
Rufy4
Name: RUN and FYVE domain containing 4
Synonyms: F930048N03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 435626
Homologene: 52359
Top2b
Name: topoisomerase (DNA) II beta
Synonyms: Top-2, D230016L12Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21974
Homologene: 134711
Sgsm3
Name: small G protein signaling modulator 3
Synonyms: 1810012I01Rik, CIP85, Rutbc3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105835
Homologene: 9249
Flnc
Name: filamin C, gamma
Synonyms: Fln2, 1110055E19Rik, actin binding protein 280
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68794
HGNC: HGNC:3756
Homologene: 37481
Nlrp4d
Name: NLR family, pyrin domain containing 4D
Synonyms: Nalp-beta, Nalp4d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 384752
Mertk
Name: MER proto-oncogene tyrosine kinase
Synonyms: Tyro 12, Nyk, Eyk, Mer, nmf12
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17289
HGNC: HGNC:7027
Homologene: 4626
Azin2
Name: antizyme inhibitor 2
Synonyms: 4933429I20Rik, Odcp, AZIN2, Adc
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242669
Homologene: 62172
Cacna2d4
Name: calcium channel, voltage-dependent, alpha 2/delta subunit 4
Synonyms: 5730412N02Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 319734
Homologene: 26544
Armc2
Name: armadillo repeat containing 2
Synonyms: 2610018I05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 213402
Homologene: 41848
H2-M1
Name: histocompatibility 2, M region locus 1
Synonyms: Mb1, H-2M1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224756
Homologene: 110792
Clca3a1
Name: chloride channel accessory 3A1
Synonyms: Clca1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12722
HGNC: HGNC:2017
Homologene: 77224
Llgl1
Name: LLGL1 scribble cell polarity complex component
Synonyms: Lgl1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16897
HGNC: HGNC:6628
Homologene: 31220
Or51b17
Name: olfactory receptor family 51 subfamily B member 17
Synonyms: 5'[b]2, MOR1-2, GA_x6K02T2PBJ9-6648196-6649143, Olfr64
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18366
Homologene: 56593
Clec2h
Name: C-type lectin domain family 2, member h
Synonyms: Clrf
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 94071
Homologene: 131164
Or1j19
Name: olfactory receptor family 1 subfamily J member 19
Synonyms: GA_x6K02T2NLDC-33481050-33481991, MOR136-8, Olfr348
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258946
Homologene: 105219
Apbb1ip
Name: amyloid beta precursor protein binding family B member 1 interacting protein
Synonyms: proline-rich protein 48, Prp48, 9930118P07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 54519
Homologene: 32434
Plekhd1
Name: pleckstrin homology domain containing, family D (with coiled-coil domains) member 1
Synonyms: 3830431G21Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217682
Homologene: 15090
Cyp3a25
Name: cytochrome P450, family 3, subfamily a, polypeptide 25
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56388
Homologene: 135775
Sox7
Name: SRY (sex determining region Y)-box 7
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 20680
VEGA: 14
Homologene: 7949
Samsn1
Name: SAM domain, SH3 domain and nuclear localization signals, 1
Synonyms: 4930571B16Rik, Hacs1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67742
Homologene: 11148
Spred3
Name: sprouty-related EVH1 domain containing 3
Synonyms: Spred-3, D130060H24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101809
Homologene: 28061
Csta2
Name: cystatin A family member 2
Synonyms: 2010005H15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 76770
HGNC: HGNC:2481
Homologene: 3819
Nuak2
Name: NUAK family, SNF1-like kinase, 2
Synonyms: 1200013B22Rik, Snark
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74137
Homologene: 12539
Vmn1r36
Name: vomeronasal 1 receptor 36
Synonyms: V1rc11
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171184
Homologene: 110800
Fam47e
Name: family with sequence similarity 47, member E
Synonyms: LOC384198, Gm1381
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384198
Homologene: 129958
Pih1d1
Name: PIH1 domain containing 1
Synonyms: 4933413A04Rik, 1110061L23Rik, Nop17
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68845
Homologene: 9914
Zfp2
Name: zinc finger protein 2
Synonyms: mkr-2, Zfp-2, Fnp-2, 9930007F06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22678
Homologene: 121779
Cep112
Name: centrosomal protein 112
Synonyms: 1700001M19Rik, 1700029K01Rik, 8430407H02Rik, Macoco, Ccdc46
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76380
Homologene: 44915
Polr2h
Name: polymerase (RNA) II (DNA directed) polypeptide H
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 245841
HGNC: HGNC:9195
Homologene: 4540
Ube2r2
Name: ubiquitin-conjugating enzyme E2R 2
Synonyms: Cdc34b, Ubc3b, 1200003M11Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67615
Homologene: 3210
Cnbd2
Name: cyclic nucleotide binding domain containing 2
Synonyms: 5430421B09Rik, 4921517L17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70873
Homologene: 15440
Or7a39
Name: olfactory receptor family 7 subfamily A member 39
Synonyms: GA_x6K02T2QGN0-2932609-2931677, MOR139-6, Olfr1355
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 257734
Homologene: 136441
Napepld
Name: N-acyl phosphatidylethanolamine phospholipase D
Synonyms: NAPE-PLD
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 242864
Homologene: 7094
Tspan1
Name: tetraspanin 1
Synonyms: 9030418M05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66805
Homologene: 21170
Igkv17-127
Name: immunoglobulin kappa variable 17-127
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243433
HGNC: HGNC:5835
Alkal2
Name: ALK and LTK ligand 2
Synonyms: 6230419C23Rik, Fam150b, Augalpha, Augmentor alpha
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100294583
VEGA: 12
Homologene: 87330
Ftmt
Name: ferritin mitochondrial
Synonyms: mitochondrial ferritin, MtF, Fth3, 4930447C24Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67634
VEGA: 18
Homologene: 110661
Fundc2b
Name: FUN14 domain containing 2B
Synonyms: 1700034I23Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 73297
Pramel55
Name: PRAME like 55
Synonyms: E330014E10Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 665943
Homologene: 133100
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 74,147,663 bp
  • C to A, chromosome 1 at 90,802,427 bp
  • A to T, chromosome 1 at 132,324,986 bp
  • A to T, chromosome 1 at 184,845,624 bp
  • T to C, chromosome 2 at 22,823,349 bp
  • A to G, chromosome 2 at 36,786,798 bp
  • A to C, chromosome 2 at 88,988,110 bp
  • C to A, chromosome 2 at 128,783,925 bp
  • T to C, chromosome 2 at 130,544,436 bp
  • G to T, chromosome 2 at 156,339,221 bp
  • A to G, chromosome 2 at 172,427,869 bp
  • C to G, chromosome 3 at 40,905,869 bp
  • T to A, chromosome 3 at 69,031,811 bp
  • C to A, chromosome 3 at 97,709,558 bp
  • T to C, chromosome 3 at 141,840,683 bp
  • T to A, chromosome 3 at 144,737,961 bp
  • T to C, chromosome 4 at 41,190,794 bp
  • T to C, chromosome 4 at 59,062,640 bp
  • T to A, chromosome 4 at 116,163,366 bp
  • G to A, chromosome 4 at 128,934,653 bp
  • A to G, chromosome 5 at 21,683,440 bp
  • A to T, chromosome 5 at 35,280,361 bp
  • A to T, chromosome 5 at 90,264,601 bp
  • G to A, chromosome 5 at 92,574,669 bp
  • T to C, chromosome 5 at 95,801,727 bp
  • A to G, chromosome 5 at 109,003,458 bp
  • A to G, chromosome 5 at 115,863,028 bp
  • G to A, chromosome 5 at 122,284,717 bp
  • A to G, chromosome 5 at 145,977,671 bp
  • A to G, chromosome 6 at 29,446,843 bp
  • T to C, chromosome 6 at 66,716,565 bp
  • G to T, chromosome 6 at 67,861,397 bp
  • G to A, chromosome 6 at 119,268,196 bp
  • A to G, chromosome 6 at 128,675,824 bp
  • A to T, chromosome 7 at 10,388,750 bp
  • T to C, chromosome 7 at 29,161,833 bp
  • A to G, chromosome 7 at 45,154,527 bp
  • A to G, chromosome 7 at 103,893,465 bp
  • T to C, chromosome 7 at 127,611,018 bp
  • A to T, chromosome 7 at 132,564,222 bp
  • A to G, chromosome 8 at 46,987,083 bp
  • G to A, chromosome 9 at 7,131,921 bp
  • A to T, chromosome 9 at 8,022,493 bp
  • T to C, chromosome 9 at 15,969,799 bp
  • T to A, chromosome 9 at 49,545,251 bp
  • C to T, chromosome 9 at 108,063,680 bp
  • T to C, chromosome 9 at 109,330,853 bp
  • TTTGCGCATT to TTT, chromosome 10 at 27,043,643 bp
  • C to T, chromosome 10 at 41,922,219 bp
  • A to T, chromosome 10 at 78,879,207 bp
  • T to A, chromosome 11 at 50,900,014 bp
  • C to T, chromosome 11 at 60,709,568 bp
  • ACAGCAGCAGCAGCAGCAGCAGCAGCA to ACAGCAGCAGCAGCAGCAGCAGCA, chromosome 11 at 94,214,452 bp
  • T to A, chromosome 11 at 108,606,284 bp
  • T to C, chromosome 12 at 25,013,443 bp
  • T to A, chromosome 12 at 30,884,973 bp
  • T to A, chromosome 12 at 75,854,101 bp
  • T to C, chromosome 12 at 80,722,327 bp
  • A to G, chromosome 13 at 89,601,650 bp
  • T to C, chromosome 13 at 112,501,161 bp
  • A to T, chromosome 14 at 16,387,313 bp
  • G to T, chromosome 14 at 32,448,977 bp
  • G to A, chromosome 14 at 63,948,478 bp
  • G to A, chromosome 15 at 12,166,145 bp
  • A to G, chromosome 15 at 81,006,779 bp
  • A to G, chromosome 15 at 81,018,386 bp
  • G to A, chromosome 16 at 19,624,200 bp
  • G to A, chromosome 16 at 20,720,553 bp
  • A to G, chromosome 16 at 29,378,500 bp
  • A to T, chromosome 16 at 36,257,365 bp
  • A to G, chromosome 16 at 75,879,103 bp
  • A to T, chromosome 16 at 94,429,455 bp
  • A to G, chromosome 16 at 94,832,613 bp
  • T to C, chromosome 16 at 96,683,818 bp
  • C to T, chromosome 17 at 36,671,220 bp
  • C to T, chromosome 17 at 56,454,973 bp
  • C to G, chromosome 18 at 52,331,586 bp
  • T to C, chromosome 18 at 63,078,791 bp
  • T to A, chromosome 18 at 77,985,057 bp
  • T to C, chromosome 19 at 8,161,569 bp
  • T to G, chromosome 19 at 41,830,322 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4899 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042503-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.