Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5502Btlr/Mmmh
Stock Number:
043063-MU
Citation ID:
RRID:MMRRC_043063-MU
Other Names:
R5502 (G1), C57BL/6J-MtgxR5502Btlr
Major Collection:

Strain Information

Ide
Name: insulin degrading enzyme
Synonyms: 1300012G03Rik, 4833415K22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 15925
HGNC: HGNC:5381
Homologene: 3645
Gria2
Name: glutamate receptor, ionotropic, AMPA2 (alpha 2)
Synonyms: GluR-B, GluR2, Glur-2, Glur2, GluA2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14800
HGNC: HGNC:4572
Homologene: 20225
Dap3
Name: death associated protein 3
Synonyms: 4921514D13Rik, DAP-3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 65111
HGNC: HGNC:2673
Homologene: 3404
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: 0610038M01Rik, 2610510B01Rik, Dopey2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Abcc8
Name: ATP-binding cassette, sub-family C member 8
Synonyms: SUR1, Sur, D930031B21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20927
HGNC: HGNC:59
Homologene: 68048
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, C130061D10Rik, Phr1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105689
Homologene: 9005
Dock9
Name: dedicator of cytokinesis 9
Synonyms: B230309H04Rik, D14Wsu89e, Zizimin1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105445
Homologene: 41026
Golga4
Name: golgin A4
Synonyms: golgin-245, Olp-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 54214
HGNC: HGNC:4427
Homologene: 68224
Rnf121
Name: ring finger protein 121
Synonyms: 4930544L10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75212
Homologene: 10132
Chd4
Name: chromodomain helicase DNA binding protein 4
Synonyms: D6Ertd380e, 9530019N15Rik, Mi-2beta
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 107932
HGNC: HGNC:1919
Homologene: 68175
Afg2a
Name: AFG2 AAA ATPase homolog A
Synonyms: 2510048F20Rik, Spaf, C78064, Spata5
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 57815
Homologene: 56920
Smurf1
Name: SMAD specific E3 ubiquitin protein ligase 1
Synonyms: 4930431E10Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75788
Homologene: 10712
Rbbp6
Name: retinoblastoma binding protein 6, ubiquitin ligase
Synonyms: 4933422O15Rik, C030034J04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19647
HGNC: HGNC:9889
Homologene: 136812
Ank3
Name: ankyrin 3, epithelial
Synonyms: Ank-3, Ankyrin-3, AnkG, 2900054D09Rik, Ankyrin-G
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11735
HGNC: HGNC:494
Homologene: 56908
Rtca
Name: RNA 3'-terminal phosphate cyclase
Synonyms: 2310009A18Rik, Rtcd1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66368
Homologene: 2766
St7
Name: suppression of tumorigenicity 7
Synonyms: RAY1, HELG, SEN4, TSG7, Fam4a2, 9430001H04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 64213
Homologene: 10185
Eps15l1
Name: epidermal growth factor receptor pathway substrate 15-like 1
Synonyms: Eps15R, 9830147J04Rik, Eps15-rs
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13859
Homologene: 31881
Zfp961
Name: zinc finger protein 961
Synonyms: A230105L22Rik, BC049349
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234413
Homologene: 136286
Bbs9
Name: Bardet-Biedl syndrome 9
Synonyms: EST 3159894, E130103I17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319845
Homologene: 44480
Setd1a
Name: SET domain containing 1A
Synonyms: KMT2F
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233904
Homologene: 52251
Strip2
Name: striatin interacting protein 2
Synonyms: Myoscape, D330017J20Rik, Fam40b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320609
Homologene: 66198
Cndp1
Name: carnosine dipeptidase 1
Synonyms: Cn1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 338403
Homologene: 57178
Mme
Name: membrane metallo endopeptidase
Synonyms: CD10, neprilysin, 6030454K05Rik, NEP, neutral endopeptidase
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17380
HGNC: HGNC:7154
Homologene: 5275
Nktr
Name: natural killer tumor recognition sequence
Synonyms: D9Wsu172e, 5330401F18Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18087
HGNC: HGNC:7833
Homologene: 122148
Snrpd2
Name: small nuclear ribonucleoprotein D2
Synonyms: 1810009A06Rik, SMD2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 107686
Homologene: 3381
Usp39
Name: ubiquitin specific peptidase 39
Synonyms: D6Wsu157e, CGI-21, SAD1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28035
Homologene: 13183
Incenp
Name: inner centromere protein
Synonyms: 2700067E22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16319
VEGA: 19
HGNC: HGNC:6058
Homologene: 9624
Tob1
Name: transducer of ErbB-2.1
Synonyms: Trob, Tob
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22057
Homologene: 31334
Ola1
Name: Obg-like ATPase 1
Synonyms: 2810405J23Rik, 2510025G09Rik, 2810409H07Rik, Gtpbp9
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67059
Homologene: 5361
Ino80
Name: INO80 complex subunit
Synonyms: 2310079N15Rik, INO80, 4632409L19Rik, Inoc1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68142
Homologene: 75070
Ibtk
Name: inhibitor of Bruton agammaglobulinemia tyrosine kinase
Synonyms: 5430411K16Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 108837
Homologene: 34661
2700049A03Rik
Name: RIKEN cDNA 2700049A03 gene
Synonyms: talpid3, Ta3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76967
Homologene: 8839
Tusc3
Name: tumor suppressor candidate 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 80286
Homologene: 6937
Qser1
Name: glutamine and serine rich 1
Synonyms: 4732486I23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99003
Homologene: 11710
Mtmr4
Name: myotubularin related protein 4
Synonyms: ESTM44, FYVE-DSP2, FYVE zinc finger phosphatase, ZFYVE11
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 170749
HGNC: HGNC:7452
Homologene: 3440
Nbeal1
Name: neurobeachin like 1
Synonyms: A530050O19Rik, ALS2CR17, A530083I02Rik, 2310076G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269198
Homologene: 16453
Gemin4
Name: gem nuclear organelle associated protein 4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 276919
Homologene: 69193
Actmap
Name: actin maturation protease
Synonyms: BC024978
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 414069
Homologene: 45689
Rfx8
Name: regulatory factor X 8
Synonyms: 4933400N17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 619289
Homologene: 82436
Syn2
Name: synapsin II
Synonyms: 2900074L19Rik, Synapsin IIb, Synapsin IIa
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20965
Homologene: 49348
Cntn3
Name: contactin 3
Synonyms: Pang
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18488
HGNC: HGNC:2173
Homologene: 7461
Or1n1
Name: olfactory receptor family 1 subfamily N member 1
Synonyms: GA_x6K02T2NLDC-33554926-33553994, MOR127-2, Olfr351
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258944
HGNC: HGNC:8221
Homologene: 10583
Myo3a
Name: myosin IIIA
Synonyms: 9030416P08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 667663
HGNC: HGNC:7601
Homologene: 49486
Pde5a
Name: phosphodiesterase 5A, cGMP-specific
Synonyms: PDE5A1, Pde5
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242202
HGNC: HGNC:8784
Homologene: 842
Cyp4a10
Name: cytochrome P450, family 4, subfamily a, polypeptide 10
Synonyms: RP1, Cyp4a, D4Rp1, Msp-3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13117
Homologene: 128044
Col5a2
Name: collagen, type V, alpha 2
Synonyms: 1110014L14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12832
HGNC: HGNC:2210
Homologene: 20119
Rapgef5
Name: Rap guanine nucleotide exchange factor (GEF) 5
Synonyms: mr-gef, D030051B22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217944
VEGA: 12
Homologene: 56563
Nat8f5
Name: N-acetyltransferase 8 (GCN5-related) family member 5
Synonyms: 1810018F03Rik, Cml5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 69049
Homologene: 87019
Sclt1
Name: sodium channel and clathrin linker 1
Synonyms: 4931421F20Rik, 2610207F23Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67161
Homologene: 27031
Tbc1d2b
Name: TBC1 domain family, member 2B
Synonyms: 1810061M12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67016
Homologene: 56694
Fyb2
Name: FYN binding protein 2
Synonyms: 1700024P16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242594
Homologene: 52981
Corin
Name: corin, serine peptidase
Synonyms: Lrp4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 53419
Homologene: 4804
Vmn2r13
Name: vomeronasal 2, receptor 13
Synonyms: Gm4867
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231589
Homologene: 129606
Pcdhb9
Name: protocadherin beta 9
Synonyms: Pcdhb4C, PcdhbI
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93880
HGNC: HGNC:8689
Homologene: 87124
Mmp15
Name: matrix metallopeptidase 15
Synonyms: MT2-MMP, Membrane type 2-MMP
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17388
HGNC: HGNC:7161
Homologene: 20549
Oaz3
Name: ornithine decarboxylase antizyme 3
Synonyms: ornithine decarboxylase antizyme in testis, Oaz-t, AZ-3, antizyme 3, AZ3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 53814
HGNC: HGNC:8097
Homologene: 9410
Accsl
Name: 1-aminocyclopropane-1-carboxylate synthase (inactive)-like
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381411
Homologene: 86007
Rusf1
Name: RUS family member 1
Synonyms: BC017158
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233913
Homologene: 11232
Slc5a9
Name: solute carrier family 5 (sodium/glucose cotransporter), member 9
Synonyms: SGLT4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230612
Homologene: 17081
Nexn
Name: nexilin
Synonyms: nF actin binding protein, 1110046H09Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68810
Homologene: 44892
Sstr4
Name: somatostatin receptor 4
Synonyms: sst4, Smstr4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20608
Homologene: 20286
Sirpb1b
Name: signal-regulatory protein beta 1B
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 668101
Homologene: 82993
Timm44
Name: translocase of inner mitochondrial membrane 44
Synonyms: Tim44, Mimt44, D8Ertd118e, 0710005E20Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 21856
Homologene: 4631
Ces2f
Name: carboxylesterase 2F
Synonyms: 2310038E17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71903
HGNC: HGNC:1864
Homologene: 135673
Hoxb4
Name: homeobox B4
Synonyms: Hox-2.6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15412
HGNC: HGNC:5115
Homologene: 32095
Tmem41b
Name: transmembrane protein 41B
Synonyms: 1500031M19Rik, D7Ertd70e, 1500015G02Rik, D7Ertd743e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233724
Homologene: 42740
Gm4868
Name: predicted gene 4868
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231736
Homologene: 138658
Disp1
Name: dispatched RND transporter family member 1
Synonyms: DispA, 1190008H24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68897
Homologene: 14133
Or4l1
Name: olfactory receptor family 4 subfamily L member 1
Synonyms: GA_x6K02T2PMLR-5600424-5599495, MOR247-3P, MOR247-4, Olfr723
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 259147
Homologene: 71986
Slc37a4
Name: solute carrier family 37 (glucose-6-phosphate transporter), member 4
Synonyms: G6pt1, G6PT
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14385
VEGA: 9
HGNC: HGNC:4061
Homologene: 37482
Spata31d1b
Name: spermatogenesis associated 31 subfamily D, member 1B
Synonyms: Gm4934, Fam75d1b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238662
VEGA: 13
Pcdhga2
Name: protocadherin gamma subfamily A, 2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93710
HGNC: HGNC:8700
Homologene: 69262
Bin2
Name: bridging integrator 2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 668218
HGNC: HGNC:1053
Homologene: 22965
D430036J16Rik
Name: RIKEN cDNA D430036J16 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 319405
Tmem134
Name: transmembrane protein 134
Synonyms: 2410001H17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 66990
Homologene: 11837
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 39,682,953 bp
  • C to A, chromosome 1 at 45,380,126 bp
  • T to A, chromosome 1 at 60,310,999 bp
  • A to G, chromosome 1 at 183,087,886 bp
  • T to C, chromosome 2 at 22,558,369 bp
  • T to C, chromosome 2 at 36,860,270 bp
  • A to T, chromosome 2 at 73,099,307 bp
  • C to T, chromosome 2 at 93,856,944 bp
  • T to C, chromosome 2 at 104,786,574 bp
  • T to C, chromosome 2 at 119,402,396 bp
  • CGAGGAGGAGGAGGA to CGAGGAGGAGGAGGAGGA, chromosome 2 at 148,395,551 bp
  • T to C, chromosome 3 at 15,548,757 bp
  • C to T, chromosome 3 at 37,528,268 bp
  • C to T, chromosome 3 at 41,657,275 bp
  • T to A, chromosome 3 at 63,300,281 bp
  • T to C, chromosome 3 at 80,706,945 bp
  • T to C, chromosome 3 at 88,925,326 bp
  • T to C, chromosome 3 at 94,435,085 bp
  • G to T, chromosome 3 at 116,489,282 bp
  • G to T, chromosome 3 at 122,803,032 bp
  • T to A, chromosome 3 at 152,238,304 bp
  • A to T, chromosome 4 at 104,945,324 bp
  • G to T, chromosome 4 at 111,893,169 bp
  • A to G, chromosome 4 at 115,525,505 bp
  • G to A, chromosome 5 at 72,316,106 bp
  • G to T, chromosome 5 at 109,173,714 bp
  • A to T, chromosome 5 at 109,940,498 bp
  • A to G, chromosome 5 at 125,847,978 bp
  • C to A, chromosome 5 at 144,884,711 bp
  • G to A, chromosome 6 at 17,834,674 bp
  • A to T, chromosome 6 at 29,927,624 bp
  • T to A, chromosome 6 at 72,328,687 bp
  • G to T, chromosome 6 at 85,817,653 bp
  • A to C, chromosome 6 at 102,265,334 bp
  • A to C, chromosome 6 at 115,278,352 bp
  • G to A, chromosome 6 at 125,105,276 bp
  • T to C, chromosome 7 at 19,151,322 bp
  • A to G, chromosome 7 at 27,197,117 bp
  • A to T, chromosome 7 at 42,708,419 bp
  • A to G, chromosome 7 at 46,108,838 bp
  • T to C, chromosome 7 at 102,023,348 bp
  • A to T, chromosome 7 at 109,982,763 bp
  • T to G, chromosome 7 at 122,988,724 bp
  • T to C, chromosome 7 at 127,797,248 bp
  • C to T, chromosome 7 at 128,285,136 bp
  • A to T, chromosome 8 at 4,269,992 bp
  • A to T, chromosome 8 at 39,130,793 bp
  • T to A, chromosome 8 at 71,968,059 bp
  • A to T, chromosome 8 at 72,378,992 bp
  • A to T, chromosome 8 at 95,368,184 bp
  • A to T, chromosome 8 at 104,952,523 bp
  • T to A, chromosome 9 at 22,504,074 bp
  • G to T, chromosome 9 at 44,402,097 bp
  • T to A, chromosome 9 at 81,631,801 bp
  • A to C, chromosome 9 at 85,720,863 bp
  • T to C, chromosome 9 at 90,227,443 bp
  • GT to GTT, chromosome 9 at 118,559,057 bp
  • C to T, chromosome 9 at 121,748,606 bp
  • A to T, chromosome 10 at 69,920,461 bp
  • A to T, chromosome 11 at 76,213,401 bp
  • A to T, chromosome 11 at 87,614,078 bp
  • ACAGCAGCAGCAGCAGCAGCAGCAGCA to ACAGCAGCAGCAGCAGCAGCAGCA, chromosome 11 at 94,214,452 bp
  • A to G, chromosome 11 at 96,320,231 bp
  • G to T, chromosome 12 at 71,164,546 bp
  • A to T, chromosome 12 at 71,164,547 bp
  • T to C, chromosome 12 at 117,721,329 bp
  • A to T, chromosome 13 at 59,716,672 bp
  • A to G, chromosome 14 at 49,929,536 bp
  • T to C, chromosome 14 at 61,206,100 bp
  • C to T, chromosome 14 at 103,173,814 bp
  • A to T, chromosome 14 at 121,610,182 bp
  • A to G, chromosome 15 at 100,645,405 bp
  • T to A, chromosome 16 at 93,793,226 bp
  • A to T, chromosome 18 at 37,401,603 bp
  • A to T, chromosome 18 at 37,670,552 bp
  • A to G, chromosome 18 at 84,632,013 bp
  • G to A, chromosome 19 at 4,131,229 bp
  • C to A, chromosome 19 at 9,893,364 bp
  • C to A, chromosome 19 at 37,330,456 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5502 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043063-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.