Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4960Btlr/Mmmh
Stock Number:
042557-MU
Citation ID:
RRID:MMRRC_042557-MU
Other Names:
R4960 (G1), C57BL/6J-MtgxR4960Btlr
Major Collection:

Strain Information

Col2a1
Name: collagen, type II, alpha 1
Synonyms: Del1, Col2a-1, Col2a, Col2, M100856, Rgsc856, Lpk, M100413, Rgsc413
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12824
HGNC: HGNC:2200
Homologene: 55607
Adamts20
Name: ADAM metallopeptidase with thrombospondin type 1 motif 20
Synonyms: ADAMTS-20, bt
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223838
Homologene: 11808
Sema3e
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E
Synonyms: Semah
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20349
Homologene: 8247
Atrn
Name: attractin
Synonyms: Mgca
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11990
HGNC: HGNC:885
Homologene: 22542
Chat
Name: choline O-acetyltransferase
Synonyms: B230380D24Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12647
VEGA: 14
HGNC: HGNC:1912
Homologene: 40693
Nrcam
Name: neuronal cell adhesion molecule
Synonyms: Bravo, C030017F07Rik, C130076O07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319504
VEGA: 12
HGNC: HGNC:7994
Homologene: 21041
Ndrg3
Name: N-myc downstream regulated gene 3
Synonyms: Ndr3, 4833415O14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 29812
Homologene: 40903
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 10,126,463 bp
  • T to A, chromosome 1 at 46,233,726 bp
  • T to A, chromosome 1 at 58,667,806 bp
  • T to A, chromosome 1 at 90,804,218 bp
  • C to A, chromosome 1 at 135,374,990 bp
  • T to A, chromosome 1 at 184,833,919 bp
  • C to T, chromosome 1 at 191,098,510 bp
  • G to A, chromosome 2 at 26,326,247 bp
  • A to G, chromosome 2 at 31,915,954 bp
  • A to G, chromosome 2 at 112,156,352 bp
  • TGAGAAA to T, chromosome 2 at 119,617,861 bp
  • A to G, chromosome 2 at 121,216,027 bp
  • A to T, chromosome 2 at 126,392,759 bp
  • C to T, chromosome 2 at 128,684,594 bp
  • C to T, chromosome 2 at 130,995,047 bp
  • A to T, chromosome 2 at 141,232,346 bp
  • A to G, chromosome 2 at 156,937,330 bp
  • T to C, chromosome 2 at 163,453,859 bp
  • A to G, chromosome 2 at 180,208,252 bp
  • G to A, chromosome 3 at 19,973,797 bp
  • A to G, chromosome 3 at 60,595,696 bp
  • A to T, chromosome 3 at 62,496,859 bp
  • A to G, chromosome 3 at 87,528,061 bp
  • A to G, chromosome 3 at 89,834,237 bp
  • A to G, chromosome 3 at 96,197,054 bp
  • A to T, chromosome 3 at 109,112,816 bp
  • A to G, chromosome 3 at 121,158,821 bp
  • A to T, chromosome 3 at 141,870,785 bp
  • C to T, chromosome 3 at 144,889,619 bp
  • T to A, chromosome 4 at 6,423,342 bp
  • C to T, chromosome 4 at 46,165,273 bp
  • A to G, chromosome 4 at 49,638,029 bp
  • C to T, chromosome 4 at 86,424,173 bp
  • T to C, chromosome 4 at 96,507,377 bp
  • T to C, chromosome 4 at 101,941,464 bp
  • T to A, chromosome 4 at 133,370,656 bp
  • G to A, chromosome 4 at 135,917,607 bp
  • G to A, chromosome 4 at 137,402,648 bp
  • G to T, chromosome 5 at 3,957,664 bp
  • A to G, chromosome 5 at 14,252,632 bp
  • G to A, chromosome 5 at 36,616,227 bp
  • A to G, chromosome 5 at 123,499,612 bp
  • T to A, chromosome 5 at 123,654,003 bp
  • A to G, chromosome 5 at 134,395,685 bp
  • C to T, chromosome 5 at 147,019,040 bp
  • T to C, chromosome 6 at 31,459,006 bp
  • C to A, chromosome 6 at 41,772,069 bp
  • T to C, chromosome 6 at 54,534,422 bp
  • C to T, chromosome 6 at 77,653,111 bp
  • T to C, chromosome 6 at 131,288,117 bp
  • A to T, chromosome 6 at 142,620,783 bp
  • TGTCCGCCAGGCCCTTGCCCCAGAAGTC to TGTC, chromosome 6 at 148,443,947 bp
  • T to C, chromosome 7 at 4,128,226 bp
  • A to G, chromosome 7 at 27,034,150 bp
  • T to C, chromosome 7 at 29,078,783 bp
  • A to C, chromosome 7 at 82,566,977 bp
  • G to T, chromosome 7 at 99,469,068 bp
  • T to A, chromosome 7 at 101,580,230 bp
  • A to G, chromosome 7 at 104,916,708 bp
  • T to A, chromosome 7 at 113,299,435 bp
  • T to C, chromosome 7 at 121,648,645 bp
  • G to T, chromosome 7 at 123,286,926 bp
  • A to C, chromosome 7 at 128,115,840 bp
  • T to C, chromosome 7 at 133,014,238 bp
  • A to T, chromosome 7 at 143,781,351 bp
  • A to G, chromosome 8 at 45,320,637 bp
  • T to A, chromosome 8 at 84,917,871 bp
  • G to T, chromosome 8 at 105,283,211 bp
  • T to C, chromosome 9 at 15,086,290 bp
  • G to T, chromosome 9 at 15,600,968 bp
  • T to A, chromosome 9 at 44,075,813 bp
  • T to A, chromosome 9 at 78,313,023 bp
  • A to G, chromosome 9 at 119,945,001 bp
  • A to G, chromosome 10 at 39,646,819 bp
  • T to C, chromosome 10 at 52,261,755 bp
  • A to G, chromosome 10 at 70,568,985 bp
  • A to C, chromosome 10 at 85,651,662 bp
  • G to A, chromosome 10 at 91,153,309 bp
  • G to A, chromosome 10 at 121,267,216 bp
  • A to C, chromosome 10 at 129,571,026 bp
  • A to G, chromosome 11 at 17,052,228 bp
  • T to A, chromosome 11 at 51,592,101 bp
  • A to T, chromosome 11 at 59,428,543 bp
  • A to G, chromosome 11 at 68,493,638 bp
  • A to T, chromosome 11 at 72,074,666 bp
  • A to T, chromosome 11 at 78,527,570 bp
  • C to T, chromosome 11 at 87,766,396 bp
  • T to A, chromosome 11 at 98,224,673 bp
  • A to G, chromosome 11 at 101,098,466 bp
  • A to G, chromosome 11 at 115,176,463 bp
  • T to A, chromosome 11 at 121,573,855 bp
  • G to T, chromosome 12 at 4,134,896 bp
  • T to A, chromosome 12 at 24,992,260 bp
  • A to G, chromosome 12 at 44,566,299 bp
  • C to T, chromosome 12 at 81,379,316 bp
  • A to T, chromosome 12 at 88,795,201 bp
  • T to C, chromosome 12 at 101,948,379 bp
  • T to A, chromosome 13 at 76,185,156 bp
  • A to G, chromosome 13 at 99,432,212 bp
  • A to T, chromosome 14 at 12,237,837 bp
  • A to T, chromosome 14 at 13,953,460 bp
  • T to C, chromosome 14 at 24,004,118 bp
  • A to G, chromosome 14 at 32,420,814 bp
  • C to T, chromosome 14 at 101,640,384 bp
  • T to C, chromosome 15 at 94,379,774 bp
  • T to C, chromosome 15 at 97,976,149 bp
  • A to G, chromosome 16 at 21,220,495 bp
  • C to A, chromosome 16 at 44,370,762 bp
  • A to G, chromosome 16 at 59,283,985 bp
  • T to A, chromosome 17 at 15,742,231 bp
  • T to C, chromosome 17 at 33,941,185 bp
  • C to A, chromosome 17 at 35,071,754 bp
  • T to G, chromosome 17 at 84,633,541 bp
  • T to A, chromosome 18 at 10,547,306 bp
  • T to C, chromosome 18 at 61,198,803 bp
  • T to G, chromosome 18 at 68,338,819 bp
  • T to C, chromosome 18 at 84,014,862 bp
  • A to T, chromosome 19 at 7,456,521 bp
  • A to T, chromosome 19 at 39,163,322 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4960 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042557-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.