Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5397Btlr/Mmmh
Stock Number:
042968-MU
Citation ID:
RRID:MMRRC_042968-MU
Other Names:
R5397 (G1), C57BL/6J-MtgxR5397Btlr
Major Collection:

Strain Information

S100a1
Name: S100 calcium binding protein A1
Synonyms: S100a, S100
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20193
Homologene: 4566
Map7
Name: microtubule-associated protein 7
Synonyms: E-MAP-115, mste, ste, mshi, Mtap7
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17761
VEGA: 10
HGNC: HGNC:6869
Homologene: 20851
Kdm5b
Name: lysine demethylase 5B
Synonyms: PLU-1, 2010009J12Rik, Plu1, Rb-Bp2, 2210016I17Rik, D1Ertd202e, Jarid1b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75605
Homologene: 48448
Atad5
Name: ATPase family, AAA domain containing 5
Synonyms: LOC237877, C130052G03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237877
Homologene: 32611
Gpi1
Name: glucose-6-phosphate isomerase 1
Synonyms: Gpi-1t, Gpi-1, Org, Gpi-1s, Gpi-1r, Gpi1-t, Gpi1-s, Gpi1-r, MF, maturation factor, NK, AMF, autocrine motility factor, neuroleukin, NK/GPI
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14751
HGNC: HGNC:4458
Homologene: 145
Ube3a
Name: ubiquitin protein ligase E3A
Synonyms: Hpve6a, E6-AP ubiquitin protein ligase, A130086L21Rik, 5830462N02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22215
Homologene: 7988
Acvr1b
Name: activin A receptor, type 1B
Synonyms: ActR-IB, Acvrlk4, SKR2, ActRIB, Alk4
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11479
HGNC: HGNC:172
Homologene: 20906
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 21,405,856 bp
  • T to A, chromosome 1 at 53,192,120 bp
  • G to A, chromosome 1 at 134,622,098 bp
  • T to C, chromosome 1 at 141,257,034 bp
  • A to G, chromosome 1 at 182,470,706 bp
  • T to C, chromosome 2 at 76,725,255 bp
  • T to A, chromosome 2 at 111,368,940 bp
  • T to A, chromosome 2 at 128,771,464 bp
  • T to A, chromosome 2 at 130,141,908 bp
  • A to G, chromosome 3 at 62,530,805 bp
  • G to A, chromosome 3 at 82,044,151 bp
  • T to C, chromosome 3 at 89,735,319 bp
  • A to T, chromosome 3 at 90,512,135 bp
  • A to T, chromosome 3 at 95,853,579 bp
  • C to A, chromosome 4 at 44,926,048 bp
  • G to A, chromosome 4 at 150,139,823 bp
  • A to T, chromosome 5 at 27,772,004 bp
  • C to CTCG, chromosome 6 at 4,756,453 bp
  • G to A, chromosome 6 at 29,441,161 bp
  • A to T, chromosome 6 at 57,979,075 bp
  • G to A, chromosome 7 at 34,227,196 bp
  • A to G, chromosome 7 at 35,708,044 bp
  • T to A, chromosome 7 at 59,286,912 bp
  • C to T, chromosome 7 at 59,317,358 bp
  • A to T, chromosome 7 at 101,384,912 bp
  • T to A, chromosome 7 at 103,564,506 bp
  • T to G, chromosome 7 at 127,553,296 bp
  • G to T, chromosome 8 at 9,972,644 bp
  • T to C, chromosome 8 at 70,891,179 bp
  • T to C, chromosome 8 at 124,675,263 bp
  • A to G, chromosome 9 at 53,570,474 bp
  • G to A, chromosome 10 at 20,273,321 bp
  • A to G, chromosome 10 at 52,025,166 bp
  • T to G, chromosome 10 at 70,565,236 bp
  • T to A, chromosome 10 at 79,708,795 bp
  • T to C, chromosome 10 at 94,843,752 bp
  • G to A, chromosome 10 at 99,445,147 bp
  • T to C, chromosome 10 at 129,856,710 bp
  • CCAGCAGCAGCAGCAGCAGCAG to CCAGCAGCAGCAGCAGCAG, chromosome 11 at 53,332,517 bp
  • C to T, chromosome 11 at 69,665,658 bp
  • T to A, chromosome 11 at 80,111,493 bp
  • G to A, chromosome 11 at 90,661,774 bp
  • A to G, chromosome 11 at 95,002,110 bp
  • A to G, chromosome 11 at 100,703,920 bp
  • T to A, chromosome 12 at 10,394,869 bp
  • G to C, chromosome 12 at 81,377,830 bp
  • A to C, chromosome 13 at 19,192,558 bp
  • T to C, chromosome 13 at 19,694,379 bp
  • A to G, chromosome 13 at 74,720,937 bp
  • T to C, chromosome 14 at 8,243,803 bp
  • A to G, chromosome 14 at 62,606,389 bp
  • A to G, chromosome 15 at 10,978,541 bp
  • A to T, chromosome 15 at 82,392,078 bp
  • T to A, chromosome 15 at 101,198,964 bp
  • A to G, chromosome 17 at 19,588,842 bp
  • A to T, chromosome 17 at 94,727,277 bp
  • G to T, chromosome 18 at 67,421,259 bp
  • C to T, chromosome 19 at 61,175,926 bp
  • TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT to TTCCTCCTCCTCCTCCTCCTCCTCCTCCT, chromosome X at 139,779,850 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5397 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The submitter or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042968-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.