Strain Name:
C57BL/6J-MtgxR5513Btlr/Mmmh
Stock Number:
043073-MU
Citation ID:
RRID:MMRRC_043073-MU
Other Names:
R5513 (G1), C57BL/6J-MtgxR5513Btlr
Major Collection:

Strain Information

Cd74
Name: CD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated)
Synonyms: Ii, CLIP
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16149
VEGA: 18
HGNC: HGNC:1697
Homologene: 3209
Lasp1
Name: LIM and SH3 protein 1
Synonyms: Def-4, SH3P6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16796
HGNC: HGNC:6513
Homologene: 4480
Sae1
Name: SUMO1 activating enzyme subunit 1
Synonyms: 2400010M20Rik, SUMO-1 activating enzyme subunit 1, HSPC140, 2610044L12Rik, AOS1, D7Ertd177e, Uble1a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56459
Homologene: 4019
Prdm2
Name: PR domain containing 2, with ZNF domain
Synonyms: Riz1, Riz, 4833427P12Rik, E330024L24Rik, KMT8, LOC381568
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 110593
HGNC: HGNC:9347
Homologene: 40822
Dab2ip
Name: disabled 2 interacting protein
Synonyms: 2310011D08Rik, AIP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69601
Homologene: 13058
Lrba
Name: LPS-responsive beige-like anchor
Synonyms: Lba, D3Ertd775e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80877
HGNC: HGNC:1742
Homologene: 36205
Etl4
Name: enhancer trap locus 4
Synonyms: 9430077C05Rik, Skt, E330027G05Rik, Etl-4, 6620402G01Rik, Sickle tail
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 208618
Homologene: 10477
Ankrd11
Name: ankyrin repeat domain 11
Synonyms: 2410104C19Rik, 9530048I21Rik, 3010027A04Rik, Yod
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 77087
Homologene: 69134
Relch
Name: RAB11 binding and LisH domain, coiled-coil and HEAT repeat containing
Synonyms: 2310035C23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227446
Homologene: 10834
Ints8
Name: integrator complex subunit 8
Synonyms: 2810013E07Rik, D130008D20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72656
Homologene: 9888
Aspm
Name: abnormal spindle microtubule assembly
Synonyms: Aspm, Sha1, Calmbp1, MCPH5, D330028K02Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12316
Homologene: 7650
Camsap2
Name: calmodulin regulated spectrin-associated protein family, member 2
Synonyms: Camsap1l1, 1600013L13Rik, 4930541M15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67886
Homologene: 18927
Mki67
Name: antigen identified by monoclonal antibody Ki 67
Synonyms: Ki-67, D630048A14Rik, Ki67
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17345
HGNC: HGNC:7107
Homologene: 1814
Senp3
Name: SUMO/sentrin specific peptidase 3
Synonyms: Smt3ip1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 80886
Homologene: 9236
Sdhaf2
Name: succinate dehydrogenase complex assembly factor 2
Synonyms: 0610038F07Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66072
VEGA: 19
Homologene: 32370
Zfp960
Name: zinc finger protein 960
Synonyms: BC018101
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 449000
Homologene: 133884
Chpf
Name: chondroitin polymerizing factor
Synonyms: D1Bwg1363e, 1700028N03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74241
Homologene: 11574
Ampd2
Name: adenosine monophosphate deaminase 2
Synonyms: Ampd-2, 1200014F01Rik, m4521Dajl
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109674
HGNC: HGNC:469
Homologene: 2979
Mcm4
Name: minichromosome maintenance complex component 4
Synonyms: 19G, Mcmd4, Cdc21, mCdc21
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17217
VEGA: 16
HGNC: HGNC:6947
Homologene: 40496
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: P1-Loop, Hst6.7b, Dnahc8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Tom1
Name: target of myb1 trafficking protein
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 21968
Homologene: 88453
Zfp236
Name: zinc finger protein 236
Synonyms: LOC240456
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 329002
Homologene: 7198
Plvap
Name: plasmalemma vesicle associated protein
Synonyms: PV-1, MECA32
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 84094
Homologene: 10578
Cd22
Name: CD22 antigen
Synonyms: Lyb-8, Lyb8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12483
HGNC: HGNC:1643
Homologene: 31052
Slc35e2
Name: solute carrier family 35, member E2
Synonyms: A530082C11Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320541
Homologene: 84987
Crb1
Name: crumbs family member 1, photoreceptor morphogenesis associated
Synonyms: 7530426H14Rik, A930008G09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 170788
HGNC: HGNC:2343
Homologene: 8092
Dnah6
Name: dynein, axonemal, heavy chain 6
Synonyms: Dnahc6, A730004I20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330355
HGNC: HGNC:2951
Homologene: 15221
Rbm15b
Name: RNA binding motif protein 15B
Synonyms: 1810017N16Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 109095
Homologene: 8325
Col27a1
Name: collagen, type XXVII, alpha 1
Synonyms: 5730512J02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 373864
Homologene: 69400
Hivep2
Name: human immunodeficiency virus type I enhancer binding protein 2
Synonyms: Shn-2, Gm20114, Schnurri-2, MIBP1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15273
HGNC: HGNC:4921
Homologene: 4900
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241516
Homologene: 110349
Arhgef5
Name: Rho guanine nucleotide exchange factor 5
Synonyms: 2210412D05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54324
Homologene: 66300
Pld4
Name: phospholipase D family member 4
Synonyms: thss
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104759
VEGA: 12
Homologene: 16350
Abtb2
Name: ankyrin repeat and BTB domain containing 2
Synonyms: BPOZ-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99382
Homologene: 15904
Rhbdl3
Name: rhomboid like 3
Synonyms: Rhbdl4, Ventrhoid, Vrho
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 246104
Homologene: 34700
Alppl2
Name: alkaline phosphatase, placental-like 2
Synonyms: Akp5, D1Ertd816e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11650
Homologene: 129600
Itprid1
Name: ITPR interacting domain containing 1
Synonyms: Ccdc129, D530004J12Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232016
Homologene: 52344
Slc46a1
Name: solute carrier family 46, member 1
Synonyms: D11Ertd18e, heme carrier protein 1, PCFT, HCP1, 1110002C08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 52466
Homologene: 41693
Ano2
Name: anoctamin 2
Synonyms: Tmem16b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243634
HGNC: HGNC:1183
Homologene: 23221
Zfp709
Name: zinc finger protein 709
Synonyms: GIOT-4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 236193
Homologene: 136795
Or52n3
Name: olfactory receptor family 52 subfamily N member 3
Synonyms: Olfr665, GA_x6K02T2PBJ9-7509539-7510489, MOR34-7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258810
Homologene: 110477
Ppig
Name: peptidyl-prolyl isomerase G (cyclophilin G)
Synonyms: SRCyp, B230312B02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228005
Homologene: 3520
Cyp2c68
Name: cytochrome P450, family 2, subfamily c, polypeptide 68
Synonyms: 9030012A22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 433247
Homologene: 74936
Or5a3
Name: olfactory receptor family 5 subfamily A member 3
Synonyms: Olfr1441, GA_x6K02T2RE5P-2753221-2754177, MOR215-2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258678
Homologene: 17343
Or4d6
Name: olfactory receptor family 4 subfamily D member 6
Synonyms: GA_x6K02T2RE5P-2468394-2467450, Olfr1428, MOR239-5
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258673
Homologene: 17339
Akr1b1
Name: aldo-keto reductase family 1 member B
Synonyms: Ahr1, Akr1b3, Aldor1, Ahr-1, ALR2, AR, Aldr1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11677
HGNC: HGNC:381
Homologene: 133743
Gm12689
Name: predicted gene 12689
Type: Gene
Species: Mouse
Chromosome: 4
Lrrc8b
Name: leucine rich repeat containing 8 family, member B
Synonyms: 2210408K08Rik, R75581
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 433926
Homologene: 9103
Cts7
Name: cathepsin 7
Synonyms: Epcs71, Epcs24, CTS1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56092
VEGA: 13
Homologene: 75110
Vmn1r11
Name: vomeronasal 1 receptor 11
Synonyms: V1rc3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113860
Homologene: 128345
Or9s13
Name: olfactory receptor family 9 subfamily S member 13
Synonyms: MOR208-5, Olfr12, GA_x6K02T2R7CC-81134096-81133095
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 257890
Homologene: 114777
Cidec
Name: cell death-inducing DFFA-like effector c
Synonyms: CIDE-3, Fsp27, CIDE-3alpha
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14311
Homologene: 11128
Cfap73
Name: cilia and flagella associated protein 73
Synonyms: Ccdc42b, Gm5988
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 546886
Homologene: 53205
Gm21276
Name: predicted gene, 21276
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 100861861
RP23-123I10.3
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Gm4409
Name: predicted gene 4409
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 75,475,834 bp
  • T to A, chromosome 1 at 87,087,338 bp
  • T to C, chromosome 1 at 92,620,380 bp
  • G to A, chromosome 1 at 105,750,973 bp
  • A to T, chromosome 1 at 136,280,863 bp
  • C to T, chromosome 1 at 139,236,821 bp
  • A to T, chromosome 1 at 139,482,398 bp
  • C to A, chromosome 2 at 20,743,827 bp
  • A to T, chromosome 2 at 35,710,254 bp
  • A to G, chromosome 2 at 69,750,359 bp
  • G to T, chromosome 2 at 82,950,908 bp
  • C to G, chromosome 2 at 82,950,912 bp
  • T to A, chromosome 2 at 82,985,198 bp
  • A to T, chromosome 2 at 103,709,278 bp
  • C to T, chromosome 3 at 86,542,641 bp
  • A to G, chromosome 3 at 108,075,667 bp
  • A to G, chromosome 4 at 11,248,303 bp
  • A to G, chromosome 4 at 63,331,344 bp
  • T to C, chromosome 4 at 99,296,165 bp
  • GCTCCTCCTCCTCCTCCTCCTCCTC to GCTCCTCCTCCTCCTCCTCCTC, chromosome 4 at 143,135,893 bp
  • C to T, chromosome 4 at 155,610,026 bp
  • A to G, chromosome 5 at 105,485,984 bp
  • A to T, chromosome 5 at 120,631,712 bp
  • C to A, chromosome 6 at 34,316,646 bp
  • A to G, chromosome 6 at 43,272,339 bp
  • A to T, chromosome 6 at 55,897,999 bp
  • A to T, chromosome 6 at 57,137,632 bp
  • G to A, chromosome 6 at 67,556,014 bp
  • T to C, chromosome 6 at 73,190,419 bp
  • C to A, chromosome 6 at 80,022,773 bp
  • A to T, chromosome 6 at 113,428,179 bp
  • A to C, chromosome 6 at 126,039,322 bp
  • T to C, chromosome 7 at 16,366,856 bp
  • C to T, chromosome 7 at 30,867,025 bp
  • G to A, chromosome 7 at 38,768,067 bp
  • A to T, chromosome 7 at 104,881,499 bp
  • A to G, chromosome 7 at 135,707,750 bp
  • T to C, chromosome 8 at 71,511,529 bp
  • A to T, chromosome 8 at 71,890,056 bp
  • T to A, chromosome 8 at 75,057,220 bp
  • T to C, chromosome 8 at 122,892,520 bp
  • A to G, chromosome 9 at 106,886,117 bp
  • A to T, chromosome 10 at 14,132,673 bp
  • T to C, chromosome 11 at 69,677,139 bp
  • T to C, chromosome 11 at 78,466,550 bp
  • T to C, chromosome 11 at 80,331,842 bp
  • T to C, chromosome 11 at 97,799,853 bp
  • A to G, chromosome 12 at 112,762,554 bp
  • T to C, chromosome 13 at 61,355,584 bp
  • T to A, chromosome 16 at 15,630,514 bp
  • C to T, chromosome 17 at 17,087,734 bp
  • T to A, chromosome 17 at 30,752,916 bp
  • T to C, chromosome 18 at 60,811,305 bp
  • A to G, chromosome 18 at 82,658,022 bp
  • C to T, chromosome 19 at 10,517,030 bp
  • A to G, chromosome 19 at 12,109,381 bp
  • G to A, chromosome 19 at 12,422,683 bp
  • A to T, chromosome 19 at 39,703,406 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5513 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043073-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.