Strain Name:
C57BL/6J-MtgxR5180Btlr/Mmmh
Stock Number:
042760-MU
Citation ID:
RRID:MMRRC_042760-MU
Other Names:
R5180 (G1), C57BL/6J-MtgxR5180Btlr
Major Collection:

Gene Information

Gene Symbol: Akap10 [MGI:1890218] (Mus musculus (mouse))
Name: A kinase (PRKA) anchor protein 10
Synonyms: D-AKAP2, B130049N18Rik, 1500031L16Rik
Chromosome: 11
Alteration at locus: Chemically Induced
Gene Symbol: Dnajc11 [MGI:2443386] (Mus musculus (mouse))
Name: DnaJ heat shock protein family (Hsp40) member C11
Synonyms: E030019A03Rik
Chromosome: 4
Alteration at locus: Chemically Induced
Gene Symbol: Sptan1 [MGI:98386] (Mus musculus (mouse))
Name: spectrin alpha, non-erythrocytic 1
Synonyms: 2610027H02Rik, alphaII-spectrin, Spna-2, alpha-fodrin, Spna2
Chromosome: 2
Alteration at locus: Chemically Induced
Gene Symbol: Dab2ip [MGI:1916851] (Mus musculus (mouse))
Name: disabled 2 interacting protein
Synonyms: AIP1, 2310011D08Rik
Chromosome: 2
Alteration at locus: Chemically Induced
Gene Symbol: Lin9 [MGI:1919818] (Mus musculus (mouse))
Name: lin-9 homolog (C. elegans)
Synonyms: 2700022J23Rik
Chromosome: 1
Alteration at locus: Chemically Induced
Gene Symbol: Daam1 [MGI:1914596] (Mus musculus (mouse))
Name: dishevelled associated activator of morphogenesis 1
Synonyms: 2310028E21Rik, 1700066F09Rik
Chromosome: 12
Alteration at locus: Chemically Induced
Gene Symbol: Supt20 [MGI:1929651] (Mus musculus (mouse))
Name: suppressor of Ty 20
Synonyms: p38IP, Fam48a, p38 interacting protein, D3Ertd300e
Chromosome: 3
Alteration at locus: Chemically Induced
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 53,423,287 bp
  • C to A, chromosome 1 at 63,086,329 bp
  • T to C, chromosome 1 at 131,844,377 bp
  • T to A, chromosome 1 at 180,669,198 bp
  • A to T, chromosome 2 at 29,993,724 bp
  • C to T, chromosome 2 at 35,720,491 bp
  • A to G, chromosome 2 at 76,749,396 bp
  • A to T, chromosome 2 at 140,395,716 bp
  • G to A, chromosome 2 at 151,600,387 bp
  • C to A, chromosome 3 at 54,709,085 bp
  • A to G, chromosome 3 at 96,046,371 bp
  • C to A, chromosome 3 at 96,680,473 bp
  • G to T, chromosome 3 at 108,079,042 bp
  • T to A, chromosome 4 at 47,383,948 bp
  • C to T, chromosome 4 at 126,367,751 bp
  • T to A, chromosome 4 at 135,559,104 bp
  • C to A, chromosome 4 at 145,227,497 bp
  • C to T, chromosome 4 at 151,969,939 bp
  • C to A, chromosome 5 at 16,267,409 bp
  • G to A, chromosome 5 at 43,615,814 bp
  • G to T, chromosome 5 at 109,330,525 bp
  • A to T, chromosome 5 at 138,265,704 bp
  • C to T, chromosome 6 at 124,704,993 bp
  • G to T, chromosome 6 at 147,027,321 bp
  • T to A, chromosome 7 at 12,775,289 bp
  • C to A, chromosome 7 at 16,205,480 bp
  • A to T, chromosome 7 at 25,246,265 bp
  • A to G, chromosome 8 at 70,720,461 bp
  • C to T, chromosome 9 at 15,332,120 bp
  • T to A, chromosome 9 at 27,051,645 bp
  • A to G, chromosome 9 at 42,337,208 bp
  • A to T, chromosome 9 at 73,034,590 bp
  • C to A, chromosome 9 at 109,111,693 bp
  • G to A, chromosome 9 at 122,999,210 bp
  • A to G, chromosome 10 at 23,993,148 bp
  • T to C, chromosome 10 at 75,976,366 bp
  • T to C, chromosome 10 at 81,544,873 bp
  • T to G, chromosome 10 at 120,145,782 bp
  • CCAGCAGCAGCAGCAGCAGC to CCAGCAGCAGCAGCAGC, chromosome 10 at 128,487,362 bp
  • T to A, chromosome 11 at 6,658,619 bp
  • A to G, chromosome 11 at 9,466,510 bp
  • A to G, chromosome 11 at 26,593,795 bp
  • A to G, chromosome 11 at 60,405,869 bp
  • G to T, chromosome 11 at 60,913,656 bp
  • C to T, chromosome 11 at 61,916,189 bp
  • T to A, chromosome 12 at 8,955,374 bp
  • A to G, chromosome 12 at 71,947,125 bp
  • G to C, chromosome 12 at 81,377,830 bp
  • G to A, chromosome 13 at 81,283,416 bp
  • C to G, chromosome 13 at 100,781,775 bp
  • A to G, chromosome 13 at 109,740,473 bp
  • T to C, chromosome 14 at 101,507,572 bp
  • T to A, chromosome 15 at 26,543,421 bp
  • C to G, chromosome 15 at 58,054,074 bp
  • C to T, chromosome 15 at 66,555,214 bp
  • T to A, chromosome 16 at 35,953,736 bp
  • C to A, chromosome 16 at 58,717,885 bp
  • T to C, chromosome 17 at 25,265,294 bp
  • T to C, chromosome 17 at 25,937,375 bp
  • A to T, chromosome 17 at 29,857,736 bp
  • A to T, chromosome 17 at 32,690,740 bp
  • T to C, chromosome 17 at 33,242,618 bp
  • T to C, chromosome 18 at 36,682,635 bp
  • A to T, chromosome 19 at 13,027,412 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5180 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
042760-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials and based on the transfer success rate of the MMRRC facility) to transfer to at least two recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.