Strain Name:
C57BL/6J-MtgxR5394Btlr/Mmmh
Stock Number:
042966-MU
Citation ID:
RRID:MMRRC_042966-MU
Other Names:
R5394 (G1), C57BL/6J-MtgxR5394Btlr
Major Collection:

Strain Information

Wnt5b
Name: wingless-type MMTV integration site family, member 5B
Synonyms: Wnt-5b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 22419
Homologene: 22530
Pik3cb
Name: phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta
Synonyms: 1110001J02Rik, p110beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 74769
HGNC: HGNC:8976
Homologene: 21250
Utp20
Name: UTP20 small subunit processome component
Synonyms: DRIM, 3830408P06Rik, mDRIM
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Atm
Name: ataxia telangiectasia mutated
Synonyms: C030026E19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 11920
HGNC: HGNC:795
Homologene: 30952
Cnst
Name: consortin, connexin sorting protein
Synonyms: 9630058J23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226744
Homologene: 17139
Ddx10
Name: DEAD box helicase 10
Synonyms: DEAD (Asp-Glu-Ala-Asp) box polypeptide 10, 4632415A01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 77591
VEGA: 9
HGNC: HGNC:2735
Homologene: 20922
Eif4g3
Name: eukaryotic translation initiation factor 4 gamma, 3
Synonyms: 4930523M17Rik, G1-419-52, 1500002J22Rik, repro8, eIF4GII
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230861
HGNC: HGNC:3298
Homologene: 2789
Eprs1
Name: glutamyl-prolyl-tRNA synthetase 1
Synonyms: Eprs, 3010002K18Rik, 2410081F06Rik, Qprs
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 107508
HGNC: HGNC:3418
Homologene: 5870
Iars1
Name: isoleucyl-tRNA synthetase 1
Synonyms: E430001P04Rik, Iars, 2510016L12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 105148
HGNC: HGNC:5330
Homologene: 5325
Myo18a
Name: myosin XVIIIA
Synonyms: MyoPDZ
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 360013
Homologene: 7977
Snx30
Name: sorting nexin family member 30
Synonyms: C030041J06Rik, 4732481H14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 209131
Homologene: 2811
Bltp1
Name: bridge-like lipid transfer protein family member 1
Synonyms: FSA, 4932438A13Rik, Tweek
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229227
Homologene: 52105
Als2
Name: alsin Rho guanine nucleotide exchange factor
Synonyms: Als2cr6, 9430073A21Rik, Alsin, 3222402C23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 74018
HGNC: HGNC:443
Homologene: 23264
Usp24
Name: ubiquitin specific peptidase 24
Synonyms: 2810030C21Rik, 2700066K03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 329908
Homologene: 35420
Arfip2
Name: ADP-ribosylation factor interacting protein 2
Synonyms: 2310002N04Rik, Arfaptin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 76932
Homologene: 8234
Atp9b
Name: ATPase, class II, type 9B
Synonyms: IIb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 50771
VEGA: 18
Homologene: 21915
Rnf123
Name: ring finger protein 123
Synonyms: KPC1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 84585
Homologene: 11112
Ubn1
Name: ubinuclein 1
Synonyms: 1110029L11Rik, 2610108L02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 170644
VEGA: 16
Homologene: 9656
Dcp1b
Name: decapping mRNA 1B
Synonyms: B930050E02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 319618
Homologene: 51881
Pot1b
Name: protection of telomeres 1B
Synonyms: 2810458H16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 72836
VEGA: 17
Homologene: 87058
Mms22l
Name: MMS22-like, DNA repair protein
Synonyms: F730047E07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 212377
Homologene: 18874
Neo1
Name: neogenin
Synonyms: D930014N22Rik, Igdcc2, 2610028H22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 18007
VEGA: 9
HGNC: HGNC:7754
Homologene: 1870
Lef1
Name: lymphoid enhancer binding factor 1
Synonyms: lymphoid enhancer factor 1, Lef-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 16842
HGNC: HGNC:6551
Homologene: 7813
Alms1
Name: ALMS1, centrosome and basal body associated
Synonyms: Alstrom syndrome 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 236266
HGNC: HGNC:428
Homologene: 49406
Mei1
Name: meiotic double-stranded break formation protein 1
Synonyms: mei1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 74369
Homologene: 46535
Htt
Name: huntingtin
Synonyms: IT15, htt, C430023I11Rik, HD, huntingtin, Hdh
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 15194
HGNC: HGNC:4851
Homologene: 1593
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: b2b414Clo, 4432416O06Rik, m407Asp, m152Asp, D030010H02Rik, Dnchc2, D330044F14Rik, DHC2, DHC1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Tia1
Name: cytotoxic granule-associated RNA binding protein 1
Synonyms: mTIA-1, 2310050N03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 21841
Homologene: 20692
Cops6
Name: COP9 signalosome subunit 6
Synonyms: VIP/MOV34, COP9 complex S6, Sgn3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 26893
Homologene: 4977
Rpf2
Name: ribosome production factor 2 homolog
Synonyms: Bxdc1, 2810470K21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 67239
Homologene: 6404
Tsc22d4
Name: Tsc22 domain family, member 4
Synonyms: Spacdr, 1700023B23Rik, Tsc22d4, Thg-1pit, 0610009M14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 78829
Homologene: 11390
Cwc22
Name: CWC22 spliceosome-associated protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 80744
Homologene: 6048
Camk1d
Name: calcium/calmodulin-dependent protein kinase ID
Synonyms: CaMKIdelta, CKLiK, E030025C11Rik, A630059D12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227541
Homologene: 121858
Fbxo46
Name: F-box protein 46
Synonyms: 4932704E22Rik, 20D7-FC4, Fbxo34l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 243867
Homologene: 18467
Asap3
Name: ArfGAP with SH3 domain, ankyrin repeat and PH domain 3
Synonyms: Ddefl1, 9430088F20Rik, UPLC1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230837
Homologene: 41190
Gm14325
Name: predicted gene 14325
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 329575
Homologene: 134324
Slc4a4
Name: solute carrier family 4 (anion exchanger), member 4
Synonyms: NBC1, NBC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 54403
Homologene: 55776
Slc16a4
Name: solute carrier family 16 (monocarboxylic acid transporters), member 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229699
Homologene: 74529
Macroh2a2
Name: macroH2A.2 histone
Synonyms: H2afy2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 404634
Homologene: 10246
Adamts13
Name: ADAM metallopeptidase with thrombospondin type 1 motif 13
Synonyms: LOC279028, vWF-CP mRNA for von Willebrand factor-cleaving
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 279028
HGNC: HGNC:1366
Homologene: 16372
Nos3
Name: nitric oxide synthase 3, endothelial cell
Synonyms: ecNOS, eNOS, 2310065A03Rik, Nos-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 18127
HGNC: HGNC:7876
Homologene: 504
Slc45a2
Name: solute carrier family 45, member 2
Synonyms: bls, blanc-sale, Aim1, Matp, dominant brown, Dbr, Oca4, Aim-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 22293
Homologene: 9412
Hydin
Name: HYDIN, axonemal central pair apparatus protein
Synonyms: hy3, 4930545D19Rik, 1700034M11Rik, hyrh, hy-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244653
Homologene: 52118
Pik3c2g
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 18705
HGNC: HGNC:8973
Homologene: 3362
Pde5a
Name: phosphodiesterase 5A, cGMP-specific
Synonyms: Pde5, PDE5A1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 242202
HGNC: HGNC:8784
Homologene: 842
Wdr17
Name: WD repeat domain 17
Synonyms: B230207L18Rik, 3010002I12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244484
Homologene: 12460
Zfp839
Name: zinc finger protein 839
Synonyms: 2810455K09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 72805
VEGA: 12
Homologene: 49541
Zan
Name: zonadhesin
Synonyms: Zan
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 22635
Homologene: 124417
Gxylt2
Name: glucoside xylosyltransferase 2
Synonyms: LOC232313, Glt8d4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232313
Homologene: 16823
Cspg4
Name: chondroitin sulfate proteoglycan 4
Synonyms: 4732461B14Rik, NG2, Cspg4a, AN2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 121021
VEGA: 9
HGNC: HGNC:2466
Homologene: 20445
Cog2
Name: component of oligomeric golgi complex 2
Synonyms: 1190002B08Rik, Cog2, 2700012E02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 76332
HGNC: HGNC:6546
Homologene: 7206
Kcnh2
Name: potassium voltage-gated channel, subfamily H (eag-related), member 2
Synonyms: merg1b, ether a go-go related, M-erg, LQT, merg1a, Lqt2, ERG1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 16511
HGNC: HGNC:6251
Homologene: 201
Egr4
Name: early growth response 4
Synonyms: NGFI-C, NGF1-C, pAT133
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 13656
HGNC: HGNC:3241
Homologene: 1485
Sspo
Name: SCO-spondin
Synonyms: C79529, Scospondin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243369
Homologene: 45453
Shc2
Name: SHC (Src homology 2 domain containing) transforming protein 2
Synonyms: Sli, ShcB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216148
Homologene: 19127
Shank1
Name: SH3 and multiple ankyrin repeat domains 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 243961
Homologene: 22949
Dhx58
Name: DExH-box helicase 58
Synonyms: LPG2, B430001I08Rik, D11Lgp2e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 80861
Homologene: 69371
Col11a1
Name: collagen, type XI, alpha 1
Synonyms: C530001D20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 12814
HGNC: HGNC:2186
Homologene: 56389
Mmut
Name: methylmalonyl-Coenzyme A mutase
Synonyms: D230010K02Rik, Mut
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 17850
VEGA: 17
HGNC: HGNC:7526
Homologene: 20097
Cebpz
Name: CCAAT/enhancer binding protein zeta
Synonyms: CBF2, Cbf, Cebpa-rs1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 12607
VEGA: 17
Homologene: 4210
Or10x1
Name: olfactory receptor family 10 subfamily X member 1
Synonyms: GA_x6K02T2P20D-20787051-20786119, Olfr417, MOR267-11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 258238
Homologene: 17358
Ankdd1a
Name: ankyrin repeat and death domain containing 1A
Synonyms: EG330963, LOC384945
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 330963
VEGA: 9
Homologene: 65619
Mmp15
Name: matrix metallopeptidase 15
Synonyms: Membrane type 2-MMP, MT2-MMP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 17388
HGNC: HGNC:7161
Homologene: 20549
Tpte
Name: transmembrane phosphatase with tensin homology
Synonyms: Pten2, Vsp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234129
Homologene: 50411
Scaf11
Name: SR-related CTD-associated factor 11
Synonyms: 1110061H03Rik, Sfrs2ip, Srsf2ip, CASP11, SIP1, 2610510E10Rik, SRRP129
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 72193
VEGA: 15
Homologene: 37957
4930503B20Rik
Name: RIKEN cDNA 4930503B20 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Homologene: 41344
Slc24a3
Name: solute carrier family 24 (sodium/potassium/calcium exchanger), member 3
Synonyms: NCKX3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 94249
Homologene: 41390
Fpr-rs3
Name: formyl peptide receptor, related sequence 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 14290
Homologene: 130087
Vmn2r65
Name: vomeronasal 2, receptor 65
Synonyms: ENSMUSG00000070600
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 100009609
Pyroxd2
Name: pyridine nucleotide-disulphide oxidoreductase domain 2
Synonyms: 3830409H07Rik, 4833409A17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 74580
VEGA: 19
Homologene: 13097
Prdm13
Name: PR domain containing 13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230025
Homologene: 11000
Dapk2
Name: death-associated protein kinase 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 13143
HGNC: HGNC:2675
Homologene: 74940
Or4c125
Name: olfactory receptor family 4 subfamily C member 125
Synonyms: Olfr1233, MOR238-1, GA_x6K02T2Q125-50784973-50784056
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258974
Homologene: 74243
Kplce
Name: KPRP N-terminal and LCE C-terminal like protein
Synonyms: 2310050C09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 66533
Homologene: 104374
Man2b2
Name: mannosidase 2, alpha B2
Synonyms: 135 kDa alpha-D-mannosidase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 17160
Homologene: 7411
4930590J08Rik
Name: RIKEN cDNA 4930590J08 gene
Synonyms: LOC381798
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 381798
Homologene: 49985
Hecw1
Name: HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
Synonyms: E130207I19Rik, NEDL1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 94253
VEGA: 13
Homologene: 9004
Zswim9
Name: zinc finger SWIM-type containing 9
Synonyms: 6330408A02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 321008
Homologene: 52386
Lats2
Name: large tumor suppressor 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 50523
HGNC: HGNC:6515
Homologene: 56678
Pigq
Name: phosphatidylinositol glycan anchor biosynthesis, class Q
Synonyms: Gpi1h, Gpih, Gpi1p, Gpi1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 14755
Homologene: 31228
Ppp1r42
Name: protein phosphatase 1, regulatory subunit 42
Synonyms: Lrrc67, 4930418G15Rik, 1700011J18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 69312
Homologene: 27077
Zfp758
Name: zinc finger protein 758
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224598
Homologene: 138293
Or51f1
Name: olfactory receptor family 51 subfamily F member 1
Synonyms: Olfr566, GA_x6K02T2PBJ9-5560696-5559746, MOR14-7P
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258168
Homologene: 133721
Rhbdd3
Name: rhomboid domain containing 3
Synonyms: 5730411O18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 279766
HGNC: HGNC:1308
Homologene: 8175
Rnf25
Name: ring finger protein 25
Synonyms: 0610009H16Rik, AO7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 57751
Homologene: 11193
Vmn1r55
Name: vomeronasal 1 receptor 55
Synonyms: LOC236535, LOC384522, V1rd5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 384522
Homologene: 41799
Or10d4b
Name: olfactory receptor family 10 subfamily D member 4B
Synonyms: GA_x6K02T2PVTD-33320043-33320987, MOR224-12, Olfr960
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258276
VEGA: 9
Homologene: 17168
Cmtm1
Name: CKLF-like MARVEL transmembrane domain containing 1
Synonyms: CHLFH1a, CKLFH1, Cklfsf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 100504164
Homologene: 134399
Rnf5
Name: ring finger protein 5
Synonyms: 2410131O05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 54197
Homologene: 56004
Zfp994
Name: zinc finger protein 994
Synonyms: Gm4944
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 240038
VEGA: 17
Homologene: 133246
Gm13415
Name: predicted gene 13415
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 102638285
Lyrm1
Name: LYR motif containing 1
Synonyms: 4930404J24Rik, 1110065L10Rik, 2310004B22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 73919
Homologene: 10707
Gm9939
Name: predicted gene 9939
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 9,999,405 bp
  • T to C, chromosome 1 at 59,174,946 bp
  • T to C, chromosome 1 at 74,595,252 bp
  • T to C, chromosome 1 at 174,369,270 bp
  • T to A, chromosome 1 at 179,601,736 bp
  • C to T, chromosome 1 at 185,372,985 bp
  • G to C, chromosome 2 at 5,303,366 bp
  • A to T, chromosome 2 at 24,442,910 bp
  • G to A, chromosome 2 at 26,986,558 bp
  • G to C, chromosome 2 at 77,929,339 bp
  • A to T, chromosome 2 at 89,339,462 bp
  • T to C, chromosome 2 at 145,613,574 bp
  • G to A, chromosome 2 at 177,832,984 bp
  • G to T, chromosome 3 at 36,917,668 bp
  • T to C, chromosome 3 at 92,868,698 bp
  • G to A, chromosome 3 at 107,292,442 bp
  • A to G, chromosome 3 at 114,194,184 bp
  • G to A, chromosome 3 at 122,818,009 bp
  • C to T, chromosome 3 at 131,194,659 bp
  • A to G, chromosome 3 at 146,650,608 bp
  • T to C, chromosome 3 at 146,650,958 bp
  • T to A, chromosome 4 at 21,679,455 bp
  • A to G, chromosome 4 at 24,517,115 bp
  • T to A, chromosome 4 at 59,879,329 bp
  • A to T, chromosome 4 at 106,408,013 bp
  • A to T, chromosome 4 at 136,241,259 bp
  • A to G, chromosome 4 at 138,103,398 bp
  • T to A, chromosome 5 at 24,332,041 bp
  • A to G, chromosome 5 at 24,383,890 bp
  • C to A, chromosome 5 at 34,905,597 bp
  • T to G, chromosome 5 at 36,814,518 bp
  • T to A, chromosome 5 at 89,197,764 bp
  • T to C, chromosome 5 at 137,435,634 bp
  • T to C, chromosome 5 at 137,464,074 bp
  • T to A, chromosome 5 at 137,758,774 bp
  • T to A, chromosome 5 at 138,163,500 bp
  • A to G, chromosome 6 at 48,495,260 bp
  • A to T, chromosome 6 at 85,512,460 bp
  • C to A, chromosome 6 at 85,623,088 bp
  • T to A, chromosome 6 at 86,427,684 bp
  • A to G, chromosome 6 at 91,919,193 bp
  • A to G, chromosome 6 at 100,705,114 bp
  • C to A, chromosome 6 at 119,175,367 bp
  • C to A, chromosome 6 at 119,440,322 bp
  • T to C, chromosome 6 at 139,720,082 bp
  • A to T, chromosome 7 at 5,146,996 bp
  • G to A, chromosome 7 at 13,260,983 bp
  • A to G, chromosome 7 at 19,136,616 bp
  • G to A, chromosome 7 at 44,352,651 bp
  • A to G, chromosome 7 at 84,946,654 bp
  • A to T, chromosome 7 at 102,856,479 bp
  • A to T, chromosome 7 at 105,636,976 bp
  • A to C, chromosome 7 at 119,914,248 bp
  • G to T, chromosome 8 at 22,327,790 bp
  • C to A, chromosome 8 at 34,965,219 bp
  • A to G, chromosome 8 at 54,639,489 bp
  • A to T, chromosome 8 at 95,366,404 bp
  • CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT, chromosome 8 at 104,309,470 bp
  • A to G, chromosome 8 at 110,539,842 bp
  • G to T, chromosome 8 at 124,532,529 bp
  • C to T, chromosome 9 at 7,120,899 bp
  • A to T, chromosome 9 at 39,623,134 bp
  • A to T, chromosome 9 at 53,233,857 bp
  • C to T, chromosome 9 at 53,507,777 bp
  • A to G, chromosome 9 at 56,890,200 bp
  • A to T, chromosome 9 at 58,990,234 bp
  • A to T, chromosome 9 at 65,505,214 bp
  • G to A, chromosome 9 at 66,268,718 bp
  • T to C, chromosome 9 at 99,088,663 bp
  • T to C, chromosome 9 at 108,070,731 bp
  • G to A, chromosome 10 at 40,233,185 bp
  • G to A, chromosome 10 at 61,751,687 bp
  • A to G, chromosome 10 at 79,630,099 bp
  • A to T, chromosome 10 at 88,772,915 bp
  • T to C, chromosome 11 at 5,105,649 bp
  • T to C, chromosome 11 at 77,853,350 bp
  • T to C, chromosome 11 at 100,698,208 bp
  • A to G, chromosome 12 at 110,855,586 bp
  • A to T, chromosome 13 at 14,322,589 bp
  • T to C, chromosome 13 at 49,722,165 bp
  • T to G, chromosome 14 at 57,691,353 bp
  • C to T, chromosome 15 at 11,027,785 bp
  • T to C, chromosome 15 at 82,092,756 bp
  • T to C, chromosome 15 at 96,419,458 bp
  • T to C, chromosome 16 at 5,074,369 bp
  • T to G, chromosome 17 at 20,624,208 bp
  • T to A, chromosome 17 at 22,200,525 bp
  • T to C, chromosome 17 at 22,372,068 bp
  • T to C, chromosome 17 at 25,931,472 bp
  • T to C, chromosome 17 at 34,602,111 bp
  • T to A, chromosome 17 at 40,947,184 bp
  • T to C, chromosome 17 at 55,700,063 bp
  • C to T, chromosome 17 at 78,922,205 bp
  • A to T, chromosome 18 at 80,776,837 bp
  • T to A, chromosome 19 at 42,740,459 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5394 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042966-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.