Strain Name:
C57BL/6J-MtgxR5540Btlr/Mmmh
Stock Number:
043098-MU
Citation ID:
RRID:MMRRC_043098-MU
Other Names:
R5540 (G1), C57BL/6J-MtgxR5540Btlr
Major Collection:

Gene Information

Apobec3
Name: apolipoprotein B mRNA editing enzyme, catalytic polypeptide 3
Synonyms: CEM15, Gm20117, Rfv3, Rfv-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 80287
Homologene: 105420
Ptpn14
Name: protein tyrosine phosphatase, non-receptor type 14
Synonyms: PTP36, C130080N23Rik, OTTMUSG00000022087
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 19250
HGNC: HGNC:9647
Homologene: 3941
Kdm5b
Name: lysine (K)-specific demethylase 5B
Synonyms: PLU-1, Jarid1b, 2010009J12Rik, Rb-Bp2, D1Ertd202e, Plu1, 2210016I17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 75605
Homologene: 48448
Hdac5
Name: histone deacetylase 5
Synonyms: mHDA1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 15184
Homologene: 3995
Stk24
Name: serine/threonine kinase 24
Synonyms: STE20, 1810013H02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 223255
VEGA: 14
Homologene: 20793
Mtor
Name: mechanistic target of rapamycin kinase
Synonyms: 2610315D21Rik, FKBP-rapamycin-associated protein FRAP, Frap1, RAPT1, RAFT1, mechanistic target of rapamycin (serine/threonine kinase), flat
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 56717
HGNC: HGNC:3942
Homologene: 3637
Eif4g2
Name: eukaryotic translation initiation factor 4, gamma 2
Synonyms: E130105L11Rik, Nat1, DAP-5, Natm1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 13690
HGNC: HGNC:3297
Homologene: 37477
Morc3
Name: microrchidia 3
Synonyms: 1110051N18Rik, 1110051N18Rik, Zcwcc3, D16Jhu32e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 338467
Homologene: 32257
Wdr59
Name: WD repeat domain 59
Synonyms: 5430401O09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 319481
Homologene: 38685
Washc4
Name: WASH complex subunit 4
Synonyms: A230046K03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 319277
VEGA: 10
Homologene: 123926
Ambra1
Name: autophagy/beclin 1 regulator 1
Synonyms: D030051N19Rik, 2310079H06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 228361
Homologene: 18204
Arid1a
Name: AT rich interactive domain 1A (SWI-like)
Synonyms: Osa1, Smarcf1, 1110030E03Rik, BAF250a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 93760
Homologene: 21216
Kif20b
Name: kinesin family member 20B
Synonyms: Kif20b, Mphosph1, magoo, C330014J10Rik, N-6 kinesin, 33cex
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 240641
VEGA: 19
HGNC: HGNC:7212
Homologene: 9418
Adgrl2
Name: adhesion G protein-coupled receptor L2
Synonyms: Lphh1, Lec1, Lphn2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 99633
Homologene: 22712
Traf3ip1
Name: TRAF3 interacting protein 1
Synonyms: MIP-T3, 3930402D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 74019
Homologene: 22913
Fbxo38
Name: F-box protein 38
Synonyms: 6030410I24Rik, SP329
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 107035
VEGA: 18
Homologene: 34526
Dyrk1a
Name: dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1a
Synonyms: 2310043O08Rik, D16Ertd493e, Mnbh, D16Ertd272e, Dyrk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 13548
HGNC: HGNC:3091
Homologene: 55576
Dync1h1
Name: dynein cytoplasmic 1 heavy chain 1
Synonyms: Dnec1, dynein heavy chain, retrograde transport, MAP1C, 9930018I23Rik, Swl, Loa, Dnchc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 13424
HGNC: HGNC:2961
Homologene: 1053
Rnpc3
Name: RNA-binding region (RNP1, RRM) containing 3
Synonyms: C030014B17Rik, 2810441O16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 67225
Homologene: 9746
Dmxl2
Name: Dmx-like 2
Synonyms: E130119P06Rik, 6430411K14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 235380
HGNC: HGNC:2938
Homologene: 41022
Scube1
Name: signal peptide, CUB domain, EGF-like 1
Synonyms: A630023E24Rik, 7330410C13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 64706
Homologene: 11224
Crebrf
Name: CREB3 regulatory factor
Synonyms: A930001N09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 77128
Homologene: 12672
Fndc3b
Name: fibronectin type III domain containing 3B
Synonyms: 1600019O04Rik, fad104
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 72007
Homologene: 11244
Nbeal2
Name: neurobeachin-like 2
Synonyms: 1110014F23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 235627
Homologene: 86422
Grik4
Name: glutamate receptor, ionotropic, kainate 4
Synonyms: GluRgamma1, 6330551K01Rik, KA1, KA-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 110637
HGNC: HGNC:4582
Homologene: 81829
Celf2
Name: CUGBP, Elav-like family member 2
Synonyms: B230345P09Rik, Cugbp2, Napor-2, ETR-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 14007
HGNC: HGNC:2550
Homologene: 4783
Stk11
Name: serine/threonine kinase 11
Synonyms: Par-4, Lkb1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 20869
Homologene: 393
Asph
Name: aspartate-beta-hydroxylase
Synonyms: Junctin, cI-37, junctate, calsequestrin-binding protein, aspartyl beta-hydroxylase, 3110001L23Rik, jumbug, 2310005F16Rik, BAH
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 65973
HGNC: HGNC:757
Homologene: 20910
Mis18bp1
Name: MIS18 binding protein 1
Synonyms: C79407
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 217653
Homologene: 10147
Trhde
Name: TRH-degrading enzyme
Synonyms: 9330155P21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 237553
Homologene: 75007
Akr1c18
Name: aldo-keto reductase family 1, member C18
Synonyms: 20alpha-hydroxysteroid dehydrogenase, 20alpha-HSD
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 105349
HGNC: HGNC:386
Homologene: 128661
Rusc2
Name: RUN and SH3 domain containing 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 100213
Homologene: 18967
Myh8
Name: myosin, heavy polypeptide 8, skeletal muscle, perinatal
Synonyms: Myhs-p, 4832426G23Rik, Myhsp, MyHC-pn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 17885
HGNC: HGNC:7578
Homologene: 68256
Fam71b
Name: family with sequence similarity 71, member B
Synonyms: OTTMUSG00000005491
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 432552
Homologene: 51067
Stab2
Name: stabilin 2
Synonyms: STAB-2, FEEL-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 192188
Homologene: 23022
Rnasel
Name: ribonuclease L (2', 5'-oligoisoadenylate synthetase-dependent)
Synonyms: 2-5A-dependent RNAase, E230029I04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 24014
Homologene: 8040
Ephb3
Name: Eph receptor B3
Synonyms: HEK2, Sek4, MDK5, Etk2, Cek10, Tyro6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 13845
HGNC: HGNC:3394
Homologene: 20938
Pqlc2
Name: PQ loop repeat containing 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 212555
Homologene: 56784
Myo7b
Name: myosin VIIB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 17922
HGNC: HGNC:7607
Homologene: 81947
Flg
Name: filaggrin
Synonyms: ft, profilaggrin, fillagrin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 14246
VEGA: 3
HGNC: null
Homologene: null
Actl7a
Name: actin-like 7a
Synonyms: t-actin 2, Tact2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 11470
HGNC: HGNC:161
Homologene: 7613
Aox1
Name: aldehyde oxidase 1
Synonyms: Aox2, Aox-2, retinal oxidase, Aox-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 11761
HGNC: HGNC:553
Homologene: 68165
Phactr1
Name: phosphatase and actin regulator 1
Synonyms: 9630030F18Rik, Rpel1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 218194
Homologene: 33597
Col6a5
Name: collagen, type VI, alpha 5
Synonyms: Gm7455, Col6a5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 665033
Homologene: 122792
Alpk3
Name: alpha-kinase 3
Synonyms: Midori
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 116904
Homologene: 10813
Slc24a1
Name: solute carrier family 24 (sodium/potassium/calcium exchanger), member 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 214111
VEGA: 9
Homologene: 3472
Shcbp1
Name: Shc SH2-domain binding protein 1
Synonyms: mPAL
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 20419
Homologene: 32123
Spag17
Name: sperm associated antigen 17
Synonyms: 4931427F14Rik, PF6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 74362
Homologene: 52601
Myom1
Name: myomesin 1
Synonyms: skelemin, D430047A17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 17929
VEGA: 17
HGNC: HGNC:7613
Homologene: 31196
Me1
Name: malic enzyme 1, NADP(+)-dependent, cytosolic
Synonyms: D9Ertd267e, Mod1, Mod-1, Mdh-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 17436
HGNC: HGNC:6983
Homologene: 134785
Npc1l1
Name: NPC1 like intracellular cholesterol transporter 1
Synonyms: Niemann-Pick disease, type C1, 9130221N23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 237636
HGNC: HGNC:7898
Homologene: 56585
Hpx
Name: hemopexin
Synonyms: Hpxn, hx
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 15458
HGNC: HGNC:5171
Homologene: 511
Gm5828
Name: predicted gene 5828
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 545306
HGNC: null
Homologene: null
Adam26b
Name: a disintegrin and metallopeptidase domain 26B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 382007
HGNC: null
Homologene: 128363
Slc26a7
Name: solute carrier family 26, member 7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 208890
Homologene: 13770
Pde6a
Name: phosphodiesterase 6A, cGMP-specific, rod, alpha
Synonyms: Pdea
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 225600
HGNC: HGNC:8785
Homologene: 380
Olfr561
Name: olfactory receptor 561
Synonyms: MOR14-2, GA_x6K02T2PBJ9-5491151-5492095
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 259096
HGNC: null
Homologene: 133029
Tmem256
Name: transmembrane protein 256
Synonyms: 1810027O10Rik, 3110009M16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 69186
Homologene: 45148
Serpinb6b
Name: serine (or cysteine) peptidase inhibitor, clade B, member 6b
Synonyms: ovalbumin, NK13, Spi12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 20708
HGNC: HGNC:8950
Homologene: 22633
Olfr765
Name: olfactory receptor 765
Synonyms: MOR115-4, GA_x6K02T2PULF-10732607-10731678
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 544748
Homologene: 105186
Tbx4
Name: T-box 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 21387
Homologene: 7968
Tmtc4
Name: transmembrane and tetratricopeptide repeat containing 4
Synonyms: 5730419O14Rik, 4930403J22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 70551
Homologene: 32796
Chrnb1
Name: cholinergic receptor, nicotinic, beta polypeptide 1 (muscle)
Synonyms: Acrb, Achr-2, AChR beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 11443
HGNC: HGNC:1961
Homologene: 594
Olfr1431
Name: olfactory receptor 1431
Synonyms: MOR214-5, GA_x6K02T2RE5P-2573738-2574676
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 258409
HGNC: null
Homologene: 115495
Vps16
Name: VSP16 CORVET/HOPS core subunit
Synonyms: 1810074M16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 80743
Homologene: 7116
Olfr463
Name: olfactory receptor 463
Synonyms: MOR240-1, GA_x6K02T2PAEV-9540823-9539888
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 258408
HGNC: HGNC:8294
Homologene: 64870
Olfr48
Name: olfactory receptor 48
Synonyms: MOR232-5, GA_x6K02T2Q125-51285881-51284976, IC3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 18347
HGNC: null
Homologene: 85936
Rsph3a
Name: radial spoke 3A homolog (Chlamydomonas)
Synonyms: Rshl2a, Rshl2, 1700012G05Rik, 4930524H12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 66832
VEGA: 17
Homologene: 12043
Paqr5
Name: progestin and adipoQ receptor family member V
Synonyms: mPRg, 0610010I15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 74090
Homologene: 9788
Map3k9
Name: mitogen-activated protein kinase kinase kinase 9
Synonyms: Mlk1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 338372
VEGA: 12
HGNC: HGNC:6861
Homologene: 76377
Akr1b10
Name: aldo-keto reductase family 1, member B10 (aldose reductase)
Synonyms: 2310005E10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 67861
Homologene: 128412
Tmem225
Name: transmembrane protein 225
Synonyms: 1700030E15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 75667
VEGA: 9
Homologene: 52854
Cd300ld
Name: CD300 molecule like family member d
Synonyms: Cd300ld1, MAIR-IV, Clm5, 4732429D16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 217305
Homologene: 129719
Fpr-rs7
Name: formyl peptide receptor, related sequence 7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 321021
HGNC: null
Homologene: null
Wdr81
Name: WD repeat domain 81
Synonyms: shakey 5, MGC32441, nur5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 192652
Homologene: 13983
Gfi1
Name: growth factor independent 1 transcription repressor
Synonyms: Pal1, Pal-1, Gfi-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 14581
HGNC: HGNC:4237
Homologene: 3854
Tnfrsf4
Name: tumor necrosis factor receptor superfamily, member 4
Synonyms: ACT35, Txgp1, CD134, Ox40
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 22163
Homologene: 2496
Vash1
Name: vasohibin 1
Synonyms: G630009D10Rik, D930046M13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 238328
Homologene: 8941
1700008O03Rik
Name: RIKEN cDNA 1700008O03 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 69349
Homologene: 19260
Pcdha4
Name: protocadherin alpha 4
Synonyms: Cnr1, Crnr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 12936
HGNC: HGNC:8670
Homologene: 130626
Gm5329
Name: predicted gene 5329
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 102633076
HGNC: null
Homologene: null
Pcdhga8
Name: protocadherin gamma subfamily A, 8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 93716
HGNC: HGNC:8706
Homologene: 57162
Gm3956
Name: predicted gene 3956
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 100042673
HGNC: null
Homologene: null
RP23-227D7.10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
4930481A15Rik
Name: RIKEN cDNA 4930481A15 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 74931
HGNC: null
Homologene: null
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 16,769,292 bp
  • A to G, chromosome 1 at 58,104,410 bp
  • G to A, chromosome 1 at 91,501,315 bp
  • A to G, chromosome 1 at 134,631,241 bp
  • G to T, chromosome 1 at 153,755,144 bp
  • A to T, chromosome 1 at 189,846,364 bp
  • T to C, chromosome 2 at 6,553,932 bp
  • A to G, chromosome 2 at 89,844,667 bp
  • A to G, chromosome 2 at 91,773,025 bp
  • T to A, chromosome 2 at 130,442,385 bp
  • G to A, chromosome 3 at 27,501,502 bp
  • T to C, chromosome 3 at 93,277,616 bp
  • A to C, chromosome 3 at 100,056,272 bp
  • A to T, chromosome 3 at 113,628,341 bp
  • G to T, chromosome 3 at 148,827,518 bp
  • A to G, chromosome 3 at 148,837,562 bp
  • A to G, chromosome 4 at 9,635,906 bp
  • A to G, chromosome 4 at 14,506,621 bp
  • A to G, chromosome 4 at 43,423,975 bp
  • A to T, chromosome 4 at 56,744,388 bp
  • A to C, chromosome 4 at 133,680,454 bp
  • A to T, chromosome 4 at 139,300,344 bp
  • A to G, chromosome 4 at 148,454,708 bp
  • C to T, chromosome 4 at 156,013,923 bp
  • A to T, chromosome 5 at 87,486,056 bp
  • T to A, chromosome 5 at 107,720,125 bp
  • A to G, chromosome 6 at 34,394,112 bp
  • G to A, chromosome 7 at 8,667,574 bp
  • T to A, chromosome 7 at 31,972,444 bp
  • A to G, chromosome 7 at 44,362,947 bp
  • G to A, chromosome 7 at 81,095,436 bp
  • C to T, chromosome 7 at 102,774,929 bp
  • A to G, chromosome 7 at 105,591,912 bp
  • A to G, chromosome 7 at 111,080,860 bp
  • A to T, chromosome 8 at 4,744,529 bp
  • C to A, chromosome 8 at 43,521,617 bp
  • A to G, chromosome 8 at 111,485,184 bp
  • T to C, chromosome 9 at 40,149,385 bp
  • T to C, chromosome 9 at 42,520,947 bp
  • A to T, chromosome 9 at 54,393,857 bp
  • T to C, chromosome 9 at 61,963,788 bp
  • A to G, chromosome 9 at 64,948,581 bp
  • A to G, chromosome 9 at 86,679,873 bp
  • T to A, chromosome 9 at 105,862,776 bp
  • A to T, chromosome 9 at 110,631,733 bp
  • A to G, chromosome 10 at 80,126,049 bp
  • A to G, chromosome 10 at 83,573,793 bp
  • A to G, chromosome 10 at 86,848,125 bp
  • C to T, chromosome 10 at 92,972,608 bp
  • T to A, chromosome 10 at 114,800,592 bp
  • G to T, chromosome 10 at 129,046,495 bp
  • A to G, chromosome 11 at 6,214,546 bp
  • A to G, chromosome 11 at 46,404,888 bp
  • C to A, chromosome 11 at 67,286,440 bp
  • A to T, chromosome 11 at 69,795,650 bp
  • A to T, chromosome 11 at 69,839,336 bp
  • T to C, chromosome 11 at 75,449,070 bp
  • A to T, chromosome 11 at 85,911,168 bp
  • T to A, chromosome 11 at 87,893,685 bp
  • T to C, chromosome 11 at 102,198,971 bp
  • T to A, chromosome 11 at 114,987,405 bp
  • T to C, chromosome 12 at 65,148,746 bp
  • G to T, chromosome 12 at 81,772,813 bp
  • ACTGCTGCTGCTGCTGCTGC to ACTGCTGCTGCTGCTGC, chromosome 12 at 86,680,057 bp
  • A to G, chromosome 12 at 110,660,950 bp
  • A to G, chromosome 13 at 4,137,179 bp
  • A to T, chromosome 13 at 32,977,558 bp
  • G to T, chromosome 13 at 42,956,774 bp
  • T to C, chromosome 14 at 121,294,281 bp
  • A to G, chromosome 14 at 122,933,129 bp
  • T to A, chromosome 15 at 79,897,919 bp
  • T to G, chromosome 15 at 83,616,666 bp
  • T to A, chromosome 16 at 21,220,860 bp
  • T to A, chromosome 16 at 93,847,380 bp
  • T to G, chromosome 16 at 94,685,343 bp
  • T to G, chromosome 17 at 7,945,958 bp
  • C to T, chromosome 17 at 20,114,094 bp
  • A to G, chromosome 17 at 26,742,097 bp
  • G to A, chromosome 17 at 71,109,787 bp
  • A to G, chromosome 18 at 32,007,090 bp
  • C to A, chromosome 18 at 36,954,837 bp
  • G to A, chromosome 18 at 37,817,908 bp
  • T to G, chromosome 18 at 61,231,366 bp
  • A to G, chromosome 18 at 62,514,793 bp
  • T to C, chromosome 19 at 5,407,026 bp
  • T to A, chromosome 19 at 12,210,460 bp
  • A to T, chromosome 19 at 34,938,460 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5540 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
043098-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.