Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5546Btlr/Mmmh
Stock Number:
043104-MU
Citation ID:
RRID:MMRRC_043104-MU
Other Names:
R5546 (G1), C57BL/6J-MtgxR5546Btlr
Major Collection:

Strain Information

Ide
Name: insulin degrading enzyme
Synonyms: 1300012G03Rik, 4833415K22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 15925
HGNC: HGNC:5381
Homologene: 3645
Erbb4
Name: erb-b2 receptor tyrosine kinase 4
Synonyms: ErbB4, Her4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13869
HGNC: HGNC:3432
Homologene: 21084
Rnf111
Name: ring finger 111
Synonyms: Arkadia
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 93836
VEGA: 9
Homologene: 9741
Prkca
Name: protein kinase C, alpha
Synonyms: Pkca
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18750
HGNC: HGNC:9393
Homologene: 55679
Spop
Name: speckle-type BTB/POZ protein
Synonyms: TEF2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20747
Homologene: 68354
Ckap5
Name: cytoskeleton associated protein 5
Synonyms: 3110043H24Rik, 4930432B04Rik, D730027C18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75786
Homologene: 8844
Myh10
Name: myosin, heavy polypeptide 10, non-muscle
Synonyms: nonmuscle myosin heavy chain II-B, NMHC-B, SMemb, nonmuscle myosin heavy chain IIB, 9330167F11Rik, 5730504C04Rik, NMHC II-B, Myhn2, Myosin IIB, Myhn-2, myosin IIB, Fltn, Fltn
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77579
HGNC: HGNC:7568
Homologene: 55941
Ahctf1
Name: AT hook containing transcription factor 1
Synonyms: 6230412P20Rik, Elys
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226747
Homologene: 9142
Mtdh
Name: metadherin
Synonyms: D8Bwg1112e, 3D3/Lyric, Lyric, 2610103J23Rik, AEG-1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67154
Homologene: 12089
Zfp280d
Name: zinc finger protein 280D
Synonyms: Suhw4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235469
Homologene: 17151
Eif4enif1
Name: eukaryotic translation initiation factor 4E nuclear import factor 1
Synonyms: Clast4, 2610509L04Rik, D11Ertd166e, A930019J01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74203
Homologene: 10522
Brd1
Name: bromodomain containing 1
Synonyms: 1110059H06Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223770
HGNC: HGNC:1102
Homologene: 40956
Zfp619
Name: zinc finger protein 619
Synonyms: 3000002G13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70227
Homologene: 133818
Tcof1
Name: treacle ribosome biogenesis factor 1
Synonyms: treacle
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 21453
Homologene: 68049
Polr1a
Name: polymerase (RNA) I polypeptide A
Synonyms: mRPA1, RPA194, 194kDa, 3010014K16Rik, Rpo1-4, 2900087K15Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20019
Homologene: 7033
Usp24
Name: ubiquitin specific peptidase 24
Synonyms: 2810030C21Rik, 2700066K03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329908
Homologene: 35420
Hook1
Name: hook microtubule tethering protein 1
Synonyms: abnormal spermatozoon head shape, azh, A930033L17Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 77963
Homologene: 9289
Aars1
Name: alanyl-tRNA synthetase 1
Synonyms: Aars
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234734
HGNC: HGNC:20
Homologene: 1213
Brf2
Name: BRF2, RNA polymerase III transcription initiation factor 50kDa subunit
Synonyms: 2700059M06Rik, BRFU, TFIIIB50, 5730512K07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66653
Homologene: 10127
C3
Name: complement component 3
Synonyms: complement factor 3, acylation stimulating protein, Plp
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12266
HGNC: HGNC:1318
Homologene: 68031
Cdcp1
Name: CUB domain containing protein 1
Synonyms: 9030022E12Rik, E030027H19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 109332
Homologene: 11276
Hspg2
Name: perlecan (heparan sulfate proteoglycan 2)
Synonyms: per, Pcn, Plc, perlecan
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15530
HGNC: HGNC:5273
Homologene: 68473
Rpn1
Name: ribophorin I
Synonyms: Rpn-1, D6Wsu137e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 103963
Homologene: 2213
Rbl2
Name: RB transcriptional corepressor like 2
Synonyms: Rb2, p130, retinoblastoma-like 2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19651
HGNC: HGNC:9894
Homologene: 4098
Sptbn2
Name: spectrin beta, non-erythrocytic 2
Synonyms: Spnb3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20743
VEGA: 19
Homologene: 48482
Oip5
Name: Opa interacting protein 5
Synonyms: 5730547N13Rik, Lint-25
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70645
Homologene: 5268
Csnk1g2
Name: casein kinase 1, gamma 2
Synonyms: 2810429I12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103236
VEGA: 10
HGNC: HGNC:2455
Homologene: 100845
Susd2
Name: sushi domain containing 2
Synonyms: 1200011D11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71733
VEGA: 10
Homologene: 10481
Ppp1r12b
Name: protein phosphatase 1, regulatory subunit 12B
Synonyms: 1810037O03Rik, 9530009M10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329251
HGNC: HGNC:7619
Homologene: 135710
Marveld2
Name: MARVEL (membrane-associating) domain containing 2
Synonyms: Mrvldc2, Tricellulin, Tric, Tric-c, Tric-b, Tric-a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218518
VEGA: 13
Homologene: 27037
Pcsk2
Name: proprotein convertase subtilisin/kexin type 2
Synonyms: prohormone convertase 2, Phpp-2, Nec-2, Nec2, PC2, SPC2, 6330411F23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18549
HGNC: HGNC:8744
Homologene: 37640
Dnah11
Name: dynein, axonemal, heavy chain 11
Synonyms: lrd, b2b1279Clo, b2b1203Clo, b2b598Clo, b2b1289Clo, b2b1727Clo, Dnahc11, avc4
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13411
HGNC: HGNC:2942
Homologene: 2801
Nlrp1b
Name: NLR family, pyrin domain containing 1B
Synonyms: Nalp1b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 637515
Homologene: 19080
Lrpap1
Name: low density lipoprotein receptor-related protein associated protein 1
Synonyms: RAP
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16976
HGNC: HGNC:6701
Homologene: 37612
Akna
Name: AT-hook transcription factor
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100182
Homologene: 49947
Ctsq
Name: cathepsin Q
Synonyms: 1600010J02Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 104002
Homologene: 122226
Arhgef15
Name: Rho guanine nucleotide exchange factor 15
Synonyms: D530030K12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 442801
Homologene: 18345
Cblif
Name: cobalamin binding intrinsic factor
Synonyms: Gif
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14603
HGNC: HGNC:4268
Homologene: 3773
Erich6
Name: glutamate rich 6
Synonyms: 4932431H17Rik, Fam194a
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 545527
Homologene: 65043
Kmt2d
Name: lysine (K)-specific methyltransferase 2D
Synonyms: C430014K11Rik, Mll4, Mll2, bapa
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 381022
HGNC: HGNC:7133
Homologene: 86893
Plxnb1
Name: plexin B1
Synonyms: 2900002G15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235611
HGNC: HGNC:9103
Homologene: 130508
Mapkbp1
Name: mitogen-activated protein kinase binding protein 1
Synonyms: Jnkbp1, 2810483F24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26390
Homologene: 69109
Mctp1
Name: multiple C2 domains, transmembrane 1
Synonyms: 2810465F10Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 78771
Homologene: 75211
Lats1
Name: large tumor suppressor
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16798
VEGA: 10
HGNC: HGNC:6514
Homologene: 55843
Actl11
Name: actin-like 11
Synonyms: 4921517D21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67722
Homologene: 69412
Wfdc8
Name: WAP four-disulfide core domain 8
Synonyms: LOC277343
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 277343
Homologene: 33799
Mast1
Name: microtubule associated serine/threonine kinase 1
Synonyms: 9430008B02Rik, SAST170, SAST
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56527
Homologene: 10543
Daxx
Name: Fas death domain-associated protein
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13163
HGNC: HGNC:2681
Homologene: 1033
Or4c12
Name: olfactory receptor family 4 subfamily C member 12
Synonyms: GA_x6K02T2Q125-51376062-51375133, MOR232-9, Olfr1259
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258338
Homologene: 128115
Gpr161
Name: G protein-coupled receptor 161
Synonyms: LOC240888, vl
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240888
Homologene: 17824
Stk36
Name: serine/threonine kinase 36
Synonyms: 1700112N14Rik, Fused
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269209
Homologene: 49432
Sec61a2
Name: SEC61 translocon subunit alpha 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 57743
Homologene: 38481
Fam107a
Name: family with sequence similarity 107, member A
Synonyms: DRR1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 268709
Homologene: 48509
Stard13
Name: StAR related lipid transfer domain containing 13
Synonyms: GT650, DLC2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243362
Homologene: 64844
Or8b12
Name: olfactory receptor family 8 subfamily B member 12
Synonyms: GA_x6K02T2PVTD-31428850-31429782, MOR161-2, Olfr874
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258882
Homologene: 17377
Or5k8
Name: olfactory receptor family 5 subfamily K member 8
Synonyms: GA_x54KRFPKG5P-55026345-55025418, GA_x54KRFPKG5P-54993816-54992890, MOR184-10P, MOR184-1, Olfr174, Olfr175-ps1, Olfr175
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 259004
Homologene: 17461
Hsf2bp
Name: heat shock transcription factor 2 binding protein
Synonyms: 4932437G14Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74377
HGNC: HGNC:5226
Homologene: 38263
Igdcc4
Name: immunoglobulin superfamily, DCC subclass, member 4
Synonyms: 9330155G14Rik, WI-18508, Nope, WI-16786
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56741
VEGA: 9
Homologene: 10570
Tekt5
Name: tektin 5
Synonyms: 3300001K11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70426
Homologene: 71928
Zar1l
Name: zygote arrest 1-like
Synonyms: LOC545824
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 545824
Homologene: 85370
Rassf7
Name: Ras association (RalGDS/AF-6) domain family (N-terminal) member 7
Synonyms: 2400009B11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66985
HGNC: HGNC:1166
Homologene: 2595
Thap11
Name: THAP domain containing 11
Synonyms: CTG-B45d, Ronin, 2810036E22Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 59016
Homologene: 10726
Zfp607b
Name: zinc finger protein 607B
Synonyms: C030039L03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 112415
Homologene: 134321
Dnah7c
Name: dynein, axonemal, heavy chain 7C
Synonyms: Dnahc7c
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100101919
Homologene: 41287
Alkbh1
Name: alkB homolog 1, histone H2A dioxygenase
Synonyms: alkB, Alkbh, Nrp
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 211064
Homologene: 4393
Lrrc57
Name: leucine rich repeat containing 57
Synonyms: 2810002D13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66606
Homologene: 11995
Gpatch11
Name: G patch domain containing 11
Synonyms: 2310002B06Rik, Ccdc75
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 53951
VEGA: 17
Homologene: 44687
Mageb3
Name: MAGE family member B3
Synonyms: Smage3, Mage-rs3, Mage-ps1, Mage-b3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17147
Homologene: 137208
Ccdc107
Name: coiled-coil domain containing 107
Synonyms: 1110032O22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 622404
Homologene: 52163
Cyp2ab1
Name: cytochrome P450, family 2, subfamily ab, polypeptide 1
Synonyms: EG224044
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224044
Homologene: 120487
4930449A18Rik
Name: RIKEN cDNA 4930449A18 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 46,666,317 bp
  • G to T, chromosome 1 at 68,298,293 bp
  • A to G, chromosome 1 at 74,626,508 bp
  • A to G, chromosome 1 at 134,777,390 bp
  • A to G, chromosome 1 at 158,597,216 bp
  • C to A, chromosome 1 at 165,306,413 bp
  • A to T, chromosome 1 at 179,754,068 bp
  • T to A, chromosome 2 at 5,876,540 bp
  • A to G, chromosome 2 at 89,943,585 bp
  • T to C, chromosome 2 at 91,594,816 bp
  • T to A, chromosome 2 at 119,610,327 bp
  • G to A, chromosome 2 at 120,019,243 bp
  • A to T, chromosome 2 at 120,608,841 bp
  • A to G, chromosome 2 at 121,954,387 bp
  • G to A, chromosome 2 at 143,546,560 bp
  • A to T, chromosome 2 at 164,597,319 bp
  • A to G, chromosome 3 at 58,618,797 bp
  • A to T, chromosome 3 at 59,841,724 bp
  • T to C, chromosome 4 at 43,495,685 bp
  • C to T, chromosome 4 at 63,394,959 bp
  • T to C, chromosome 4 at 63,395,566 bp
  • G to T, chromosome 4 at 96,002,528 bp
  • T to A, chromosome 4 at 106,416,047 bp
  • T to C, chromosome 4 at 137,548,174 bp
  • A to G, chromosome 5 at 35,097,667 bp
  • T to C, chromosome 5 at 150,512,900 bp
  • A to G, chromosome 5 at 151,045,901 bp
  • T to C, chromosome 6 at 71,929,366 bp
  • T to G, chromosome 6 at 88,093,859 bp
  • C to A, chromosome 6 at 121,222,913 bp
  • A to T, chromosome 7 at 27,702,607 bp
  • C to A, chromosome 7 at 39,535,153 bp
  • C to A, chromosome 7 at 141,217,060 bp
  • A to G, chromosome 8 at 27,124,283 bp
  • G to C, chromosome 8 at 84,916,260 bp
  • A to G, chromosome 8 at 91,078,932 bp
  • G to A, chromosome 8 at 105,855,916 bp
  • T to A, chromosome 8 at 111,042,225 bp
  • T to A, chromosome 9 at 37,746,524 bp
  • A to G, chromosome 9 at 65,128,795 bp
  • A to T, chromosome 9 at 70,459,096 bp
  • G to A, chromosome 9 at 72,308,099 bp
  • A to G, chromosome 9 at 107,929,633 bp
  • G to T, chromosome 9 at 109,100,750 bp
  • G to T, chromosome 9 at 123,178,029 bp
  • T to C, chromosome 10 at 7,705,754 bp
  • T to A, chromosome 10 at 75,642,218 bp
  • C to A, chromosome 10 at 80,638,398 bp
  • T to C, chromosome 11 at 3,243,989 bp
  • T to G, chromosome 11 at 68,798,380 bp
  • G to A, chromosome 11 at 68,954,051 bp
  • A to T, chromosome 11 at 71,217,276 bp
  • G to T, chromosome 11 at 95,485,843 bp
  • A to G, chromosome 11 at 108,053,980 bp
  • A to G, chromosome 12 at 87,429,284 bp
  • G to A, chromosome 12 at 117,975,848 bp
  • A to T, chromosome 13 at 61,037,888 bp
  • C to T, chromosome 13 at 77,029,918 bp
  • T to C, chromosome 13 at 100,600,938 bp
  • C to T, chromosome 14 at 8,298,764 bp
  • T to C, chromosome 15 at 34,114,059 bp
  • T to A, chromosome 15 at 88,701,122 bp
  • T to C, chromosome 15 at 98,853,068 bp
  • G to T, chromosome 16 at 10,361,390 bp
  • T to A, chromosome 16 at 20,313,757 bp
  • G to T, chromosome 16 at 58,824,153 bp
  • T to A, chromosome 17 at 31,946,695 bp
  • TGATGATGACGATGATGACGATGATGA to TGATGATGACGATGATGA, chromosome 17 at 33,912,641 bp
  • A to G, chromosome 17 at 57,222,976 bp
  • C to T, chromosome 17 at 78,842,119 bp
  • T to C, chromosome 18 at 60,831,556 bp
  • C to T, chromosome 19 at 4,725,950 bp
  • T to C, chromosome 19 at 11,748,495 bp
  • T to G, chromosome 19 at 37,272,224 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5546 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043104-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.