Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5502Btlr/Mmmh
Stock Number:
043063-MU
Citation ID:
RRID:MMRRC_043063-MU
Other Names:
R5502 (G1), C57BL/6J-MtgxR5502Btlr
Major Collection:

Strain Information

Ide
Name: insulin degrading enzyme
Synonyms: 1300012G03Rik, 4833415K22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 15925
HGNC: HGNC:5381
Homologene: 3645
Gria2
Name: glutamate receptor, ionotropic, AMPA2 (alpha 2)
Synonyms: GluR-B, GluR2, Glur-2, Glur2, GluA2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14800
HGNC: HGNC:4572
Homologene: 20225
Dap3
Name: death associated protein 3
Synonyms: 4921514D13Rik, DAP-3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 65111
HGNC: HGNC:2673
Homologene: 3404
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: 0610038M01Rik, 2610510B01Rik, Dopey2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Abcc8
Name: ATP-binding cassette, sub-family C member 8
Synonyms: SUR1, Sur, D930031B21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20927
HGNC: HGNC:59
Homologene: 68048
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, C130061D10Rik, Phr1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105689
Homologene: 9005
Dock9
Name: dedicator of cytokinesis 9
Synonyms: B230309H04Rik, D14Wsu89e, Zizimin1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105445
Homologene: 41026
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 39,682,953 bp
  • C to A, chromosome 1 at 45,380,126 bp
  • T to A, chromosome 1 at 60,310,999 bp
  • A to G, chromosome 1 at 183,087,886 bp
  • T to C, chromosome 2 at 22,558,369 bp
  • T to C, chromosome 2 at 36,860,270 bp
  • A to T, chromosome 2 at 73,099,307 bp
  • C to T, chromosome 2 at 93,856,944 bp
  • T to C, chromosome 2 at 104,786,574 bp
  • T to C, chromosome 2 at 119,402,396 bp
  • CGAGGAGGAGGAGGA to CGAGGAGGAGGAGGAGGA, chromosome 2 at 148,395,551 bp
  • T to C, chromosome 3 at 15,548,757 bp
  • C to T, chromosome 3 at 37,528,268 bp
  • C to T, chromosome 3 at 41,657,275 bp
  • T to A, chromosome 3 at 63,300,281 bp
  • T to C, chromosome 3 at 80,706,945 bp
  • T to C, chromosome 3 at 88,925,326 bp
  • T to C, chromosome 3 at 94,435,085 bp
  • G to T, chromosome 3 at 116,489,282 bp
  • G to T, chromosome 3 at 122,803,032 bp
  • T to A, chromosome 3 at 152,238,304 bp
  • A to T, chromosome 4 at 104,945,324 bp
  • G to T, chromosome 4 at 111,893,169 bp
  • A to G, chromosome 4 at 115,525,505 bp
  • G to A, chromosome 5 at 72,316,106 bp
  • G to T, chromosome 5 at 109,173,714 bp
  • A to T, chromosome 5 at 109,940,498 bp
  • A to G, chromosome 5 at 125,847,978 bp
  • C to A, chromosome 5 at 144,884,711 bp
  • G to A, chromosome 6 at 17,834,674 bp
  • A to T, chromosome 6 at 29,927,624 bp
  • T to A, chromosome 6 at 72,328,687 bp
  • G to T, chromosome 6 at 85,817,653 bp
  • A to C, chromosome 6 at 102,265,334 bp
  • A to C, chromosome 6 at 115,278,352 bp
  • G to A, chromosome 6 at 125,105,276 bp
  • T to C, chromosome 7 at 19,151,322 bp
  • A to G, chromosome 7 at 27,197,117 bp
  • A to T, chromosome 7 at 42,708,419 bp
  • A to G, chromosome 7 at 46,108,838 bp
  • T to C, chromosome 7 at 102,023,348 bp
  • A to T, chromosome 7 at 109,982,763 bp
  • T to G, chromosome 7 at 122,988,724 bp
  • T to C, chromosome 7 at 127,797,248 bp
  • C to T, chromosome 7 at 128,285,136 bp
  • A to T, chromosome 8 at 4,269,992 bp
  • A to T, chromosome 8 at 39,130,793 bp
  • T to A, chromosome 8 at 71,968,059 bp
  • A to T, chromosome 8 at 72,378,992 bp
  • A to T, chromosome 8 at 95,368,184 bp
  • A to T, chromosome 8 at 104,952,523 bp
  • T to A, chromosome 9 at 22,504,074 bp
  • G to T, chromosome 9 at 44,402,097 bp
  • T to A, chromosome 9 at 81,631,801 bp
  • A to C, chromosome 9 at 85,720,863 bp
  • T to C, chromosome 9 at 90,227,443 bp
  • GT to GTT, chromosome 9 at 118,559,057 bp
  • C to T, chromosome 9 at 121,748,606 bp
  • A to T, chromosome 10 at 69,920,461 bp
  • A to T, chromosome 11 at 76,213,401 bp
  • A to T, chromosome 11 at 87,614,078 bp
  • ACAGCAGCAGCAGCAGCAGCAGCAGCA to ACAGCAGCAGCAGCAGCAGCAGCA, chromosome 11 at 94,214,452 bp
  • A to G, chromosome 11 at 96,320,231 bp
  • G to T, chromosome 12 at 71,164,546 bp
  • A to T, chromosome 12 at 71,164,547 bp
  • T to C, chromosome 12 at 117,721,329 bp
  • A to T, chromosome 13 at 59,716,672 bp
  • A to G, chromosome 14 at 49,929,536 bp
  • T to C, chromosome 14 at 61,206,100 bp
  • C to T, chromosome 14 at 103,173,814 bp
  • A to T, chromosome 14 at 121,610,182 bp
  • A to G, chromosome 15 at 100,645,405 bp
  • T to A, chromosome 16 at 93,793,226 bp
  • A to T, chromosome 18 at 37,401,603 bp
  • A to T, chromosome 18 at 37,670,552 bp
  • A to G, chromosome 18 at 84,632,013 bp
  • G to A, chromosome 19 at 4,131,229 bp
  • C to A, chromosome 19 at 9,893,364 bp
  • C to A, chromosome 19 at 37,330,456 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5502 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The submitter or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043063-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.