Strain Name:
C57BL/6J-MtgxR5180Btlr/Mmmh
Stock Number:
042760-MU
Citation ID:
RRID:MMRRC_042760-MU
Other Names:
R5180 (G1), C57BL/6J-MtgxR5180Btlr
Major Collection:

Strain Information

Akap10
Name: A kinase anchor protein 10
Synonyms: D-AKAP2, 1500031L16Rik, B130049N18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56697
HGNC: HGNC:368
Homologene: 32452
Dnajc11
Name: DnaJ heat shock protein family (Hsp40) member C11
Synonyms: E030019A03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230935
Homologene: 14558
Sptan1
Name: spectrin alpha, non-erythrocytic 1
Synonyms: alphaII-spectrin, 2610027H02Rik, Spna-2, Spna2, alpha-fodrin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20740
Homologene: 2353
Dab2ip
Name: disabled 2 interacting protein
Synonyms: AIP1, 2310011D08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69601
Homologene: 13058
Lin9
Name: lin-9 DREAM MuvB core complex component
Synonyms: 2700022J23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72568
Homologene: 35252
Daam1
Name: dishevelled associated activator of morphogenesis 1
Synonyms: 2310028E21Rik, 1700066F09Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 208846
VEGA: 12
Homologene: 36635
Supt20
Name: SPT20 SAGA complex component
Synonyms: p38IP, D3Ertd300e, Fam48a, p38 interacting protein
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56790
Homologene: 134155
Ago3
Name: argonaute RISC catalytic subunit 3
Synonyms: eIF2C3, argonaute 3, C130014L07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 214150
Homologene: 49799
Kif15
Name: kinesin family member 15
Synonyms: 3930402I10Rik, 3110023M17Rik, HKLP2, N-10 kinesin, Knsl7
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 209737
VEGA: 9
Homologene: 23210
Ncapd3
Name: non-SMC condensin II complex, subunit D3
Synonyms: 2810487N22Rik, B130055D15Rik, 4632407J06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 78658
VEGA: 9
Homologene: 41021
Dnah7a
Name: dynein, axonemal, heavy chain 7A
Synonyms: Dnahc7, LOC381341, Dnahc7a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 627872
Homologene: 41287
Ramp3
Name: receptor (calcitonin) activity modifying protein 3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56089
HGNC: HGNC:9845
Homologene: 4276
Ino80d
Name: INO80 complex subunit D
Synonyms: A430093A21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227195
Homologene: 9819
Erf
Name: Ets2 repressor factor
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13875
HGNC: HGNC:3444
Homologene: 68516
Macrod2
Name: mono-ADP ribosylhydrolase 2
Synonyms: 2610107G07Rik, 2900006F19Rik, 1110033L15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72899
Homologene: 85987
Grhl3
Name: grainyhead like transcription factor 3
Synonyms: Get1, ct, Som
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230824
Homologene: 18864
Ampd2
Name: adenosine monophosphate deaminase 2
Synonyms: 1200014F01Rik, Ampd-2, m4521Dajl
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109674
HGNC: HGNC:469
Homologene: 2979
Ccnb1
Name: cyclin B1
Synonyms: Ccnb1-rs13, Cycb-4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 268697
HGNC: HGNC:1579
Homologene: 68982
Tgfbr1
Name: transforming growth factor, beta receptor I
Synonyms: TbetaR-I, ALK5, TbetaRI, Alk-5
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21812
Homologene: 3177
Cep295
Name: centrosomal protein 295
Synonyms: LOC382128, 5830418K08Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319675
Homologene: 27936
Pde4d
Name: phosphodiesterase 4D, cAMP specific
Synonyms: dunce, Dpde3, 9630011N22Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238871
HGNC: HGNC:8783
Smarcc2
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2
Synonyms: 5930405J04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 68094
VEGA: 10
Homologene: 2312
Natd1
Name: N-acetyltransferase domain containing 1
Synonyms: Gtlf3b, F3-2, Gm16515
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 24083
Homologene: 11907
Abca13
Name: ATP-binding cassette, sub-family A member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268379
Homologene: 27991
Ttn
Name: titin
Synonyms: shru, L56, mdm, connectin, D330041I19Rik, 2310057K23Rik, 2310074I15Rik, 2310036G12Rik, D830007G01Rik, 1100001C23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Ankrd35
Name: ankyrin repeat domain 35
Synonyms: 4732436F15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213121
Homologene: 16977
Tecta
Name: tectorin alpha
Synonyms: Tctna, [a]-tectorin
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21683
Homologene: 3955
Tnfrsf1b
Name: tumor necrosis factor receptor superfamily, member 1b
Synonyms: TNFBR, p75 TNFR, TNFalpha-R2, TNF-R2, TNFRII, p75, TNF-alphaR2, Tnfr2, TNF-R75, TNF-R-II, TNFR80, CD120b
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21938
Homologene: 829
Zscan18
Name: zinc finger and SCAN domain containing 18
Synonyms: EG232875
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232875
Homologene: 122136
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: Mgr1, Mass1, Gpr98, VLGR1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Gm5134
Name: predicted gene 5134
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 333669
Homologene: 129891
Irak3
Name: interleukin-1 receptor-associated kinase 3
Synonyms: IRAK-M, 4833428C18Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73914
Homologene: 36215
Gna11
Name: guanine nucleotide binding protein, alpha 11
Synonyms: Dsk7
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14672
HGNC: HGNC:4379
Homologene: 20474
Gm4787
Name: predicted gene 4787
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 214321
Homologene: 86950
Matn3
Name: matrilin 3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 17182
HGNC: HGNC:6909
Homologene: 1785
Or5b101
Name: olfactory receptor family 5 subfamily B member 101
Synonyms: GA_x6K02T2RE5P-3357666-3356743, MOR202-6, Olfr1453
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258695
HGNC: HGNC:8324
Homologene: 120159
Parp9
Name: poly (ADP-ribose) polymerase family, member 9
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 80285
Homologene: 12720
Ppfibp1
Name: PTPRF interacting protein, binding protein 1 (liprin beta 1)
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67533
HGNC: HGNC:9249
Homologene: 2685
Plxnb1
Name: plexin B1
Synonyms: 2900002G15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235611
HGNC: HGNC:9103
Homologene: 130508
Zfp955a
Name: zinc finger protein 955A
Synonyms: AI842447
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 77652
VEGA: 17
Homologene: 104925
Cacna2d1
Name: calcium channel, voltage-dependent, alpha2/delta subunit 1
Synonyms: Cchl2a, Ca(v)alpha2delta1, Cacna2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12293
HGNC: HGNC:1399
Homologene: 579
Mdga1
Name: MAM domain containing glycosylphosphatidylinositol anchor 1
Synonyms: Mamdc3, 1200011I03Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74762
Homologene: 17780
Tbc1d4
Name: TBC1 domain family, member 4
Synonyms: 5930406J04Rik, AS160
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 210789
Homologene: 45451
Slc41a1
Name: solute carrier family 41, member 1
Synonyms: B230315F01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98396
Homologene: 14871
Dhx34
Name: DExH-box helicase 34
Synonyms: 1810012L18Rik, Ddx34, 1200013B07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71723
Homologene: 69171
Vmn2r16
Name: vomeronasal 2, receptor 16
Synonyms: EG384220
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384220
Homologene: 104825
Taar7a
Name: trace amine-associated receptor 7A
Synonyms: LOC215856, Taar7a
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215856
Homologene: 110833
Fbxl7
Name: F-box and leucine-rich repeat protein 7
Synonyms: Fbl6, D230018M15Rik, FBL7
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 448987
VEGA: 15
Homologene: 69121
Ube2i
Name: ubiquitin-conjugating enzyme E2I
Synonyms: 5830467E05Rik, Ubce9, UBC9, Mmubc9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 22196
Homologene: 5574
Gal3st4
Name: galactose-3-O-sulfotransferase 4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330217
Homologene: 11633
Gm6899
Name: predicted gene 6899
Type: Gene
Species: Mouse
Chromosome: 11
Snph
Name: syntaphilin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241727
Homologene: 8817
Zhx1
Name: zinc fingers and homeoboxes 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 22770
Homologene: 5225
Pigq
Name: phosphatidylinositol glycan anchor biosynthesis, class Q
Synonyms: Gpi1h, Gpi1, Gpi1p, Gpih
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14755
Homologene: 31228
Vps45
Name: vacuolar protein sorting 45
Synonyms: mVps45
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22365
Homologene: 5250
Slc35a4
Name: solute carrier family 35, member A4
Synonyms: 2610030J16Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67843
Homologene: 12195
Atpaf2
Name: ATP synthase mitochondrial F1 complex assembly factor 2
Synonyms: ATP12p, ATP12
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 246782
Homologene: 34602
Tmem71
Name: transmembrane protein 71
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 213068
VEGA: 15
Homologene: 51638
C1qtnf7
Name: C1q and tumor necrosis factor related protein 7
Synonyms: 8430425G24Rik, 5530401N20Rik, CTRP7
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 109323
Homologene: 12900
Gpr15
Name: G protein-coupled receptor 15
Synonyms: 4933439K08Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 71223
VEGA: 16
HGNC: HGNC:4469
Homologene: 3869
Cyp4f15
Name: cytochrome P450, family 4, subfamily f, polypeptide 15
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106648
Homologene: 80199
Emg1
Name: EMG1 N1-specific pseudouridine methyltransferase
Synonyms: Grcc2f
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14791
Homologene: 4617
Pigb
Name: phosphatidylinositol glycan anchor biosynthesis, class B
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 55981
HGNC: HGNC:8959
Homologene: 3570
Gm3336
Name: predicted gene 3336
Synonyms: 2410018E23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100502950
Homologene: 136417
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 53,423,287 bp
  • C to A, chromosome 1 at 63,086,329 bp
  • T to C, chromosome 1 at 131,844,377 bp
  • T to A, chromosome 1 at 180,669,198 bp
  • A to T, chromosome 2 at 29,993,724 bp
  • C to T, chromosome 2 at 35,720,491 bp
  • A to G, chromosome 2 at 76,749,396 bp
  • A to T, chromosome 2 at 140,395,716 bp
  • G to A, chromosome 2 at 151,600,387 bp
  • C to A, chromosome 3 at 54,709,085 bp
  • A to G, chromosome 3 at 96,046,371 bp
  • C to A, chromosome 3 at 96,680,473 bp
  • G to T, chromosome 3 at 108,079,042 bp
  • T to A, chromosome 4 at 47,383,948 bp
  • C to T, chromosome 4 at 126,367,751 bp
  • T to A, chromosome 4 at 135,559,104 bp
  • C to A, chromosome 4 at 145,227,497 bp
  • C to T, chromosome 4 at 151,969,939 bp
  • C to A, chromosome 5 at 16,267,409 bp
  • G to A, chromosome 5 at 43,615,814 bp
  • G to T, chromosome 5 at 109,330,525 bp
  • A to T, chromosome 5 at 138,265,704 bp
  • C to T, chromosome 6 at 124,704,993 bp
  • G to T, chromosome 6 at 147,027,321 bp
  • T to A, chromosome 7 at 12,775,289 bp
  • C to A, chromosome 7 at 16,205,480 bp
  • A to T, chromosome 7 at 25,246,265 bp
  • A to G, chromosome 8 at 70,720,461 bp
  • C to T, chromosome 9 at 15,332,120 bp
  • T to A, chromosome 9 at 27,051,645 bp
  • A to G, chromosome 9 at 42,337,208 bp
  • A to T, chromosome 9 at 73,034,590 bp
  • C to A, chromosome 9 at 109,111,693 bp
  • G to A, chromosome 9 at 122,999,210 bp
  • A to G, chromosome 10 at 23,993,148 bp
  • T to C, chromosome 10 at 75,976,366 bp
  • T to C, chromosome 10 at 81,544,873 bp
  • T to G, chromosome 10 at 120,145,782 bp
  • CCAGCAGCAGCAGCAGCAGC to CCAGCAGCAGCAGCAGC, chromosome 10 at 128,487,362 bp
  • T to A, chromosome 11 at 6,658,619 bp
  • A to G, chromosome 11 at 9,466,510 bp
  • A to G, chromosome 11 at 26,593,795 bp
  • A to G, chromosome 11 at 60,405,869 bp
  • G to T, chromosome 11 at 60,913,656 bp
  • C to T, chromosome 11 at 61,916,189 bp
  • T to A, chromosome 12 at 8,955,374 bp
  • A to G, chromosome 12 at 71,947,125 bp
  • G to C, chromosome 12 at 81,377,830 bp
  • G to A, chromosome 13 at 81,283,416 bp
  • C to G, chromosome 13 at 100,781,775 bp
  • A to G, chromosome 13 at 109,740,473 bp
  • T to C, chromosome 14 at 101,507,572 bp
  • T to A, chromosome 15 at 26,543,421 bp
  • C to G, chromosome 15 at 58,054,074 bp
  • C to T, chromosome 15 at 66,555,214 bp
  • T to A, chromosome 16 at 35,953,736 bp
  • C to A, chromosome 16 at 58,717,885 bp
  • T to C, chromosome 17 at 25,265,294 bp
  • T to C, chromosome 17 at 25,937,375 bp
  • A to T, chromosome 17 at 29,857,736 bp
  • A to T, chromosome 17 at 32,690,740 bp
  • T to C, chromosome 17 at 33,242,618 bp
  • T to C, chromosome 18 at 36,682,635 bp
  • A to T, chromosome 19 at 13,027,412 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5180 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042760-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.