Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5394Btlr/Mmmh
Stock Number:
042966-MU
Citation ID:
RRID:MMRRC_042966-MU
Other Names:
R5394 (G1), C57BL/6J-MtgxR5394Btlr
Major Collection:

Strain Information

Wnt5b
Name: wingless-type MMTV integration site family, member 5B
Synonyms: Wnt-5b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22419
Homologene: 22530
Pik3cb
Name: phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta
Synonyms: 1110001J02Rik, p110beta
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74769
HGNC: HGNC:8976
Homologene: 21250
Utp20
Name: UTP20 small subunit processome component
Synonyms: mDRIM, DRIM, 3830408P06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Atm
Name: ataxia telangiectasia mutated
Synonyms: C030026E19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11920
HGNC: HGNC:795
Homologene: 30952
Cnst
Name: consortin, connexin sorting protein
Synonyms: 9630058J23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226744
Homologene: 17139
Ddx10
Name: DEAD box helicase 10
Synonyms: 4632415A01Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 10
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 77591
VEGA: 9
HGNC: HGNC:2735
Homologene: 20922
Eif4g3
Name: eukaryotic translation initiation factor 4 gamma, 3
Synonyms: eIF4GII, 1500002J22Rik, 4930523M17Rik, G1-419-52, repro8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230861
HGNC: HGNC:3298
Homologene: 2789
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 9,999,405 bp
  • T to C, chromosome 1 at 59,174,946 bp
  • T to C, chromosome 1 at 74,595,252 bp
  • T to C, chromosome 1 at 174,369,270 bp
  • T to A, chromosome 1 at 179,601,736 bp
  • C to T, chromosome 1 at 185,372,985 bp
  • G to C, chromosome 2 at 5,303,366 bp
  • A to T, chromosome 2 at 24,442,910 bp
  • G to A, chromosome 2 at 26,986,558 bp
  • G to C, chromosome 2 at 77,929,339 bp
  • A to T, chromosome 2 at 89,339,462 bp
  • T to C, chromosome 2 at 145,613,574 bp
  • G to A, chromosome 2 at 177,832,984 bp
  • G to T, chromosome 3 at 36,917,668 bp
  • T to C, chromosome 3 at 92,868,698 bp
  • G to A, chromosome 3 at 107,292,442 bp
  • A to G, chromosome 3 at 114,194,184 bp
  • G to A, chromosome 3 at 122,818,009 bp
  • C to T, chromosome 3 at 131,194,659 bp
  • A to G, chromosome 3 at 146,650,608 bp
  • T to C, chromosome 3 at 146,650,958 bp
  • T to A, chromosome 4 at 21,679,455 bp
  • A to G, chromosome 4 at 24,517,115 bp
  • T to A, chromosome 4 at 59,879,329 bp
  • A to T, chromosome 4 at 106,408,013 bp
  • A to T, chromosome 4 at 136,241,259 bp
  • A to G, chromosome 4 at 138,103,398 bp
  • T to A, chromosome 5 at 24,332,041 bp
  • A to G, chromosome 5 at 24,383,890 bp
  • C to A, chromosome 5 at 34,905,597 bp
  • T to G, chromosome 5 at 36,814,518 bp
  • T to A, chromosome 5 at 89,197,764 bp
  • T to C, chromosome 5 at 137,435,634 bp
  • T to C, chromosome 5 at 137,464,074 bp
  • T to A, chromosome 5 at 137,758,774 bp
  • T to A, chromosome 5 at 138,163,500 bp
  • A to G, chromosome 6 at 48,495,260 bp
  • A to T, chromosome 6 at 85,512,460 bp
  • C to A, chromosome 6 at 85,623,088 bp
  • T to A, chromosome 6 at 86,427,684 bp
  • A to G, chromosome 6 at 91,919,193 bp
  • A to G, chromosome 6 at 100,705,114 bp
  • C to A, chromosome 6 at 119,175,367 bp
  • C to A, chromosome 6 at 119,440,322 bp
  • T to C, chromosome 6 at 139,720,082 bp
  • A to T, chromosome 7 at 5,146,996 bp
  • G to A, chromosome 7 at 13,260,983 bp
  • A to G, chromosome 7 at 19,136,616 bp
  • G to A, chromosome 7 at 44,352,651 bp
  • A to G, chromosome 7 at 84,946,654 bp
  • A to T, chromosome 7 at 102,856,479 bp
  • A to T, chromosome 7 at 105,636,976 bp
  • A to C, chromosome 7 at 119,914,248 bp
  • G to T, chromosome 8 at 22,327,790 bp
  • C to A, chromosome 8 at 34,965,219 bp
  • A to G, chromosome 8 at 54,639,489 bp
  • A to T, chromosome 8 at 95,366,404 bp
  • CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT, chromosome 8 at 104,309,470 bp
  • A to G, chromosome 8 at 110,539,842 bp
  • G to T, chromosome 8 at 124,532,529 bp
  • C to T, chromosome 9 at 7,120,899 bp
  • A to T, chromosome 9 at 39,623,134 bp
  • A to T, chromosome 9 at 53,233,857 bp
  • C to T, chromosome 9 at 53,507,777 bp
  • A to G, chromosome 9 at 56,890,200 bp
  • A to T, chromosome 9 at 58,990,234 bp
  • A to T, chromosome 9 at 65,505,214 bp
  • G to A, chromosome 9 at 66,268,718 bp
  • T to C, chromosome 9 at 99,088,663 bp
  • T to C, chromosome 9 at 108,070,731 bp
  • G to A, chromosome 10 at 40,233,185 bp
  • G to A, chromosome 10 at 61,751,687 bp
  • A to G, chromosome 10 at 79,630,099 bp
  • A to T, chromosome 10 at 88,772,915 bp
  • T to C, chromosome 11 at 5,105,649 bp
  • T to C, chromosome 11 at 77,853,350 bp
  • T to C, chromosome 11 at 100,698,208 bp
  • A to G, chromosome 12 at 110,855,586 bp
  • A to T, chromosome 13 at 14,322,589 bp
  • T to C, chromosome 13 at 49,722,165 bp
  • T to G, chromosome 14 at 57,691,353 bp
  • C to T, chromosome 15 at 11,027,785 bp
  • T to C, chromosome 15 at 82,092,756 bp
  • T to C, chromosome 15 at 96,419,458 bp
  • T to C, chromosome 16 at 5,074,369 bp
  • T to G, chromosome 17 at 20,624,208 bp
  • T to A, chromosome 17 at 22,200,525 bp
  • T to C, chromosome 17 at 22,372,068 bp
  • T to C, chromosome 17 at 25,931,472 bp
  • T to C, chromosome 17 at 34,602,111 bp
  • T to A, chromosome 17 at 40,947,184 bp
  • T to C, chromosome 17 at 55,700,063 bp
  • C to T, chromosome 17 at 78,922,205 bp
  • A to T, chromosome 18 at 80,776,837 bp
  • T to A, chromosome 19 at 42,740,459 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5394 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The submitter or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042966-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.