Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5513Btlr/Mmmh
Stock Number:
043073-MU
Citation ID:
RRID:MMRRC_043073-MU
Other Names:
R5513 (G1), C57BL/6J-MtgxR5513Btlr
Major Collection:

Strain Information

Cd74
Name: CD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated)
Synonyms: CLIP, Ii
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16149
VEGA: 18
HGNC: HGNC:1697
Homologene: 3209
Lasp1
Name: LIM and SH3 protein 1
Synonyms: SH3P6, Def-4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16796
HGNC: HGNC:6513
Homologene: 4480
Sae1
Name: SUMO1 activating enzyme subunit 1
Synonyms: 2400010M20Rik, 2610044L12Rik, SUMO-1 activating enzyme subunit 1, HSPC140, AOS1, D7Ertd177e, Uble1a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56459
Homologene: 4019
Prdm2
Name: PR domain containing 2, with ZNF domain
Synonyms: Riz, Riz1, LOC381568, E330024L24Rik, 4833427P12Rik, KMT8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 110593
HGNC: HGNC:9347
Homologene: 40822
Dab2ip
Name: disabled 2 interacting protein
Synonyms: 2310011D08Rik, AIP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69601
Homologene: 13058
Lrba
Name: LPS-responsive beige-like anchor
Synonyms: Lba, D3Ertd775e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80877
HGNC: HGNC:1742
Homologene: 36205
Etl4
Name: enhancer trap locus 4
Synonyms: Etl-4, E330027G05Rik, 6620402G01Rik, 9430077C05Rik, Skt, Sickle tail
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 208618
Homologene: 10477
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 75,475,834 bp
  • T to A, chromosome 1 at 87,087,338 bp
  • T to C, chromosome 1 at 92,620,380 bp
  • G to A, chromosome 1 at 105,750,973 bp
  • A to T, chromosome 1 at 136,280,863 bp
  • C to T, chromosome 1 at 139,236,821 bp
  • A to T, chromosome 1 at 139,482,398 bp
  • C to A, chromosome 2 at 20,743,827 bp
  • A to T, chromosome 2 at 35,710,254 bp
  • A to G, chromosome 2 at 69,750,359 bp
  • G to T, chromosome 2 at 82,950,908 bp
  • C to G, chromosome 2 at 82,950,912 bp
  • T to A, chromosome 2 at 82,985,198 bp
  • A to T, chromosome 2 at 103,709,278 bp
  • C to T, chromosome 3 at 86,542,641 bp
  • A to G, chromosome 3 at 108,075,667 bp
  • A to G, chromosome 4 at 11,248,303 bp
  • A to G, chromosome 4 at 63,331,344 bp
  • T to C, chromosome 4 at 99,296,165 bp
  • GCTCCTCCTCCTCCTCCTCCTCCTC to GCTCCTCCTCCTCCTCCTCCTC, chromosome 4 at 143,135,893 bp
  • C to T, chromosome 4 at 155,610,026 bp
  • A to G, chromosome 5 at 105,485,984 bp
  • A to T, chromosome 5 at 120,631,712 bp
  • C to A, chromosome 6 at 34,316,646 bp
  • A to G, chromosome 6 at 43,272,339 bp
  • A to T, chromosome 6 at 55,897,999 bp
  • A to T, chromosome 6 at 57,137,632 bp
  • G to A, chromosome 6 at 67,556,014 bp
  • T to C, chromosome 6 at 73,190,419 bp
  • C to A, chromosome 6 at 80,022,773 bp
  • A to T, chromosome 6 at 113,428,179 bp
  • A to C, chromosome 6 at 126,039,322 bp
  • T to C, chromosome 7 at 16,366,856 bp
  • C to T, chromosome 7 at 30,867,025 bp
  • G to A, chromosome 7 at 38,768,067 bp
  • A to T, chromosome 7 at 104,881,499 bp
  • A to G, chromosome 7 at 135,707,750 bp
  • T to C, chromosome 8 at 71,511,529 bp
  • A to T, chromosome 8 at 71,890,056 bp
  • T to A, chromosome 8 at 75,057,220 bp
  • T to C, chromosome 8 at 122,892,520 bp
  • A to G, chromosome 9 at 106,886,117 bp
  • A to T, chromosome 10 at 14,132,673 bp
  • T to C, chromosome 11 at 69,677,139 bp
  • T to C, chromosome 11 at 78,466,550 bp
  • T to C, chromosome 11 at 80,331,842 bp
  • T to C, chromosome 11 at 97,799,853 bp
  • A to G, chromosome 12 at 112,762,554 bp
  • T to C, chromosome 13 at 61,355,584 bp
  • T to A, chromosome 16 at 15,630,514 bp
  • C to T, chromosome 17 at 17,087,734 bp
  • T to A, chromosome 17 at 30,752,916 bp
  • T to C, chromosome 18 at 60,811,305 bp
  • A to G, chromosome 18 at 82,658,022 bp
  • C to T, chromosome 19 at 10,517,030 bp
  • A to G, chromosome 19 at 12,109,381 bp
  • G to A, chromosome 19 at 12,422,683 bp
  • A to T, chromosome 19 at 39,703,406 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5513 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The submitter or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043073-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.