Strain Name:
Stock Number:
Citation ID:
Other Names:
R4960 (G1), C57BL/6J-MtgxR4960Btlr
Major Collection:

Strain Information

Name: collagen, type II, alpha 1
Synonyms: Del1, Col2a-1, Col2a, Col2, M100856, Rgsc856, Lpk, M100413, Rgsc413
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 12824
Homologene: 55607
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20
Synonyms: ADAMTS-20, bt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223838
Homologene: 11808
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E
Synonyms: Semah
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 20349
Homologene: 8247
Name: attractin
Synonyms: Mgca
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 11990
Homologene: 22542
Name: choline acetyltransferase
Synonyms: B230380D24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 12647
VEGA: 14
Homologene: 40693
Name: neuronal cell adhesion molecule
Synonyms: Bravo, C030017F07Rik, C130076O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 319504
VEGA: 12
Homologene: 21041
Name: N-myc downstream regulated gene 3
Synonyms: Ndr3, 4833415O14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 29812
Homologene: 40903
Name: C-terminal binding protein 2
Synonyms: D7Ertd45e, Ribeye, Gtrgeo6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 13017
Homologene: 75187
Name: mitochondrial amidoxime reducing component 2
Synonyms: 2810484M10Rik, Mosc2, Marc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67247
Homologene: 9904
Name: microtubule-associated protein 1B
Synonyms: MAP5, Mtap-5, Mtap5, LC1, Mtap1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17755
VEGA: 13
Homologene: 38111
Name: THO complex 7
Synonyms: 9230101K24Rik, 1500006O09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 66231
VEGA: 14
Homologene: 11821
Name: BTB (POZ) domain containing 11
Synonyms: 6330404E16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 74007
Homologene: 72536
Name: transformation related protein 53 binding protein 1
Synonyms: 53BP1, p53BP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 27223
Homologene: 4137
Name: chromodomain helicase DNA binding protein 1
Synonyms: 4930525N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 12648
Homologene: 68174
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1
Synonyms: sodium-hydrogen exchanger regulatory factor, NHE-RF, NHERF1, EBP-50
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 26941
Homologene: 3137
Name: tumor necrosis factor, alpha-induced protein 1 (endothelial)
Synonyms: Edp-1, Edp1, Tnfip1, Bacurd2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 21927
Homologene: 22519
Name: protein tyrosine phosphatase, receptor type, G
Synonyms: 5430405N12Rik, RPTPgamma
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 19270
Homologene: 2129
Name: tubulin-specific chaperone d
Synonyms: A030005L14Rik, 2310057L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 108903
Homologene: 4368
Name: anaphase promoting complex subunit 1
Synonyms: tsg24, Apc1, 2610021O03Rik, Mcpr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 17222
Homologene: 7414
Name: nuclear cap binding protein subunit 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 433702
Homologene: 1859
Name: A kinase (PRKA) anchor protein (yotiao) 9
Synonyms: AKAP450, 5730481H23Rik, G1-448-15, repro12, mei2-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100986
Homologene: 134583
Name: general transcription factor II I repeat domain-containing 1
Synonyms: WBSCR11, Cream1, GTF3, MusTRD1, binding factor for early enhancer, BEN, ESTM9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 57080
Homologene: 4158
Name: ring finger protein 20
Synonyms: 4833430L21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 109331
Homologene: 5571
Name: ataxin 3
Synonyms: Sca3, MJD1, 2210008M02Rik, ataxin-3, Mjd, Atx3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 110616
Homologene: 3658
Name: tetratricopeptide repeat domain 37
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218343
VEGA: 13
Homologene: 40966
Name: melanocortin 5 receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 17203
VEGA: 18
Homologene: 4321
Name: neutral sphingomyelinase (N-SMase) activation associated factor
Synonyms: Fan, factor associated with N-SMase activation
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18201
Homologene: 2652
Name: aryl hydrocarbon receptor nuclear translocator-like
Synonyms: Arnt3, MOP3, Bmal1, bHLHe5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11865
Homologene: 910
Name: muscleblind like splicing factor 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 56758
Homologene: 23186
Name: phytanoyl-CoA hydroxylase interacting protein-like
Synonyms: 4921522K17Rik, PHY2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 70911
Homologene: 13028
Name: G-protein signalling modulator 1 (AGS3-like, C. elegans)
Synonyms: 1810037C22Rik, Ags3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 67839
Homologene: 16987
Name: laminin, alpha 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16776
Homologene: 4060
Name: Rho GTPase activating protein 17
Synonyms: WBP15, Nadrin, Rich1, 5730403H17Rik, Nadrin2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 70497
Homologene: 9984
Name: centrosome and spindle pole associated protein 1
Synonyms: 4930413O22Rik, 2310020J12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 211660
Homologene: 23487
Name: DNA segment, Chr 5, ERATO Doi 579, expressed
Synonyms: 9030221A05Rik, A930018H20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 320661
Homologene: 19716
Name: ADAMTS-like 1
Synonyms: punctin-1, 6720426B09Rik, 5930437A14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 77739
Homologene: 64642
Name: cyclin-dependent kinase 12
Synonyms: 1810022J16Rik, Crk7, D11Ertd752e, Crkrs
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 69131
Homologene: 128632
Name: muskelin 1, intracellular mediator containing kelch motifs
Synonyms: A130067F06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 27418
Homologene: 8305
Name: discoidin, CUB and LCCL domain containing 1
Synonyms: 4631413K11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 66686
Homologene: 12010
Name: reticulophagy regulator family member 3
Synonyms: 4933404C01Rik, 1300010M03Rik, Fam134c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 67998
Homologene: 23585
Name: Opa interacting protein 5
Synonyms: 5730547N13Rik, Lint-25
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 70645
Homologene: 5268
Name: transmembrane and tetratricopeptide repeat containing 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 387314
Homologene: 65299
Name: shisa family member 4
Synonyms: 9330132O05Rik, Tmem58
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 77552
Homologene: 18428
Name: tweety family member 1
Synonyms: tty, 6330408P11Rik, 4930459B04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 57776
Homologene: 10779
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 1
Synonyms: antiporter, Nhe1, Apnh, Nhe-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 20544
Homologene: 20660
Name: reticulon 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 20168
VEGA: 19
Homologene: 24934
Name: ceruloplasmin
Synonyms: D3Ertd555e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 12870
Homologene: 75
Name: ryanodine receptor 1, skeletal muscle
Synonyms: calcium release channel isoform 1, Ryr, skrr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 20190
Homologene: 68069
Name: ubiquitin specific peptidase 2
Synonyms: ubp41, B930035K21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 53376
Homologene: 3098
Name: integrin alpha M
Synonyms: complement component receptor 3 alpha, CD11B (p170), Mac-1 alpha, Mac-1, complement receptor type 3, CR3, CD11b/CD18, Mac-1a, F730045J24Rik, Ly-40, Cd11b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16409
Homologene: 526
Name: ADAMTS-like 3
Synonyms: punctin-2, 9230119C12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 269959
Homologene: 18912
Name: kinase D-interacting substrate 220
Synonyms: 3110039L19Rik, C330002I19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 77480
VEGA: 12
Homologene: 14254
Name: DEAH (Asp-Glu-Ala-His) box polypeptide 36
Synonyms: Ddx36, 2810407E23Rik, RHAU
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 72162
Homologene: 6356
Name: laminin gamma 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 23928
Homologene: 21222
Name: hephaestin-like 1
Synonyms: LOC244698, Zp, zyklopen, thd, cw
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 244698
Homologene: 9112
Name: cytochrome P450, family 2, subfamily c, polypeptide 66
Synonyms: 2010301M18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 69888
Homologene: 133566
Name: COMM domain containing 6
Synonyms: 1700063H17Rik, 1110059J08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 66200
Homologene: 52572
Name: olfactory receptor family 4 subfamily F member 62
Synonyms: GA_x6K02T2Q125-73202172-73203134, MOR245-16, Olfr1318
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258022
Homologene: 134079
Name: adenylate cyclase 3
Synonyms: AC3, ACIII
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 104111
Homologene: 2978
Name: leucine rich repeat containing 43
Synonyms: LOC381741
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 381741
Homologene: 17662
Name: collagen, type VI, alpha 3
Synonyms: Col6a-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12835
Homologene: 37917
Name: bone morphogenetic protein receptor, type 1B
Synonyms: Alk6, CFK-43a, Acvrlk6, BMPR-IB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 12167
Homologene: 20322
Name: Eph receptor B3
Synonyms: Sek4, MDK5, HEK2, Etk2, Tyro6, Cek10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 13845
Homologene: 20938
Name: solute carrier family 26 (sulfate transporter), member 2
Synonyms: ST-OB, Dtd
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 13521
Homologene: 73876
Name: deuterosome assembly protein 1
Synonyms: 4933401K09Rik, Ccdc67
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 234964
Homologene: 18760
Name: ligand of numb-protein X 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 140887
Homologene: 17737
Name: teashirt zinc finger family member 1
Synonyms: NY-CO-33, D18Bwg1409e, 5730407I04Rik, Mtsh1, Sdccag33, teashirt1, Tsh1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 110796
Homologene: 4227
Name: tetratricopeptide repeat domain 21A
Synonyms: 4921538N17Rik, Thm2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 74052
Homologene: 14728
Name: ets variant 3
Synonyms: ETS-domain transcriptional repressor, METS, Pe1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 27049
Homologene: 21085
Name: predicted gene 4787
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 214321
Homologene: 86950
Name: potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Synonyms: Slo, mSlo1, Slo1, MaxiK, BK channel alpha subunit, 5730414M22Rik, BKCa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 16531
Homologene: 1693
Name: phosphoinositide-3-kinase regulatory subunit 5
Synonyms: p101, Foap2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 320207
Homologene: 8627
Name: ganglioside-induced differentiation-associated protein 1-like 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228858
Homologene: 11426
Name: neurexin III
Synonyms: neurexin III beta, neurexin III alpha, neurexin III beta, neurexin III alpha, 9330112C09Rik, D12Bwg0831e, 4933401A11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 18191
Homologene: 83225
Name: growth regulation by estrogen in breast cancer-like
Synonyms: mKIAA4095, AK220484
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 381157
Homologene: 73393
Name: PITPNM family member 3
Synonyms: A330068P14Rik, Ackr6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 327958
Homologene: 66271
Name: 5-phosphohydroxy-L-lysine phospholyase
Synonyms: 2900006B13Rik, Agxt2l2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 72947
Homologene: 75268
Name: dynein, axonemal, heavy chain 7B
Synonyms: LOC227058, Dnahc7b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227058
Homologene: 41287
Name: synaptosomal-associated protein, 47
Synonyms: SNAP-47, 1110031B06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 67826
Homologene: 14206
Name: thymopoietin
Synonyms: TP, 5630400D24Rik, LAP2, lamina-associated polypeptide 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 21917
VEGA: 10
Homologene: 31144
Name: RWD domain containing 3
Synonyms: 3110037C01Rik, 2510027J23Rik, RSUME
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 66568
Homologene: 22899
Name: WD repeat domain 46
Synonyms: 2310007I04Rik, Bing4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 57315
Homologene: 3981
Name: spindle and centriole associated protein 1
Synonyms: D16Ertd480e, Ccdc52
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 212514
Homologene: 16931
Name: CAP-GLY domain containing linker protein 1
Synonyms: cytoplasmic linker protein 50, Clip50, CLIP-170, 1110007I12Rik, 4631429H07Rik, Rsn, Clip 170, restin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 56430
Homologene: 74455
Name: microtubule associated serine/threonine kinase 1
Synonyms: 9430008B02Rik, SAST170, SAST
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 56527
Homologene: 10543
Name: kelch-like 35
Synonyms: 2810406K13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 72184
Homologene: 27849
Name: olfactory receptor family 5 subfamily AC member 20
Synonyms: GA_x54KRFPKG5P-55498766-55497843, MOR182-1, Olfr202
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 258997
Homologene: 138323
Name: ATPase, class I, type 8B, member 4
Synonyms: Im
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241633
Homologene: 133162
Name: TRAF3 interacting protein 2
Synonyms: Act1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 103213
Homologene: 15885
Name: ubiquitin specific peptidase 31
Synonyms: 6330567E21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 76179
Homologene: 44504
Name: olfactory receptor family 9 subfamily A member 2
Synonyms: GA_x6K02T2P3E9-5780974-5781915, MOR120-1, Olfr459
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 258569
Homologene: 83448
Name: RIKEN cDNA 4931428F04 gene
Synonyms: MATCAP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 74356
Homologene: 47588
Name: catenin (cadherin associated protein), alpha 2
Synonyms: alpha(N)-catenin, alpha N-catenin, Catna, chp, Catna2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 12386
Homologene: 68394
Name: TSPO associated protein 1
Synonyms: peripheral, Bzrap1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 207777
Homologene: 37961
Name: dynein cytoplasmic 2 light intermediate chain 1
Synonyms: mD2LIC, CGI-60, LIC3, 4933404O11Rik, D2lic
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 213575
VEGA: 17
Homologene: 9336
Name: olfactory receptor family 52 subfamily N member 2B
Synonyms: GA_x6K02T2PBJ9-7546146-7545166, MOR34-2, MOR34-11, Olfr667
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259062
Homologene: 121559
Name: cannabinoid receptor 2 (macrophage)
Synonyms: CB2-R, cannabinoid receptor 2 (spleen), CB2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 12802
Homologene: 1389
Name: solute carrier family 25, member 54
Synonyms: 4930443G12Rik, SCaMC-1like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 74686
Homologene: 82464
Name: chymotrypsin-like elastase family, member 3A
Synonyms: Gm13011
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242711
Homologene: 129880
Name: chloride channel accessory 4C, pseudogene
Synonyms: Gm6289, Clca4c, Gm18718
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 622139
Name: flagellum associated containing coiled-coil domains 1
Synonyms: 4933405P16Rik, 4933425F06Rik, Als2cr12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 108812
Homologene: 51399
Name: oocyte maturation, alpha
Synonyms: OM2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 18379
Homologene: 136010
Name: mago homolog B, exon junction complex core component
Synonyms: 2010012C16Rik, Magoh-rs1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 66441
Homologene: 56794
Name: cytochrome P450, family 2, subfamily j, polypeptide 8
Synonyms: OTTMUSG00000007938, Cyp2j8-ps
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 665095
Homologene: 133819
Name: basic leucine zipper transcription factor, ATF-like 3
Synonyms: 9130211I03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 381319
Homologene: 41280
Name: cytochrome P450, family 2, subfamily a, polypeptide 12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 13085
Homologene: 69128
Name: lymphocyte antigen 6 complex, locus G6D
Synonyms: NG32, G6f, NG25, G6d, MEGT1, A930024F17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 114654
Homologene: 76442
Name: MAS-related GPR, member E
Synonyms: MrgE, C130069N09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 244238
Homologene: 18469
Name: cytochrome P450, family 4, subfamily v, polypeptide 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 102294
Homologene: 133054
Name: src homology 2 domain-containing transforming protein E
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 214547
Homologene: 18186
Name: ADP-ribosyltransferase 2b
Synonyms: Rt6-2, Rt-6, Rt6, ART2.2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11872
Homologene: 113756
Name: olfactory receptor family 6 subfamily C member 88
Synonyms: GA_x6K02T2PULF-11248702-11249664, MOR114-11, Olfr794
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 258375
Homologene: 45066
Name: secernin 1
Synonyms: 6330535A03Rik, SES1, 2810019K23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 69938
Homologene: 8853
Name: bolA-like 1 (E. coli)
Synonyms: 1810037G04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 69168
Homologene: 41103
Name: TBC1 domain family, member 30
Synonyms: 4930505D03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 74694
VEGA: 10
Homologene: 18930
Name: mono-ADP ribosylhydrolase 2, opposite strand 2
Synonyms: Gm14105
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Name: RIKEN cDNA 5330439B14 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 321015
Name: cannabinoid receptor interacting protein 1
Synonyms: 5330437A18Rik, 3110054C06Rik, 1500041B16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 380686
Homologene: 9153
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 10,126,463 bp
  • T to A, chromosome 1 at 46,233,726 bp
  • T to A, chromosome 1 at 58,667,806 bp
  • T to A, chromosome 1 at 90,804,218 bp
  • C to A, chromosome 1 at 135,374,990 bp
  • T to A, chromosome 1 at 184,833,919 bp
  • C to T, chromosome 1 at 191,098,510 bp
  • G to A, chromosome 2 at 26,326,247 bp
  • A to G, chromosome 2 at 31,915,954 bp
  • A to G, chromosome 2 at 112,156,352 bp
  • TGAGAAA to T, chromosome 2 at 119,617,861 bp
  • A to G, chromosome 2 at 121,216,027 bp
  • A to T, chromosome 2 at 126,392,759 bp
  • C to T, chromosome 2 at 128,684,594 bp
  • C to T, chromosome 2 at 130,995,047 bp
  • A to T, chromosome 2 at 141,232,346 bp
  • A to G, chromosome 2 at 156,937,330 bp
  • T to C, chromosome 2 at 163,453,859 bp
  • A to G, chromosome 2 at 180,208,252 bp
  • G to A, chromosome 3 at 19,973,797 bp
  • A to G, chromosome 3 at 60,595,696 bp
  • A to T, chromosome 3 at 62,496,859 bp
  • A to G, chromosome 3 at 87,528,061 bp
  • A to G, chromosome 3 at 89,834,237 bp
  • A to G, chromosome 3 at 96,197,054 bp
  • A to T, chromosome 3 at 109,112,816 bp
  • A to G, chromosome 3 at 121,158,821 bp
  • A to T, chromosome 3 at 141,870,785 bp
  • C to T, chromosome 3 at 144,889,619 bp
  • T to A, chromosome 4 at 6,423,342 bp
  • C to T, chromosome 4 at 46,165,273 bp
  • A to G, chromosome 4 at 49,638,029 bp
  • C to T, chromosome 4 at 86,424,173 bp
  • T to C, chromosome 4 at 96,507,377 bp
  • T to C, chromosome 4 at 101,941,464 bp
  • T to A, chromosome 4 at 133,370,656 bp
  • G to A, chromosome 4 at 135,917,607 bp
  • G to A, chromosome 4 at 137,402,648 bp
  • G to T, chromosome 5 at 3,957,664 bp
  • A to G, chromosome 5 at 14,252,632 bp
  • G to A, chromosome 5 at 36,616,227 bp
  • A to G, chromosome 5 at 123,499,612 bp
  • T to A, chromosome 5 at 123,654,003 bp
  • A to G, chromosome 5 at 134,395,685 bp
  • C to T, chromosome 5 at 147,019,040 bp
  • T to C, chromosome 6 at 31,459,006 bp
  • C to A, chromosome 6 at 41,772,069 bp
  • T to C, chromosome 6 at 54,534,422 bp
  • C to T, chromosome 6 at 77,653,111 bp
  • T to C, chromosome 6 at 131,288,117 bp
  • A to T, chromosome 6 at 142,620,783 bp
  • TGTCCGCCAGGCCCTTGCCCCAGAAGTC to TGTC, chromosome 6 at 148,443,947 bp
  • T to C, chromosome 7 at 4,128,226 bp
  • A to G, chromosome 7 at 27,034,150 bp
  • T to C, chromosome 7 at 29,078,783 bp
  • A to C, chromosome 7 at 82,566,977 bp
  • G to T, chromosome 7 at 99,469,068 bp
  • T to A, chromosome 7 at 101,580,230 bp
  • A to G, chromosome 7 at 104,916,708 bp
  • T to A, chromosome 7 at 113,299,435 bp
  • T to C, chromosome 7 at 121,648,645 bp
  • G to T, chromosome 7 at 123,286,926 bp
  • A to C, chromosome 7 at 128,115,840 bp
  • T to C, chromosome 7 at 133,014,238 bp
  • A to T, chromosome 7 at 143,781,351 bp
  • A to G, chromosome 8 at 45,320,637 bp
  • T to A, chromosome 8 at 84,917,871 bp
  • G to T, chromosome 8 at 105,283,211 bp
  • T to C, chromosome 9 at 15,086,290 bp
  • G to T, chromosome 9 at 15,600,968 bp
  • T to A, chromosome 9 at 44,075,813 bp
  • T to A, chromosome 9 at 78,313,023 bp
  • A to G, chromosome 9 at 119,945,001 bp
  • A to G, chromosome 10 at 39,646,819 bp
  • T to C, chromosome 10 at 52,261,755 bp
  • A to G, chromosome 10 at 70,568,985 bp
  • A to C, chromosome 10 at 85,651,662 bp
  • G to A, chromosome 10 at 91,153,309 bp
  • G to A, chromosome 10 at 121,267,216 bp
  • A to C, chromosome 10 at 129,571,026 bp
  • A to G, chromosome 11 at 17,052,228 bp
  • T to A, chromosome 11 at 51,592,101 bp
  • A to T, chromosome 11 at 59,428,543 bp
  • A to G, chromosome 11 at 68,493,638 bp
  • A to T, chromosome 11 at 72,074,666 bp
  • A to T, chromosome 11 at 78,527,570 bp
  • C to T, chromosome 11 at 87,766,396 bp
  • T to A, chromosome 11 at 98,224,673 bp
  • A to G, chromosome 11 at 101,098,466 bp
  • A to G, chromosome 11 at 115,176,463 bp
  • T to A, chromosome 11 at 121,573,855 bp
  • G to T, chromosome 12 at 4,134,896 bp
  • T to A, chromosome 12 at 24,992,260 bp
  • A to G, chromosome 12 at 44,566,299 bp
  • C to T, chromosome 12 at 81,379,316 bp
  • A to T, chromosome 12 at 88,795,201 bp
  • T to C, chromosome 12 at 101,948,379 bp
  • T to A, chromosome 13 at 76,185,156 bp
  • A to G, chromosome 13 at 99,432,212 bp
  • A to T, chromosome 14 at 12,237,837 bp
  • A to T, chromosome 14 at 13,953,460 bp
  • T to C, chromosome 14 at 24,004,118 bp
  • A to G, chromosome 14 at 32,420,814 bp
  • C to T, chromosome 14 at 101,640,384 bp
  • T to C, chromosome 15 at 94,379,774 bp
  • T to C, chromosome 15 at 97,976,149 bp
  • A to G, chromosome 16 at 21,220,495 bp
  • C to A, chromosome 16 at 44,370,762 bp
  • A to G, chromosome 16 at 59,283,985 bp
  • T to A, chromosome 17 at 15,742,231 bp
  • T to C, chromosome 17 at 33,941,185 bp
  • C to A, chromosome 17 at 35,071,754 bp
  • T to G, chromosome 17 at 84,633,541 bp
  • T to A, chromosome 18 at 10,547,306 bp
  • T to C, chromosome 18 at 61,198,803 bp
  • T to G, chromosome 18 at 68,338,819 bp
  • T to C, chromosome 18 at 84,014,862 bp
  • A to T, chromosome 19 at 7,456,521 bp
  • A to T, chromosome 19 at 39,163,322 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4960 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042557-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.