Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5397Btlr/Mmmh
Stock Number:
042968-MU
Citation ID:
RRID:MMRRC_042968-MU
Other Names:
R5397 (G1), C57BL/6J-MtgxR5397Btlr
Major Collection:

Strain Information

S100a1
Name: S100 calcium binding protein A1
Synonyms: S100a, S100
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20193
Homologene: 4566
Map7
Name: microtubule-associated protein 7
Synonyms: E-MAP-115, mste, ste, mshi, Mtap7
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17761
VEGA: 10
HGNC: HGNC:6869
Homologene: 20851
Kdm5b
Name: lysine demethylase 5B
Synonyms: PLU-1, 2010009J12Rik, Plu1, Rb-Bp2, 2210016I17Rik, D1Ertd202e, Jarid1b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75605
Homologene: 48448
Atad5
Name: ATPase family, AAA domain containing 5
Synonyms: LOC237877, C130052G03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237877
Homologene: 32611
Gpi1
Name: glucose-6-phosphate isomerase 1
Synonyms: Org, Gpi-1t, Gpi-1, Gpi-1s, Gpi-1r, Gpi1-t, Gpi1-s, Gpi1-r, MF, maturation factor, NK, AMF, autocrine motility factor, neuroleukin, NK/GPI
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14751
HGNC: HGNC:4458
Homologene: 145
Ube3a
Name: ubiquitin protein ligase E3A
Synonyms: Hpve6a, E6-AP ubiquitin protein ligase, A130086L21Rik, 5830462N02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22215
Homologene: 7988
Acvr1b
Name: activin A receptor, type 1B
Synonyms: ActR-IB, Acvrlk4, SKR2, ActRIB, Alk4
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11479
HGNC: HGNC:172
Homologene: 20906
Prpf3
Name: pre-mRNA processing factor 3
Synonyms: 3632413F13Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70767
Homologene: 3447
Afg3l2
Name: AFG3-like AAA ATPase 2
Synonyms: 2310036I02Rik, par, Emv66
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 69597
VEGA: 18
HGNC: HGNC:315
Homologene: 4947
Phyhipl
Name: phytanoyl-CoA hydroxylase interacting protein-like
Synonyms: 4921522K17Rik, PHY2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70911
Homologene: 13028
Lig4
Name: ligase IV, DNA, ATP-dependent
Synonyms: DNA ligase IV, 5830471N16Rik, tiny
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319583
HGNC: HGNC:6601
Homologene: 1736
C1qtnf3
Name: C1q and tumor necrosis factor related protein 3
Synonyms: CORS-26, Corcs, 2310005P21Rik, CTRP3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 81799
Homologene: 12788
Npat
Name: nuclear protein in the AT region
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244879
HGNC: HGNC:7896
Homologene: 1888
Pms1
Name: PMS1 homolog 1, mismatch repair system component
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227099
HGNC: HGNC:9121
Homologene: 449
Paxip1
Name: PAX interacting (with transcription-activation domain) protein 1
Synonyms: PTIP, D5Ertd149e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 55982
HGNC: HGNC:8624
Arap1
Name: ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1
Synonyms: 2410002L19Rik, Centd2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69710
Homologene: 12326
Mplkipl1
Name: M-phase specific PLK1 intereacting protein like 1
Synonyms: Gm7102
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 633057
Cd68
Name: CD68 antigen
Synonyms: macrosialin, gp110, Scard1, Lamp4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12514
HGNC: HGNC:1693
Homologene: 955
Zcchc7
Name: zinc finger, CCHC domain containing 7
Synonyms: 4930572I07Rik, D4Wsu132e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 319885
Homologene: 22217
Adar
Name: adenosine deaminase, RNA-specific
Synonyms: ADAR1, mZaADAR, Adar1p150, Adar1p110
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56417
HGNC: HGNC:225
Homologene: 9281
Srcap
Name: Snf2-related CREBBP activator protein
Synonyms: F630004O05Rik, B930091H02Rik, D030022P06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043597
Homologene: 38213
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Fam124a
Name: family with sequence similarity 124, member A
Synonyms: EG629059
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 629059
Homologene: 86241
Gucy1b1
Name: guanylate cyclase 1, soluble, beta 1
Synonyms: beta 1 sGC, Gucy1b3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 54195
HGNC: HGNC:4687
Homologene: 664
Trgv5
Name: T cell receptor gamma, variable 5
Synonyms: Tcrg-V5
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21639
Tom1l1
Name: target of myb1-like 1 (chicken)
Synonyms: 2310045L10Rik, Srcasm
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71943
Homologene: 38055
Cyp2d11
Name: cytochrome P450, family 2, subfamily d, polypeptide 11
Synonyms: Cyp2d, P450-2D
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 545123
VEGA: 15
Homologene: 86099
Ppp1r9b
Name: protein phosphatase 1, regulatory subunit 9B
Synonyms: neurabin II, spinophilin, Spn, SPL
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217124
HGNC: HGNC:9298
Homologene: 32787
Capn2
Name: calpain 2
Synonyms: m-calpain, Capa-2, Capa2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12334
HGNC: HGNC:1479
Homologene: 1326
Gm4787
Name: predicted gene 4787
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 214321
Homologene: 86950
Or51ac3
Name: olfactory receptor family 51 subfamily AC member 3
Synonyms: GA_x6K02T2PBJ9-6289676-6288723, MOR19-1, Olfr616
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259103
Homologene: 64957
Or4k77
Name: olfactory receptor family 4 subfamily K member 77
Synonyms: GA_x6K02T2Q125-72420217-72421134, MOR248-19, Olfr1283
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228443
Homologene: 133657
Dhx58
Name: DExH-box helicase 58
Synonyms: B430001I08Rik, LPG2, D11Lgp2e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 80861
Homologene: 69371
Flnc
Name: filamin C, gamma
Synonyms: Fln2, 1110055E19Rik, actin binding protein 280
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68794
HGNC: HGNC:3756
Homologene: 37481
Mertk
Name: MER proto-oncogene tyrosine kinase
Synonyms: Tyro 12, Nyk, Eyk, Mer, nmf12
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17289
HGNC: HGNC:7027
Homologene: 4626
Nme8
Name: NME/NM23 family member 8
Synonyms: 1700056P15Rik, Sptrx-2, Txndc3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 73412
Homologene: 9593
Dpy19l3
Name: dpy-19 like C-mannosyltransferase 3
Synonyms: 9330164H19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233115
Homologene: 18692
Tgm6
Name: transglutaminase 6
Synonyms: TGM3L
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241636
Homologene: 27970
Plxnc1
Name: plexin C1
Synonyms: vespr, 2510048K12Rik, CD232
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 54712
HGNC: HGNC:9106
Homologene: 4211
Slc5a5
Name: solute carrier family 5 (sodium iodide symporter), member 5
Synonyms: NIS
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 114479
Homologene: 37311
Or6c76b
Name: olfactory receptor family 6 subfamily C member 76B
Synonyms: GA_x6K02T2PULF-11535078-11536010, MOR108-3, Olfr813
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258252
Homologene: 138308
Vmn1r25
Name: vomeronasal 1 receptor 25
Synonyms: V1rc8
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113865
Homologene: 137652
Gad1-ps
Name: glutamate decarboxylase 1, pseudogene
Synonyms: Gad-1ps
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 382407
VEGA: 10
Vmn2r101
Name: vomeronasal 2, receptor 101
Synonyms: EG627576
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627576
Homologene: 115024
Acox2
Name: acyl-Coenzyme A oxidase 2, branched chain
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 93732
HGNC: HGNC:120
Homologene: 74473
Ripply1
Name: ripply transcriptional repressor 1
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 622473
Homologene: 134609
Gpr149
Name: G protein-coupled receptor 149
Synonyms: PGR10, 9630018L10Rik, Ieda, R35
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229357
Homologene: 16359
Kcnq5
Name: potassium voltage-gated channel, subfamily Q, member 5
Synonyms: 9230107O05Rik, D1Mgi1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226922
HGNC: HGNC:6299
Homologene: 28270
Slc2a5
Name: solute carrier family 2 (facilitated glucose transporter), member 5
Synonyms: GLUT5
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56485
Homologene: 74459
Bsg
Name: basigin
Synonyms: neurothelin, CD147, 5A11/Basigin, EMMPRIN, HT-7, gp 42
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12215
HGNC: HGNC:1116
Homologene: 1308
Zcchc10
Name: zinc finger, CCHC domain containing 10
Synonyms: 2410141K03Rik, D11Ertd416e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67966
Vgll2
Name: vestigial like family member 2
Synonyms: C130057C21Rik, VITO-1, Vito1, Vgl-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215031
Homologene: 35066
Mettl4
Name: methyltransferase 4, N6-adenosine
Synonyms: HsT661, 2410198H06Rik, A730091E08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 76781
VEGA: 17
Homologene: 35305
Rdh14
Name: retinol dehydrogenase 14 (all-trans and 9-cis)
Synonyms: PAN2, 3110030G19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 105014
VEGA: 12
Homologene: 75139
Gm4845
Name: predicted gene 4845
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226472
Snhg14
Name: small nucleolar RNA host gene 14
Synonyms: Lncat, D7Ertd715e, Gm42391, Gm42390, Gm42389, Gm42388, Gm45921, Gm42386, Gm42387, C230091D08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 52480
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 21,405,856 bp
  • T to A, chromosome 1 at 53,192,120 bp
  • G to A, chromosome 1 at 134,622,098 bp
  • T to C, chromosome 1 at 141,257,034 bp
  • A to G, chromosome 1 at 182,470,706 bp
  • T to C, chromosome 2 at 76,725,255 bp
  • T to A, chromosome 2 at 111,368,940 bp
  • T to A, chromosome 2 at 128,771,464 bp
  • T to A, chromosome 2 at 130,141,908 bp
  • A to G, chromosome 3 at 62,530,805 bp
  • G to A, chromosome 3 at 82,044,151 bp
  • T to C, chromosome 3 at 89,735,319 bp
  • A to T, chromosome 3 at 90,512,135 bp
  • A to T, chromosome 3 at 95,853,579 bp
  • C to A, chromosome 4 at 44,926,048 bp
  • G to A, chromosome 4 at 150,139,823 bp
  • A to T, chromosome 5 at 27,772,004 bp
  • C to CTCG, chromosome 6 at 4,756,453 bp
  • G to A, chromosome 6 at 29,441,161 bp
  • A to T, chromosome 6 at 57,979,075 bp
  • G to A, chromosome 7 at 34,227,196 bp
  • A to G, chromosome 7 at 35,708,044 bp
  • T to A, chromosome 7 at 59,286,912 bp
  • C to T, chromosome 7 at 59,317,358 bp
  • A to T, chromosome 7 at 101,384,912 bp
  • T to A, chromosome 7 at 103,564,506 bp
  • T to G, chromosome 7 at 127,553,296 bp
  • G to T, chromosome 8 at 9,972,644 bp
  • T to C, chromosome 8 at 70,891,179 bp
  • T to C, chromosome 8 at 124,675,263 bp
  • A to G, chromosome 9 at 53,570,474 bp
  • G to A, chromosome 10 at 20,273,321 bp
  • A to G, chromosome 10 at 52,025,166 bp
  • T to G, chromosome 10 at 70,565,236 bp
  • T to A, chromosome 10 at 79,708,795 bp
  • T to C, chromosome 10 at 94,843,752 bp
  • G to A, chromosome 10 at 99,445,147 bp
  • T to C, chromosome 10 at 129,856,710 bp
  • CCAGCAGCAGCAGCAGCAGCAG to CCAGCAGCAGCAGCAGCAG, chromosome 11 at 53,332,517 bp
  • C to T, chromosome 11 at 69,665,658 bp
  • T to A, chromosome 11 at 80,111,493 bp
  • G to A, chromosome 11 at 90,661,774 bp
  • A to G, chromosome 11 at 95,002,110 bp
  • A to G, chromosome 11 at 100,703,920 bp
  • T to A, chromosome 12 at 10,394,869 bp
  • G to C, chromosome 12 at 81,377,830 bp
  • A to C, chromosome 13 at 19,192,558 bp
  • T to C, chromosome 13 at 19,694,379 bp
  • A to G, chromosome 13 at 74,720,937 bp
  • T to C, chromosome 14 at 8,243,803 bp
  • A to G, chromosome 14 at 62,606,389 bp
  • A to G, chromosome 15 at 10,978,541 bp
  • A to T, chromosome 15 at 82,392,078 bp
  • T to A, chromosome 15 at 101,198,964 bp
  • A to G, chromosome 17 at 19,588,842 bp
  • A to T, chromosome 17 at 94,727,277 bp
  • G to T, chromosome 18 at 67,421,259 bp
  • C to T, chromosome 19 at 61,175,926 bp
  • TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT to TTCCTCCTCCTCCTCCTCCTCCTCCTCCT, chromosome X at 139,779,850 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5397 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042968-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.