Strain Name:
C57BL/6J-MtgxR4960Btlr/Mmmh
Stock Number:
042557-MU
Citation ID:
RRID:MMRRC_042557-MU
Other Names:
R4960 (G1), C57BL/6J-MtgxR4960Btlr
Major Collection:

Gene Information

Col2a1
Name: collagen, type II, alpha 1
Synonyms: Col2a-1, Col2a, Del1, Col2, M100856, Rgsc856, Lpk, M100413, Rgsc413
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 12824
HGNC: HGNC:2200
Homologene: 55607
Adamts20
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20
Synonyms: ADAMTS-20, bt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223838
Homologene: 11808
Sema3e
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E
Synonyms: Semah
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 20349
Homologene: 8247
Atrn
Name: attractin
Synonyms: Mgca
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 11990
HGNC: HGNC:885
Homologene: 22542
Chat
Name: choline acetyltransferase
Synonyms: B230380D24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 12647
VEGA: 14
HGNC: HGNC:1912
Homologene: 40693
Nrcam
Name: neuronal cell adhesion molecule
Synonyms: Bravo, C030017F07Rik, C130076O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 319504
VEGA: 12
HGNC: HGNC:7994
Homologene: 21041
Ndrg3
Name: N-myc downstream regulated gene 3
Synonyms: Ndr3, 4833415O14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 29812
Homologene: 40903
Ctbp2
Name: C-terminal binding protein 2
Synonyms: D7Ertd45e, Ribeye, Gtrgeo6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 13017
HGNC: HGNC:2495
Homologene: 75187
Mtarc2
Name: mitochondrial amidoxime reducing component 2
Synonyms: 2810484M10Rik, Mosc2, Marc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67247
Homologene: 9904
Map1b
Name: microtubule-associated protein 1B
Synonyms: MAP5, Mtap-5, Mtap5, LC1, Mtap1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17755
VEGA: 13
HGNC: HGNC:6836
Homologene: 38111
Thoc7
Name: THO complex 7
Synonyms: 9230101K24Rik, 1500006O09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 66231
VEGA: 14
Homologene: 11821
Btbd11
Name: BTB (POZ) domain containing 11
Synonyms: 6330404E16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 74007
Homologene: 72536
Trp53bp1
Name: transformation related protein 53 binding protein 1
Synonyms: 53BP1, p53BP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 27223
Homologene: 4137
Chd1
Name: chromodomain helicase DNA binding protein 1
Synonyms: 4930525N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 12648
HGNC: HGNC:1915
Homologene: 68174
Slc9a3r1
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1
Synonyms: sodium-hydrogen exchanger regulatory factor, NHE-RF, NHERF1, EBP-50
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 26941
Homologene: 3137
Tnfaip1
Name: tumor necrosis factor, alpha-induced protein 1 (endothelial)
Synonyms: Edp-1, Edp1, Tnfip1, Bacurd2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 21927
Homologene: 22519
Ptprg
Name: protein tyrosine phosphatase, receptor type, G
Synonyms: 5430405N12Rik, RPTPgamma
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 19270
HGNC: HGNC:9671
Homologene: 2129
Tbcd
Name: tubulin-specific chaperone d
Synonyms: A030005L14Rik, 2310057L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 108903
Homologene: 4368
Anapc1
Name: anaphase promoting complex subunit 1
Synonyms: tsg24, Apc1, 2610021O03Rik, Mcpr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 17222
Homologene: 7414
Ncbp1
Name: nuclear cap binding protein subunit 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 433702
HGNC: HGNC:7658
Homologene: 1859
Akap9
Name: A kinase (PRKA) anchor protein (yotiao) 9
Synonyms: AKAP450, 5730481H23Rik, G1-448-15, repro12, mei2-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100986
HGNC: HGNC:379
Homologene: 134583
Gtf2ird1
Name: general transcription factor II I repeat domain-containing 1
Synonyms: WBSCR11, Cream1, GTF3, MusTRD1, binding factor for early enhancer, BEN, ESTM9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 57080
HGNC: HGNC:4661
Homologene: 4158
Rnf20
Name: ring finger protein 20
Synonyms: 4833430L21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 109331
Homologene: 5571
Atxn3
Name: ataxin 3
Synonyms: Sca3, MJD1, 2210008M02Rik, ataxin-3, Mjd, Atx3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 110616
HGNC: HGNC:7106
Homologene: 3658
Ttc37
Name: tetratricopeptide repeat domain 37
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218343
VEGA: 13
Homologene: 40966
Mc5r
Name: melanocortin 5 receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 17203
VEGA: 18
HGNC: HGNC:6933
Homologene: 4321
Nsmaf
Name: neutral sphingomyelinase (N-SMase) activation associated factor
Synonyms: Fan, factor associated with N-SMase activation
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18201
HGNC: HGNC:8017
Homologene: 2652
Arntl
Name: aryl hydrocarbon receptor nuclear translocator-like
Synonyms: Arnt3, MOP3, Bmal1, bHLHe5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11865
HGNC: HGNC:701
Homologene: 910
Mbnl1
Name: muscleblind like splicing factor 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 56758
HGNC: HGNC:6923
Homologene: 23186
Phyhipl
Name: phytanoyl-CoA hydroxylase interacting protein-like
Synonyms: 4921522K17Rik, PHY2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 70911
Homologene: 13028
Gpsm1
Name: G-protein signalling modulator 1 (AGS3-like, C. elegans)
Synonyms: 1810037C22Rik, Ags3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 67839
Homologene: 16987
Lama5
Name: laminin, alpha 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16776
HGNC: HGNC:6485
Homologene: 4060
Arhgap17
Name: Rho GTPase activating protein 17
Synonyms: WBP15, Nadrin, Rich1, 5730403H17Rik, Nadrin2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 70497
Homologene: 9984
Cspp1
Name: centrosome and spindle pole associated protein 1
Synonyms: 4930413O22Rik, 2310020J12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 211660
Homologene: 23487
D5Ertd579e
Name: DNA segment, Chr 5, ERATO Doi 579, expressed
Synonyms: 9030221A05Rik, A930018H20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 320661
Homologene: 19716
Adamtsl1
Name: ADAMTS-like 1
Synonyms: punctin-1, 6720426B09Rik, 5930437A14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 77739
Homologene: 64642
Cdk12
Name: cyclin-dependent kinase 12
Synonyms: 1810022J16Rik, Crk7, D11Ertd752e, Crkrs
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 69131
Homologene: 128632
Mkln1
Name: muskelin 1, intracellular mediator containing kelch motifs
Synonyms: A130067F06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 27418
HGNC: HGNC:7109
Homologene: 8305
Dcbld1
Name: discoidin, CUB and LCCL domain containing 1
Synonyms: 4631413K11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 66686
Homologene: 12010
Retreg3
Name: reticulophagy regulator family member 3
Synonyms: 4933404C01Rik, 1300010M03Rik, Fam134c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 67998
Homologene: 23585
Oip5
Name: Opa interacting protein 5
Synonyms: 5730547N13Rik, Lint-25
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 70645
Homologene: 5268
Tmtc1
Name: transmembrane and tetratricopeptide repeat containing 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 387314
Homologene: 65299
Shisa4
Name: shisa family member 4
Synonyms: 9330132O05Rik, Tmem58
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 77552
Homologene: 18428
Ttyh1
Name: tweety family member 1
Synonyms: tty, 6330408P11Rik, 4930459B04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 57776
Homologene: 10779
Slc9a1
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 1
Synonyms: antiporter, Apnh, Nhe1, Nhe-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 20544
Homologene: 20660
Rtn3
Name: reticulon 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 20168
VEGA: 19
Homologene: 24934
Cp
Name: ceruloplasmin
Synonyms: D3Ertd555e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 12870
HGNC: HGNC:2295
Homologene: 75
Ryr1
Name: ryanodine receptor 1, skeletal muscle
Synonyms: calcium release channel isoform 1, Ryr, skrr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 20190
Homologene: 68069
Usp2
Name: ubiquitin specific peptidase 2
Synonyms: ubp41, B930035K21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 53376
Homologene: 3098
Itgam
Name: integrin alpha M
Synonyms: complement component receptor 3 alpha, CD11B (p170), Mac-1 alpha, Mac-1, complement receptor type 3, CR3, CD11b/CD18, Mac-1a, F730045J24Rik, Ly-40, Cd11b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16409
HGNC: HGNC:6149
Homologene: 526
Adamtsl3
Name: ADAMTS-like 3
Synonyms: punctin-2, 9230119C12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 269959
Homologene: 18912
Kidins220
Name: kinase D-interacting substrate 220
Synonyms: 3110039L19Rik, C330002I19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 77480
VEGA: 12
Homologene: 14254
Dhx36
Name: DEAH (Asp-Glu-Ala-His) box polypeptide 36
Synonyms: Ddx36, 2810407E23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 72162
Homologene: 6356
Lamc3
Name: laminin gamma 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 23928
HGNC: HGNC:6494
Homologene: 21222
Hephl1
Name: hephaestin-like 1
Synonyms: LOC244698, Zp, zyklopen, thd, cw
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 244698
Homologene: 9112
Cyp2c66
Name: cytochrome P450, family 2, subfamily c, polypeptide 66
Synonyms: 2010301M18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 69888
HGNC: HGNC:2623
Homologene: 133566
Commd6
Name: COMM domain containing 6
Synonyms: 1700063H17Rik, 1110059J08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 66200
Homologene: 52572
Olfr1318
Name: olfactory receptor 1318
Synonyms: GA_x6K02T2Q125-73202172-73203134, MOR245-16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258022
Homologene: 134079
Adcy3
Name: adenylate cyclase 3
Synonyms: AC3, ACIII
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 104111
HGNC: HGNC:234
Homologene: 2978
Lrrc43
Name: leucine rich repeat containing 43
Synonyms: LOC381741
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 381741
Homologene: 17662
Col6a3
Name: collagen, type VI, alpha 3
Synonyms: Col6a-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12835
HGNC: HGNC:2213
Homologene: 37917
Bmpr1b
Name: bone morphogenetic protein receptor, type 1B
Synonyms: Alk6, CFK-43a, Acvrlk6, BMPR-IB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 12167
HGNC: HGNC:1077
Homologene: 20322
Ephb3
Name: Eph receptor B3
Synonyms: Sek4, MDK5, HEK2, Etk2, Tyro6, Cek10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 13845
HGNC: HGNC:3394
Homologene: 20938
Slc26a2
Name: solute carrier family 26 (sulfate transporter), member 2
Synonyms: ST-OB, Dtd
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 13521
Homologene: 73876
Pramel19
Name: PRAME like 19
Synonyms: Gm12794
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 332923
Deup1
Name: deuterosome assembly protein 1
Synonyms: 4933401K09Rik, Ccdc67
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 234964
Homologene: 18760
Lnx2
Name: ligand of numb-protein X 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 140887
Homologene: 17737
Tshz1
Name: teashirt zinc finger family member 1
Synonyms: NY-CO-33, D18Bwg1409e, 5730407I04Rik, Mtsh1, teashirt1, Sdccag33, Tsh1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 110796
Homologene: 4227
Ttc21a
Name: tetratricopeptide repeat domain 21A
Synonyms: 4921538N17Rik, Thm2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 74052
Homologene: 14728
Etv3
Name: ets variant 3
Synonyms: ETS-domain transcriptional repressor, METS, Pe1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 27049
HGNC: HGNC:3492
Homologene: 21085
Gm4787
Name: predicted gene 4787
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 214321
Homologene: 86950
Kcnma1
Name: potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Synonyms: Slo, mSlo1, Slo1, MaxiK, BK channel alpha subunit, 5730414M22Rik, BKCa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 16531
HGNC: HGNC:6284
Homologene: 1693
Pik3r5
Name: phosphoinositide-3-kinase regulatory subunit 5
Synonyms: Foap2, p101
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 320207
Homologene: 8627
Gdap1l1
Name: ganglioside-induced differentiation-associated protein 1-like 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228858
HGNC: HGNC:4213
Homologene: 11426
Nrxn3
Name: neurexin III
Synonyms: neurexin III beta, neurexin III alpha, neurexin III beta, neurexin III alpha, 9330112C09Rik, D12Bwg0831e, 4933401A11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 18191
HGNC: HGNC:8010
Homologene: 83225
Greb1l
Name: growth regulation by estrogen in breast cancer-like
Synonyms: mKIAA4095, AK220484
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 381157
Homologene: 73393
Pitpnm3
Name: PITPNM family member 3
Synonyms: A330068P14Rik, Ackr6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 327958
Homologene: 66271
Phykpl
Name: 5-phosphohydroxy-L-lysine phospholyase
Synonyms: 2900006B13Rik, Agxt2l2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 72947
Homologene: 75268
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: LOC227058, Dnahc7b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227058
Homologene: 41287
Snap47
Name: synaptosomal-associated protein, 47
Synonyms: SNAP-47, 1110031B06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 67826
Homologene: 14206
Tmpo
Name: thymopoietin
Synonyms: TP, 5630400D24Rik, LAP2, lamina-associated polypeptide 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 21917
VEGA: 10
Homologene: 31144
Rwdd3
Name: RWD domain containing 3
Synonyms: 3110037C01Rik, 2510027J23Rik, RSUME
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 66568
Homologene: 22899
Wdr46
Name: WD repeat domain 46
Synonyms: 2310007I04Rik, Bing4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 57315
Homologene: 3981
Spice1
Name: spindle and centriole associated protein 1
Synonyms: D16Ertd480e, Ccdc52
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 212514
Homologene: 16931
Clip1
Name: CAP-GLY domain containing linker protein 1
Synonyms: cytoplasmic linker protein 50, Clip50, CLIP-170, 1110007I12Rik, 4631429H07Rik, Rsn, Clip 170, restin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 56430
Homologene: 74455
Mast1
Name: microtubule associated serine/threonine kinase 1
Synonyms: 9430008B02Rik, SAST170, SAST
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 56527
Homologene: 10543
Klhl35
Name: kelch-like 35
Synonyms: 2810406K13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 72184
Homologene: 27849
Olfr202
Name: olfactory receptor 202
Synonyms: GA_x54KRFPKG5P-55498766-55497843, MOR182-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 258997
Homologene: 138323
Atp8b4
Name: ATPase, class I, type 8B, member 4
Synonyms: Im
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241633
Homologene: 133162
Traf3ip2
Name: TRAF3 interacting protein 2
Synonyms: Act1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 103213
HGNC: HGNC:1343
Homologene: 15885
Usp31
Name: ubiquitin specific peptidase 31
Synonyms: 6330567E21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 76179
Homologene: 44504
Olfr459
Name: olfactory receptor 459
Synonyms: GA_x6K02T2P3E9-5780974-5781915, MOR120-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 258569
Homologene: 83448
4931428F04Rik
Name: RIKEN cDNA 4931428F04 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 74356
Homologene: 47588
Ctnna2
Name: catenin (cadherin associated protein), alpha 2
Synonyms: alpha(N)-catenin, alpha N-catenin, Catna, chp, Catna2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 12386
HGNC: HGNC:2510
Homologene: 68394
Tspoap1
Name: TSPO associated protein 1
Synonyms: peripheral, Bzrap1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 207777
Homologene: 37961
Dync2li1
Name: dynein cytoplasmic 2 light intermediate chain 1
Synonyms: mD2LIC, CGI-60, LIC3, 4933404O11Rik, D2lic
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 213575
VEGA: 17
Homologene: 9336
Olfr667
Name: olfactory receptor 667
Synonyms: GA_x6K02T2PBJ9-7546146-7545166, MOR34-2, MOR34-11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259062
Homologene: 121559
Cnr2
Name: cannabinoid receptor 2 (macrophage)
Synonyms: CB2-R, cannabinoid receptor 2 (spleen), CB2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 12802
HGNC: HGNC:2160
Homologene: 1389
Slc25a54
Name: solute carrier family 25, member 54
Synonyms: 4930443G12Rik, SCaMC-1like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 74686
Homologene: 82464
Cela3a
Name: chymotrypsin-like elastase family, member 3A
Synonyms: Gm13011
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242711
Homologene: 129880
Clca4c-ps
Name: chloride channel accessory 4C, pseudogene
Synonyms: Clca4c, Gm18718, Gm6289
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 622139
Flacc1
Name: flagellum associated containing coiled-coil domains 1
Synonyms: 4933405P16Rik, 4933425F06Rik, Als2cr12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 108812
Homologene: 51399
Omt2a
Name: oocyte maturation, alpha
Synonyms: OM2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 18379
Homologene: 136010
Magohb
Name: mago homolog B, exon junction complex core component
Synonyms: 2010012C16Rik, Magoh-rs1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 66441
Homologene: 56794
Cyp2j8
Name: cytochrome P450, family 2, subfamily j, polypeptide 8
Synonyms: OTTMUSG00000007938, Cyp2j8-ps
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 665095
Homologene: 133819
Batf3
Name: basic leucine zipper transcription factor, ATF-like 3
Synonyms: 9130211I03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 381319
Homologene: 41280
Cyp2a12
Name: cytochrome P450, family 2, subfamily a, polypeptide 12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 13085
Homologene: 69128
Ly6g6d
Name: lymphocyte antigen 6 complex, locus G6D
Synonyms: NG32, G6f, NG25, G6d, MEGT1, A930024F17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 114654
Homologene: 76442
Mrgpre
Name: MAS-related GPR, member E
Synonyms: MrgE, C130069N09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 244238
Homologene: 18469
Cyp4v3
Name: cytochrome P450, family 4, subfamily v, polypeptide 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 102294
Homologene: 133054
She
Name: src homology 2 domain-containing transforming protein E
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 214547
Homologene: 18186
Art2b
Name: ADP-ribosyltransferase 2b
Synonyms: Rt6-2, Rt-6, Rt6, ART2.2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11872
Homologene: 113756
Olfr794
Name: olfactory receptor 794
Synonyms: GA_x6K02T2PULF-11248702-11249664, MOR114-11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 258375
Homologene: 45066
Scrn1
Name: secernin 1
Synonyms: 6330535A03Rik, SES1, 2810019K23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 69938
Homologene: 8853
Bola1
Name: bolA-like 1 (E. coli)
Synonyms: 1810037G04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 69168
Homologene: 41103
Tbc1d30
Name: TBC1 domain family, member 30
Synonyms: 4930505D03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 74694
VEGA: 10
Homologene: 18930
Macrod2os2
Name: mono-ADP ribosylhydrolase 2, opposite strand 2
Synonyms: Gm14105
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
5330439B14Rik
Name: RIKEN cDNA 5330439B14 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 321015
Cnrip1
Name: cannabinoid receptor interacting protein 1
Synonyms: 5330437A18Rik, 3110054C06Rik, 1500041B16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 380686
Homologene: 9153
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 10,126,463 bp
  • T to A, chromosome 1 at 46,233,726 bp
  • T to A, chromosome 1 at 58,667,806 bp
  • T to A, chromosome 1 at 90,804,218 bp
  • C to A, chromosome 1 at 135,374,990 bp
  • T to A, chromosome 1 at 184,833,919 bp
  • C to T, chromosome 1 at 191,098,510 bp
  • G to A, chromosome 2 at 26,326,247 bp
  • A to G, chromosome 2 at 31,915,954 bp
  • A to G, chromosome 2 at 112,156,352 bp
  • TGAGAAA to T, chromosome 2 at 119,617,861 bp
  • A to G, chromosome 2 at 121,216,027 bp
  • A to T, chromosome 2 at 126,392,759 bp
  • C to T, chromosome 2 at 128,684,594 bp
  • C to T, chromosome 2 at 130,995,047 bp
  • A to T, chromosome 2 at 141,232,346 bp
  • A to G, chromosome 2 at 156,937,330 bp
  • T to C, chromosome 2 at 163,453,859 bp
  • A to G, chromosome 2 at 180,208,252 bp
  • G to A, chromosome 3 at 19,973,797 bp
  • A to G, chromosome 3 at 60,595,696 bp
  • A to T, chromosome 3 at 62,496,859 bp
  • A to G, chromosome 3 at 87,528,061 bp
  • A to G, chromosome 3 at 89,834,237 bp
  • A to G, chromosome 3 at 96,197,054 bp
  • A to T, chromosome 3 at 109,112,816 bp
  • A to G, chromosome 3 at 121,158,821 bp
  • A to T, chromosome 3 at 141,870,785 bp
  • C to T, chromosome 3 at 144,889,619 bp
  • T to A, chromosome 4 at 6,423,342 bp
  • C to T, chromosome 4 at 46,165,273 bp
  • A to G, chromosome 4 at 49,638,029 bp
  • C to T, chromosome 4 at 86,424,173 bp
  • T to C, chromosome 4 at 96,507,377 bp
  • T to C, chromosome 4 at 101,941,464 bp
  • T to A, chromosome 4 at 133,370,656 bp
  • G to A, chromosome 4 at 135,917,607 bp
  • G to A, chromosome 4 at 137,402,648 bp
  • G to T, chromosome 5 at 3,957,664 bp
  • A to G, chromosome 5 at 14,252,632 bp
  • G to A, chromosome 5 at 36,616,227 bp
  • A to G, chromosome 5 at 123,499,612 bp
  • T to A, chromosome 5 at 123,654,003 bp
  • A to G, chromosome 5 at 134,395,685 bp
  • C to T, chromosome 5 at 147,019,040 bp
  • T to C, chromosome 6 at 31,459,006 bp
  • C to A, chromosome 6 at 41,772,069 bp
  • T to C, chromosome 6 at 54,534,422 bp
  • C to T, chromosome 6 at 77,653,111 bp
  • T to C, chromosome 6 at 131,288,117 bp
  • A to T, chromosome 6 at 142,620,783 bp
  • TGTCCGCCAGGCCCTTGCCCCAGAAGTC to TGTC, chromosome 6 at 148,443,947 bp
  • T to C, chromosome 7 at 4,128,226 bp
  • A to G, chromosome 7 at 27,034,150 bp
  • T to C, chromosome 7 at 29,078,783 bp
  • A to C, chromosome 7 at 82,566,977 bp
  • G to T, chromosome 7 at 99,469,068 bp
  • T to A, chromosome 7 at 101,580,230 bp
  • A to G, chromosome 7 at 104,916,708 bp
  • T to A, chromosome 7 at 113,299,435 bp
  • T to C, chromosome 7 at 121,648,645 bp
  • G to T, chromosome 7 at 123,286,926 bp
  • A to C, chromosome 7 at 128,115,840 bp
  • T to C, chromosome 7 at 133,014,238 bp
  • A to T, chromosome 7 at 143,781,351 bp
  • A to G, chromosome 8 at 45,320,637 bp
  • T to A, chromosome 8 at 84,917,871 bp
  • G to T, chromosome 8 at 105,283,211 bp
  • T to C, chromosome 9 at 15,086,290 bp
  • G to T, chromosome 9 at 15,600,968 bp
  • T to A, chromosome 9 at 44,075,813 bp
  • T to A, chromosome 9 at 78,313,023 bp
  • A to G, chromosome 9 at 119,945,001 bp
  • A to G, chromosome 10 at 39,646,819 bp
  • T to C, chromosome 10 at 52,261,755 bp
  • A to G, chromosome 10 at 70,568,985 bp
  • A to C, chromosome 10 at 85,651,662 bp
  • G to A, chromosome 10 at 91,153,309 bp
  • G to A, chromosome 10 at 121,267,216 bp
  • A to C, chromosome 10 at 129,571,026 bp
  • A to G, chromosome 11 at 17,052,228 bp
  • T to A, chromosome 11 at 51,592,101 bp
  • A to T, chromosome 11 at 59,428,543 bp
  • A to G, chromosome 11 at 68,493,638 bp
  • A to T, chromosome 11 at 72,074,666 bp
  • A to T, chromosome 11 at 78,527,570 bp
  • C to T, chromosome 11 at 87,766,396 bp
  • T to A, chromosome 11 at 98,224,673 bp
  • A to G, chromosome 11 at 101,098,466 bp
  • A to G, chromosome 11 at 115,176,463 bp
  • T to A, chromosome 11 at 121,573,855 bp
  • G to T, chromosome 12 at 4,134,896 bp
  • T to A, chromosome 12 at 24,992,260 bp
  • A to G, chromosome 12 at 44,566,299 bp
  • C to T, chromosome 12 at 81,379,316 bp
  • A to T, chromosome 12 at 88,795,201 bp
  • T to C, chromosome 12 at 101,948,379 bp
  • T to A, chromosome 13 at 76,185,156 bp
  • A to G, chromosome 13 at 99,432,212 bp
  • A to T, chromosome 14 at 12,237,837 bp
  • A to T, chromosome 14 at 13,953,460 bp
  • T to C, chromosome 14 at 24,004,118 bp
  • A to G, chromosome 14 at 32,420,814 bp
  • C to T, chromosome 14 at 101,640,384 bp
  • T to C, chromosome 15 at 94,379,774 bp
  • T to C, chromosome 15 at 97,976,149 bp
  • A to G, chromosome 16 at 21,220,495 bp
  • C to A, chromosome 16 at 44,370,762 bp
  • A to G, chromosome 16 at 59,283,985 bp
  • T to A, chromosome 17 at 15,742,231 bp
  • T to C, chromosome 17 at 33,941,185 bp
  • C to A, chromosome 17 at 35,071,754 bp
  • T to G, chromosome 17 at 84,633,541 bp
  • T to A, chromosome 18 at 10,547,306 bp
  • T to C, chromosome 18 at 61,198,803 bp
  • T to G, chromosome 18 at 68,338,819 bp
  • T to C, chromosome 18 at 84,014,862 bp
  • A to T, chromosome 19 at 7,456,521 bp
  • A to T, chromosome 19 at 39,163,322 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4960 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042557-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.