Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5540Btlr/Mmmh
Stock Number:
043098-MU
Citation ID:
RRID:MMRRC_043098-MU
Other Names:
R5540 (G1), C57BL/6J-MtgxR5540Btlr
Major Collection:

Strain Information

Apobec3
Name: apolipoprotein B mRNA editing enzyme, catalytic polypeptide 3
Synonyms: Rfv-3, CEM15, Rfv3, Gm20117
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 80287
Homologene: 105420
Ptpn14
Name: protein tyrosine phosphatase, non-receptor type 14
Synonyms: PTP36, C130080N23Rik, OTTMUSG00000022087
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19250
HGNC: HGNC:9647
Homologene: 3941
Kdm5b
Name: lysine demethylase 5B
Synonyms: PLU-1, 2010009J12Rik, Plu1, Rb-Bp2, 2210016I17Rik, D1Ertd202e, Jarid1b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75605
Homologene: 48448
Hdac5
Name: histone deacetylase 5
Synonyms: mHDA1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15184
Homologene: 3995
Stk24
Name: serine/threonine kinase 24
Synonyms: 1810013H02Rik, STE20
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 223255
VEGA: 14
Homologene: 20793
Mtor
Name: mechanistic target of rapamycin kinase
Synonyms: FKBP-rapamycin-associated protein FRAP, 2610315D21Rik, RAPT1, RAFT1, flat, Frap1, mechanistic target of rapamycin (serine/threonine kinase)
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56717
HGNC: HGNC:3942
Homologene: 3637
Eif4g2
Name: eukaryotic translation initiation factor 4, gamma 2
Synonyms: Nat1, DAP-5, Natm1, E130105L11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13690
HGNC: HGNC:3297
Homologene: 37477
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 16,769,292 bp
  • A to G, chromosome 1 at 58,104,410 bp
  • G to A, chromosome 1 at 91,501,315 bp
  • A to G, chromosome 1 at 134,631,241 bp
  • G to T, chromosome 1 at 153,755,144 bp
  • A to T, chromosome 1 at 189,846,364 bp
  • T to C, chromosome 2 at 6,553,932 bp
  • A to G, chromosome 2 at 89,844,667 bp
  • A to G, chromosome 2 at 91,773,025 bp
  • T to A, chromosome 2 at 130,442,385 bp
  • G to A, chromosome 3 at 27,501,502 bp
  • T to C, chromosome 3 at 93,277,616 bp
  • A to C, chromosome 3 at 100,056,272 bp
  • A to T, chromosome 3 at 113,628,341 bp
  • G to T, chromosome 3 at 148,827,518 bp
  • A to G, chromosome 3 at 148,837,562 bp
  • A to G, chromosome 4 at 9,635,906 bp
  • A to G, chromosome 4 at 14,506,621 bp
  • A to G, chromosome 4 at 43,423,975 bp
  • A to T, chromosome 4 at 56,744,388 bp
  • A to C, chromosome 4 at 133,680,454 bp
  • A to T, chromosome 4 at 139,300,344 bp
  • A to G, chromosome 4 at 148,454,708 bp
  • C to T, chromosome 4 at 156,013,923 bp
  • A to T, chromosome 5 at 87,486,056 bp
  • T to A, chromosome 5 at 107,720,125 bp
  • A to G, chromosome 6 at 34,394,112 bp
  • G to A, chromosome 7 at 8,667,574 bp
  • T to A, chromosome 7 at 31,972,444 bp
  • A to G, chromosome 7 at 44,362,947 bp
  • G to A, chromosome 7 at 81,095,436 bp
  • C to T, chromosome 7 at 102,774,929 bp
  • A to G, chromosome 7 at 105,591,912 bp
  • A to G, chromosome 7 at 111,080,860 bp
  • A to T, chromosome 8 at 4,744,529 bp
  • C to A, chromosome 8 at 43,521,617 bp
  • A to G, chromosome 8 at 111,485,184 bp
  • T to C, chromosome 9 at 40,149,385 bp
  • T to C, chromosome 9 at 42,520,947 bp
  • A to T, chromosome 9 at 54,393,857 bp
  • T to C, chromosome 9 at 61,963,788 bp
  • A to G, chromosome 9 at 64,948,581 bp
  • A to G, chromosome 9 at 86,679,873 bp
  • T to A, chromosome 9 at 105,862,776 bp
  • A to T, chromosome 9 at 110,631,733 bp
  • A to G, chromosome 10 at 80,126,049 bp
  • A to G, chromosome 10 at 83,573,793 bp
  • A to G, chromosome 10 at 86,848,125 bp
  • C to T, chromosome 10 at 92,972,608 bp
  • T to A, chromosome 10 at 114,800,592 bp
  • G to T, chromosome 10 at 129,046,495 bp
  • A to G, chromosome 11 at 6,214,546 bp
  • A to G, chromosome 11 at 46,404,888 bp
  • C to A, chromosome 11 at 67,286,440 bp
  • A to T, chromosome 11 at 69,795,650 bp
  • A to T, chromosome 11 at 69,839,336 bp
  • T to C, chromosome 11 at 75,449,070 bp
  • A to T, chromosome 11 at 85,911,168 bp
  • T to A, chromosome 11 at 87,893,685 bp
  • T to C, chromosome 11 at 102,198,971 bp
  • T to A, chromosome 11 at 114,987,405 bp
  • T to C, chromosome 12 at 65,148,746 bp
  • G to T, chromosome 12 at 81,772,813 bp
  • ACTGCTGCTGCTGCTGCTGC to ACTGCTGCTGCTGCTGC, chromosome 12 at 86,680,057 bp
  • A to G, chromosome 12 at 110,660,950 bp
  • A to G, chromosome 13 at 4,137,179 bp
  • A to T, chromosome 13 at 32,977,558 bp
  • G to T, chromosome 13 at 42,956,774 bp
  • T to C, chromosome 14 at 121,294,281 bp
  • A to G, chromosome 14 at 122,933,129 bp
  • T to A, chromosome 15 at 79,897,919 bp
  • T to G, chromosome 15 at 83,616,666 bp
  • T to A, chromosome 16 at 21,220,860 bp
  • T to A, chromosome 16 at 93,847,380 bp
  • T to G, chromosome 16 at 94,685,343 bp
  • T to G, chromosome 17 at 7,945,958 bp
  • C to T, chromosome 17 at 20,114,094 bp
  • A to G, chromosome 17 at 26,742,097 bp
  • G to A, chromosome 17 at 71,109,787 bp
  • A to G, chromosome 18 at 32,007,090 bp
  • C to A, chromosome 18 at 36,954,837 bp
  • G to A, chromosome 18 at 37,817,908 bp
  • T to G, chromosome 18 at 61,231,366 bp
  • A to G, chromosome 18 at 62,514,793 bp
  • T to C, chromosome 19 at 5,407,026 bp
  • T to A, chromosome 19 at 12,210,460 bp
  • A to T, chromosome 19 at 34,938,460 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5540 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The submitter or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043098-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.