Strain Name:
C57BL/6J-MtgxR5568Btlr/Mmmh
Stock Number:
043125-MU
Citation ID:
RRID:MMRRC_043125-MU
Other Names:
R5568 (G1), C57BL/6J-MtgxR5568Btlr
Major Collection:

Strain Information

Tln2
Name: talin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Vcan
Name: versican
Synonyms: 5430420N07Rik, PG-M, DPEAAE, Cspg2, hdf, heart defect
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Sez6
Name: seizure related gene 6
Synonyms: D11Bhm177e, sez-6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20370
Homologene: 10948
Ep400
Name: E1A binding protein p400
Synonyms: 1700020J09Rik, p400, mDomino
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 75560
Homologene: 38779
Rapgef2
Name: Rap guanine nucleotide exchange factor (GEF) 2
Synonyms: RA-GEF-1, Pdzgef1, CNRasGEF, nRapGEP, 5830453M24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 76089
Homologene: 35477
Aco2
Name: aconitase 2, mitochondrial
Synonyms: Irp1, Aco3, D10Wsu183e, Aco-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 11429
HGNC: HGNC:118
Homologene: 856
Tfg
Name: Trk-fused gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 21787
Homologene: 4426
Dlgap4
Name: DLG associated protein 4
Synonyms: Sapap4, WBP16, PSD-95/SAP90 binding protein 4, SAP90/PSD-95-associated protein 4, DAP4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228836
Homologene: 8935
Ticrr
Name: TOPBP1-interacting checkpoint and replication regulator
Synonyms: 5730590G19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 77011
Homologene: 67120
Anapc5
Name: anaphase-promoting complex subunit 5
Synonyms: 2510006G12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 59008
Homologene: 41118
Ddx27
Name: DEAD box helicase 27
Synonyms: DEAD (Asp-Glu-Ala-Asp) box polypeptide 27
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228889
Homologene: 6431
Ranbp3
Name: RAN binding protein 3
Synonyms: 2610024N24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 71810
VEGA: 17
HGNC: HGNC:9850
Homologene: 136516
Abl1
Name: c-abl oncogene 1, non-receptor tyrosine kinase
Synonyms: c-Abl, E430008G22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 11350
HGNC: HGNC:76
Homologene: 3783
Xdh
Name: xanthine dehydrogenase
Synonyms: Xor, XO, Xox1, xanthine oxidase, Xox-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 22436
VEGA: 17
Homologene: 324
Crhbp
Name: corticotropin releasing hormone binding protein
Synonyms: CRH-BP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 12919
VEGA: 13
HGNC: HGNC:2356
Homologene: 1418
Uhrf2
Name: ubiquitin-like, containing PHD and RING finger domains 2
Synonyms: 2310065A22Rik, D130071B19Rik, Nirf
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 109113
Homologene: 17001
Cc2d2a
Name: coiled-coil and C2 domain containing 2A
Synonyms: b2b1035Clo, 5730509K17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231214
Homologene: 18159
Ints13
Name: integrator complex subunit 13
Synonyms: Asun, 4933424B01Rik, Spata30
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 71177
Homologene: 10043
Myo9a
Name: myosin IXa
Synonyms: C130068I12Rik, 4732465J09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 270163
HGNC: HGNC:7608
Homologene: 21371
Dmxl2
Name: Dmx-like 2
Synonyms: E130119P06Rik, 6430411K14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235380
HGNC: HGNC:2938
Homologene: 41022
Utp15
Name: UTP15 small subunit processome component
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 105372
VEGA: 13
Homologene: 6629
Plxnb2
Name: plexin B2
Synonyms: Debt, 1110007H23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 140570
HGNC: HGNC:9104
Homologene: 66630
Scaf4
Name: SR-related CTD-associated factor 4
Synonyms: Srsf15, Sra4, Sfrs15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 224432
VEGA: 16
Homologene: 16227
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: LOC381562, D930005K06Rik, Zubr1, p600, A930005E13Rik, 1810009A16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 69116
Homologene: 10804
Atf7
Name: activating transcription factor 7
Synonyms: 1110012F10Rik, 9430065F09Rik, C130020M04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223922
HGNC: HGNC:792
Homologene: 4994
Klrb1c
Name: killer cell lectin-like receptor subfamily B member 1C
Synonyms: NK-RP1, CD161, Nkrp1-c, Ly55c, Nk-1.2, Nk1, Nk-1, NKR-P1, Ly59, NKR-P1C, Nk1.1, NK-1.1, Ly-59
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 17059
HGNC: HGNC:6373
Homologene: 84369
Crispld1
Name: cysteine-rich secretory protein LCCL domain containing 1
Synonyms: Cocoacrisp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 83691
Homologene: 12857
Gfral
Name: GDNF family receptor alpha like
Synonyms: GRAL
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 404194
Homologene: 45748
Lama1
Name: laminin, alpha 1
Synonyms: Lama
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 16772
VEGA: 17
HGNC: HGNC:6481
Homologene: 21146
Srpk2
Name: serine/arginine-rich protein specific kinase 2
Synonyms: mSRPK2, WBP6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 20817
Homologene: 101663
Ddx24
Name: DEAD box helicase 24
Synonyms: 2510027P10Rik, 1700055J08Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 24
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 27225
VEGA: 12
Homologene: 10702
Mfsd14b
Name: major facilitator superfamily domain containing 14B
Synonyms: Hiatl1, 5730414C17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 66631
Homologene: 64464
Clp1
Name: CLP1, cleavage and polyadenylation factor I subunit
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 98985
Homologene: 4975
Map4k3
Name: mitogen-activated protein kinase kinase kinase kinase 3
Synonyms: 9530052P13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 225028
VEGA: 17
HGNC: HGNC:6865
Homologene: 2683
Pcdhb18
Name: protocadherin beta 18
Synonyms: Pcdhb9, PcdhbR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93889
Homologene: 137649
Cp
Name: ceruloplasmin
Synonyms: D3Ertd555e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 12870
HGNC: HGNC:2295
Homologene: 75
Cilp
Name: cartilage intermediate layer protein, nucleotide pyrophosphohydrolase
Synonyms: C130036G17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 214425
HGNC: HGNC:1980
Homologene: 2679
Scd2
Name: stearoyl-Coenzyme A desaturase 2
Synonyms: Scd-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 20250
VEGA: 19
Homologene: 136612
Ttn
Name: titin
Synonyms: L56, 1100001C23Rik, D330041I19Rik, 2310057K23Rik, D830007G01Rik, 2310074I15Rik, 2310036G12Rik, mdm, connectin, shru
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Stradb
Name: STE20-related kinase adaptor beta
Synonyms: Als2cr2, PRO1038, D1Ucla2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227154
Homologene: 10237
Kmt5b
Name: lysine methyltransferase 5B
Synonyms: Suv420h1, Suv4-20h1, C630029K18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 225888
Homologene: 32351
Fat3
Name: FAT atypical cadherin 3
Synonyms: LOC234973, 9430076A06Rik, LOC382129, D430038H04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 270120
VEGA: 9
Homologene: 82252
Ndrg2
Name: N-myc downstream regulated gene 2
Synonyms: Ndr2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 29811
VEGA: 14
Homologene: 22785
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241516
Homologene: 110349
Nfatc1
Name: nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 1
Synonyms: NFATc, 2210017P03Rik, NFAT2, NF-ATc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 18018
VEGA: 18
HGNC: HGNC:7775
Homologene: 32336
Col6a3
Name: collagen, type VI, alpha 3
Synonyms: Col6a-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12835
HGNC: HGNC:2213
Homologene: 37917
Cryga
Name: crystallin, gamma A
Synonyms: Cryg-4, DGcry-4, Secc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12964
HGNC: HGNC:2408
Homologene: 129704
Plcb1
Name: phospholipase C, beta 1
Synonyms: 3110043I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18795
Homologene: 22876
Vmn1r76
Name: vomeronasal 1 receptor 76
Synonyms: V1rg4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 171239
Aadacl4
Name: arylacetamide deacetylase like 4
Synonyms: Gm13177
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 435815
Homologene: 82530
Wdr64
Name: WD repeat domain 64
Synonyms: 4930415O10Rik, 4930511H01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 75820
Homologene: 51634
Mbd6
Name: methyl-CpG binding domain protein 6
Synonyms: D10Wsu93e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 110962
Homologene: 14171
Abcc9
Name: ATP-binding cassette, sub-family C (CFTR/MRP), member 9
Synonyms: SUR2B, SUR2A, Sur2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 20928
HGNC: HGNC:60
Homologene: 56521
Npsr1
Name: neuropeptide S receptor 1
Synonyms: 9330128H10Rik, PGR14, Gpr154, VRR1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 319239
Homologene: 45515
Shmt2
Name: serine hydroxymethyltransferase 2 (mitochondrial)
Synonyms: 2700043D08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 108037
VEGA: 10
Homologene: 133984
Cacna1b
Name: calcium channel, voltage-dependent, N type, alpha 1B subunit
Synonyms: alpha(1B), Cav2.2, Cchn1a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 12287
HGNC: HGNC:1389
Homologene: 20184
Plcl1
Name: phospholipase C-like 1
Synonyms: C230017K02Rik, PLC-L, PRIP-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227120
HGNC: HGNC:9063
Homologene: 38155
Or10d5
Name: olfactory receptor family 10 subfamily D member 5
Synonyms: GA_x6K02T2PVTD-33651220-33650288, Olfr975, MOR224-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258825
VEGA: 9
Homologene: 27275
Nlrp10
Name: NLR family, pyrin domain containing 10
Synonyms: 6430548I20Rik, Pynod, Nalp10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 244202
Homologene: 18468
Ptk6
Name: PTK6 protein tyrosine kinase 6
Synonyms: Sik, Tksk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20459
HGNC: HGNC:9617
Homologene: 68494
Dlk2
Name: delta like non-canonical Notch ligand 2
Synonyms: Egfl9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 106565
Homologene: 11397
Cyp3a57
Name: cytochrome P450, family 3, subfamily a, polypeptide 57
Synonyms: EG622127
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 622127
Homologene: 135775
Rab12
Name: RAB12, member RAS oncogene family
Synonyms: 2900054P15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 19328
Homologene: 103879
Capn5
Name: calpain 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 12337
HGNC: HGNC:1482
Homologene: 31212
Adam26b
Name: a disintegrin and metallopeptidase domain 26B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 382007
Homologene: 128363
Sorcs2
Name: sortilin-related VPS10 domain containing receptor 2
Synonyms: VPS10 domain receptor protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 81840
Homologene: 56899
Smarca5
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5
Synonyms: 4933427E24Rik, MommeD4, D030040M08Rik, D330027N15Rik, Snf2h
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 93762
Homologene: 55764
Phyhd1
Name: phytanoyl-CoA dioxygenase domain containing 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227696
Homologene: 14939
H2-T10
Name: histocompatibility 2, T region locus 10
Synonyms: H-2T10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 15024
Rigi
Name: RNA sensor RIG-I
Synonyms: 6430573D20Rik, RIG-I, Ddx58, DEAD (Asp-Glu-Ala-Asp) box polypeptide 58
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230073
Homologene: 32215
Xylb
Name: xylulokinase homolog (H. influenzae)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 102448
VEGA: 9
Homologene: 3746
Kbtbd12
Name: kelch repeat and BTB (POZ) domain containing 12
Synonyms: 4933428M03Rik, 4833415F11Rik, Klhdc6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 74589
Homologene: 52613
Elp5
Name: elongator acetyltransferase complex subunit 5
Synonyms: Rai12, Clone 13u
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 54351
Homologene: 10291
Ninj2
Name: ninjurin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 29862
HGNC: HGNC:7825
Homologene: 9555
Pacsin1
Name: protein kinase C and casein kinase substrate in neurons 1
Synonyms: Syndapin I, A830061D09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 23969
HGNC: HGNC:8570
Homologene: 22674
Mup3
Name: major urinary protein 3
Synonyms: Mup-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 17842
Homologene: 74304
Ganc
Name: glucosidase, alpha; neutral C
Synonyms: 5830445O15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 76051
HGNC: HGNC:4139
Homologene: 25627
Dus4l
Name: dihydrouridine synthase 4-like (S. cerevisiae)
Synonyms: 2700089B10Rik, 2310069P03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 71916
VEGA: 12
Homologene: 6535
Gm5884
Name: predicted pseudogene 5884
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 545878
Tmcc1
Name: transmembrane and coiled coil domains 1
Synonyms: 3632431M01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 330401
Homologene: 8995
Cyp2c68
Name: cytochrome P450, family 2, subfamily c, polypeptide 68
Synonyms: 9030012A22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 433247
Homologene: 74936
Vmn1r174
Name: vomeronasal 1 receptor 174
Synonyms: V1rd22
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 404291
Homologene: 79577
Pcdh1
Name: protocadherin 1
Synonyms: 2010005A06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 75599
HGNC: HGNC:8655
Homologene: 12613
Glis1
Name: GLIS family zinc finger 1
Synonyms: GliH1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230587
Homologene: 77390
Plppr2
Name: phospholipid phosphatase related 2
Synonyms: BC018242, PRG-4, Lppr2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235044
Homologene: 11229
Krt79
Name: keratin 79
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223917
Homologene: 89169
Mrpl46
Name: mitochondrial ribosomal protein L46
Synonyms: LIECG2, P2ECSL, 3110052F15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 67308
HGNC: HGNC:1192
Homologene: 6747
Tpm2
Name: tropomyosin 2, beta
Synonyms: Trop-2, Tpm-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 22004
Homologene: 134309
Krt28
Name: keratin 28
Synonyms: 4733401L19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 70843
Homologene: 124711
Hsbp1l1
Name: heat shock factor binding protein 1-like 1
Synonyms: 1810005K13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 66255
VEGA: 18
Homologene: 122116
Garin5a
Name: golgi associated RAB2 interactor 5A
Synonyms: 1700021P22Rik, 0610007G24Rik, 1700021N13Rik, Fam71e1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 75538
Homologene: 19259
Ulbp1
Name: UL16 binding protein 1
Synonyms: A430108B07Rik, MULT1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 77777
VEGA: 10
Homologene: 108274
Maneal
Name: mannosidase, endo-alpha-like
Synonyms: LOC215090
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 215090
Homologene: 17597
Tfec
Name: transcription factor EC
Synonyms: bHLHe34, TFEC, Tcfec
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 21426
Homologene: 32148
Or52r1b
Name: olfactory receptor family 52 subfamily R member 1B
Synonyms: Olfr582, MOR30-3, GA_x6K02T2PBJ9-5752857-5753801
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259055
Homologene: 73943
Gm10030
Name: predicted gene 10030
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 791282
Cd300c2
Name: CD300C molecule 2
Synonyms: Cd300d, DIgR1, Clm4, MAIR-II, LMIR2, AF251705, Igsf7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 140497
Homologene: 74580
Rab36
Name: RAB36, member RAS oncogene family
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 76877
HGNC: HGNC:9775
Homologene: 3610
Pole3
Name: polymerase (DNA directed), epsilon 3 (p17 subunit)
Synonyms: YBL1, 1810034K18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 59001
Homologene: 9694
Gm27013
Name: predicted gene, 27013
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Pcdha12
Name: protocadherin alpha 12
Synonyms: Pcdha13, Cnr5, Crnr5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 192164
HGNC: HGNC:8667
Homologene: 135870
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 17,750,271 bp
  • T to C, chromosome 1 at 55,696,150 bp
  • T to A, chromosome 1 at 58,992,742 bp
  • A to G, chromosome 1 at 65,103,228 bp
  • A to G, chromosome 1 at 90,807,958 bp
  • C to T, chromosome 1 at 175,743,597 bp
  • A to G, chromosome 2 at 24,607,600 bp
  • T to A, chromosome 2 at 30,277,010 bp
  • C to T, chromosome 2 at 31,779,074 bp
  • T to G, chromosome 2 at 76,750,578 bp
  • T to C, chromosome 2 at 82,986,564 bp
  • T to A, chromosome 2 at 84,725,978 bp
  • A to G, chromosome 2 at 120,433,812 bp
  • A to T, chromosome 2 at 135,370,593 bp
  • T to A, chromosome 2 at 156,762,901 bp
  • A to G, chromosome 2 at 167,029,519 bp
  • A to T, chromosome 2 at 181,199,695 bp
  • A to G, chromosome 3 at 19,989,049 bp
  • A to G, chromosome 3 at 79,104,001 bp
  • T to A, chromosome 4 at 40,222,140 bp
  • C to A, chromosome 4 at 43,522,692 bp
  • T to G, chromosome 4 at 62,084,572 bp
  • T to C, chromosome 4 at 62,524,431 bp
  • T to C, chromosome 4 at 107,619,635 bp
  • T to C, chromosome 4 at 124,857,144 bp
  • T to G, chromosome 4 at 139,392,038 bp
  • T to C, chromosome 4 at 144,622,794 bp
  • T to A, chromosome 5 at 23,525,699 bp
  • A to C, chromosome 5 at 36,046,530 bp
  • A to G, chromosome 5 at 43,709,091 bp
  • A to T, chromosome 5 at 110,756,205 bp
  • G to A, chromosome 5 at 122,791,925 bp
  • A to T, chromosome 5 at 145,370,646 bp
  • T to A, chromosome 6 at 16,867,593 bp
  • C to T, chromosome 6 at 88,618,627 bp
  • G to C, chromosome 6 at 116,022,110 bp
  • T to C, chromosome 6 at 120,198,709 bp
  • C to A, chromosome 6 at 128,645,011 bp
  • A to G, chromosome 6 at 128,788,914 bp
  • A to T, chromosome 6 at 130,520,148 bp
  • A to C, chromosome 6 at 142,689,016 bp
  • A to C, chromosome 6 at 146,576,357 bp
  • C to T, chromosome 7 at 11,931,135 bp
  • T to A, chromosome 7 at 23,754,494 bp
  • T to G, chromosome 7 at 44,501,004 bp
  • C to G, chromosome 7 at 78,780,494 bp
  • G to A, chromosome 7 at 79,689,967 bp
  • T to A, chromosome 7 at 79,695,296 bp
  • T to A, chromosome 7 at 98,125,930 bp
  • G to T, chromosome 7 at 103,042,310 bp
  • C to T, chromosome 7 at 104,841,208 bp
  • T to A, chromosome 7 at 108,924,261 bp
  • A to G, chromosome 7 at 142,512,040 bp
  • A to T, chromosome 8 at 43,520,492 bp
  • A to T, chromosome 8 at 80,716,530 bp
  • T to A, chromosome 9 at 16,376,923 bp
  • G to A, chromosome 9 at 21,941,129 bp
  • T to A, chromosome 9 at 24,313,214 bp
  • A to G, chromosome 9 at 39,950,687 bp
  • A to T, chromosome 9 at 54,423,359 bp
  • A to G, chromosome 9 at 59,874,628 bp
  • A to C, chromosome 9 at 65,280,233 bp
  • A to G, chromosome 9 at 67,311,865 bp
  • T to C, chromosome 9 at 76,164,805 bp
  • A to T, chromosome 9 at 111,006,420 bp
  • T to A, chromosome 9 at 119,361,132 bp
  • A to C, chromosome 10 at 7,473,281 bp
  • G to T, chromosome 10 at 75,052,479 bp
  • A to G, chromosome 10 at 127,283,428 bp
  • A to G, chromosome 10 at 127,520,381 bp
  • A to G, chromosome 11 at 69,980,037 bp
  • C to T, chromosome 11 at 77,973,118 bp
  • A to T, chromosome 11 at 99,371,384 bp
  • T to C, chromosome 11 at 115,000,836 bp
  • A to T, chromosome 12 at 31,646,713 bp
  • T to A, chromosome 12 at 103,424,288 bp
  • A to G, chromosome 12 at 113,702,217 bp
  • A to T, chromosome 13 at 65,072,122 bp
  • T to A, chromosome 13 at 89,688,671 bp
  • T to A, chromosome 13 at 95,442,229 bp
  • T to C, chromosome 13 at 98,257,925 bp
  • T to A, chromosome 14 at 51,906,963 bp
  • T to A, chromosome 15 at 81,903,586 bp
  • G to A, chromosome 15 at 89,157,435 bp
  • A to G, chromosome 15 at 101,929,785 bp
  • A to G, chromosome 15 at 102,563,322 bp
  • T to C, chromosome 16 at 56,701,087 bp
  • GGCTGCTGCTGCTGCTGCTGCTGCTG to GGCTGCTGCTGCTGCTGCTGCTG, chromosome 16 at 90,229,857 bp
  • T to A, chromosome 17 at 27,708,048 bp
  • A to G, chromosome 17 at 36,119,187 bp
  • C to A, chromosome 17 at 46,303,908 bp
  • T to C, chromosome 17 at 56,701,543 bp
  • C to T, chromosome 17 at 66,497,423 bp
  • A to T, chromosome 17 at 67,768,298 bp
  • T to C, chromosome 17 at 73,943,885 bp
  • T to A, chromosome 17 at 80,663,998 bp
  • T to C, chromosome 18 at 37,020,390 bp
  • T to A, chromosome 18 at 37,491,800 bp
  • T to C, chromosome 18 at 38,197,367 bp
  • T to C, chromosome 18 at 80,235,464 bp
  • A to T, chromosome 18 at 80,649,822 bp
  • A to T, chromosome 19 at 3,786,538 bp
  • G to T, chromosome 19 at 30,039,088 bp
  • A to T, chromosome 19 at 39,689,082 bp
  • T to C, chromosome 19 at 44,299,703 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5568 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043125-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.