Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5360Btlr/Mmmh
Stock Number:
042939-MU
Citation ID:
RRID:MMRRC_042939-MU
Other Names:
R5360 (G1), C57BL/6J-MtgxR5360Btlr
Major Collection:

Strain Information

Col2a1
Name: collagen, type II, alpha 1
Synonyms: Del1, Col2a-1, Col2a, Col2, M100856, Rgsc856, Lpk, M100413, Rgsc413
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12824
HGNC: HGNC:2200
Homologene: 55607
Trp53
Name: transformation related protein 53
Synonyms: p53, p44
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22059
Homologene: 460
Ppp2r2a
Name: protein phosphatase 2, regulatory subunit B, alpha
Synonyms: 2410004D02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71978
VEGA: 14
HGNC: HGNC:9304
Homologene: 2035
Otx1
Name: orthodenticle homeobox 1
Synonyms: A730044F23Rik, jv
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18423
HGNC: HGNC:8521
Homologene: 7875
Ilrun
Name: inflammation and lipid regulator with UBA-like and NBR1-like domains
Synonyms: D17Wsu92e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224647
Homologene: 32575
Rps8
Name: ribosomal protein S8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20116
Homologene: 133143
Mdm4
Name: MDM4 regulator of p53
Synonyms: Mdmx, 4933417N07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17248
HGNC: HGNC:6974
Homologene: 1794
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 58,146,508 bp
  • T to G, chromosome 1 at 58,228,925 bp
  • TAAAAAAAAA to TAAAAAAA, chromosome 1 at 88,215,928 bp
  • A to G, chromosome 1 at 132,518,857 bp
  • A to T, chromosome 1 at 132,991,658 bp
  • G to A, chromosome 1 at 162,963,798 bp
  • A to G, chromosome 1 at 172,278,869 bp
  • A to G, chromosome 2 at 37,389,855 bp
  • A to C, chromosome 2 at 76,919,978 bp
  • G to T, chromosome 2 at 148,783,378 bp
  • C to A, chromosome 2 at 164,833,101 bp
  • T to C, chromosome 2 at 169,021,313 bp
  • T to A, chromosome 3 at 86,542,618 bp
  • A to G, chromosome 3 at 100,109,410 bp
  • G to A, chromosome 3 at 108,075,642 bp
  • C to T, chromosome 4 at 44,363,730 bp
  • A to T, chromosome 4 at 56,800,104 bp
  • T to C, chromosome 4 at 83,261,847 bp
  • A to G, chromosome 4 at 111,822,829 bp
  • G to C, chromosome 4 at 117,155,155 bp
  • T to A, chromosome 4 at 138,734,345 bp
  • T to A, chromosome 4 at 155,761,945 bp
  • G to A, chromosome 5 at 77,349,146 bp
  • A to G, chromosome 5 at 121,315,401 bp
  • T to C, chromosome 6 at 48,656,302 bp
  • G to A, chromosome 6 at 125,312,794 bp
  • C to T, chromosome 7 at 57,490,785 bp
  • T to C, chromosome 8 at 85,001,404 bp
  • A to G, chromosome 9 at 15,326,733 bp
  • A to G, chromosome 9 at 27,311,672 bp
  • G to A, chromosome 9 at 32,259,671 bp
  • T to G, chromosome 9 at 39,394,402 bp
  • T to C, chromosome 10 at 18,544,307 bp
  • C to T, chromosome 10 at 79,912,458 bp
  • C to T, chromosome 10 at 80,126,090 bp
  • T to C, chromosome 11 at 8,879,204 bp
  • C to A, chromosome 11 at 21,997,037 bp
  • T to A, chromosome 11 at 53,437,207 bp
  • A to G, chromosome 11 at 54,620,005 bp
  • T to C, chromosome 11 at 69,588,740 bp
  • G to A, chromosome 11 at 78,314,762 bp
  • G to T, chromosome 11 at 94,496,578 bp
  • A to T, chromosome 11 at 98,018,271 bp
  • A to C, chromosome 12 at 88,018,495 bp
  • C to T, chromosome 13 at 27,659,160 bp
  • T to C, chromosome 13 at 55,828,478 bp
  • A to T, chromosome 13 at 100,126,546 bp
  • A to G, chromosome 14 at 65,638,626 bp
  • G to A, chromosome 14 at 67,016,571 bp
  • TCAGCAGCAGCAGCAGCAGCAGCAGCA to TCAGCAGCAGCAGCAGCAGCAGCA, chromosome 14 at 76,417,267 bp
  • T to A, chromosome 15 at 47,669,203 bp
  • A to G, chromosome 15 at 82,778,064 bp
  • A to G, chromosome 15 at 83,608,695 bp
  • A to G, chromosome 15 at 97,988,873 bp
  • T to A, chromosome 16 at 20,154,162 bp
  • C to T, chromosome 16 at 32,251,934 bp
  • C to T, chromosome 16 at 32,777,672 bp
  • A to G, chromosome 16 at 72,935,777 bp
  • T to A, chromosome 17 at 14,059,092 bp
  • A to G, chromosome 17 at 24,880,093 bp
  • A to T, chromosome 17 at 27,794,046 bp
  • A to T, chromosome 17 at 28,810,562 bp
  • G to A, chromosome 17 at 34,645,329 bp
  • T to C, chromosome 17 at 50,984,632 bp
  • A to G, chromosome 18 at 20,340,954 bp
  • T to C, chromosome 19 at 8,619,422 bp
  • A to T, chromosome 19 at 12,623,629 bp
  • G to A, chromosome 19 at 16,133,426 bp
  • A to T, chromosome 19 at 40,230,549 bp
  • T to A, chromosome 19 at 55,291,160 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5360 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The submitter or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042939-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.