Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5568Btlr/Mmmh
Stock Number:
043125-MU
Citation ID:
RRID:MMRRC_043125-MU
Other Names:
R5568 (G1), C57BL/6J-MtgxR5568Btlr
Major Collection:

Strain Information

Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Vcan
Name: versican
Synonyms: PG-M, hdf, heart defect, 5430420N07Rik, Cspg2, DPEAAE
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Sez6
Name: seizure related gene 6
Synonyms: sez-6, D11Bhm177e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20370
Homologene: 10948
Ep400
Name: E1A binding protein p400
Synonyms: p400, mDomino, 1700020J09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75560
Homologene: 38779
Rapgef2
Name: Rap guanine nucleotide exchange factor (GEF) 2
Synonyms: 5830453M24Rik, Pdzgef1, RA-GEF-1, CNRasGEF, nRapGEP
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76089
Homologene: 35477
Aco2
Name: aconitase 2, mitochondrial
Synonyms: Aco3, Aco-2, D10Wsu183e, Irp1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11429
HGNC: HGNC:118
Homologene: 856
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 17,750,271 bp
  • T to C, chromosome 1 at 55,696,150 bp
  • T to A, chromosome 1 at 58,992,742 bp
  • A to G, chromosome 1 at 65,103,228 bp
  • A to G, chromosome 1 at 90,807,958 bp
  • C to T, chromosome 1 at 175,743,597 bp
  • A to G, chromosome 2 at 24,607,600 bp
  • T to A, chromosome 2 at 30,277,010 bp
  • C to T, chromosome 2 at 31,779,074 bp
  • T to G, chromosome 2 at 76,750,578 bp
  • T to C, chromosome 2 at 82,986,564 bp
  • T to A, chromosome 2 at 84,725,978 bp
  • A to G, chromosome 2 at 120,433,812 bp
  • A to T, chromosome 2 at 135,370,593 bp
  • T to A, chromosome 2 at 156,762,901 bp
  • A to G, chromosome 2 at 167,029,519 bp
  • A to T, chromosome 2 at 181,199,695 bp
  • A to G, chromosome 3 at 19,989,049 bp
  • A to G, chromosome 3 at 79,104,001 bp
  • T to A, chromosome 4 at 40,222,140 bp
  • C to A, chromosome 4 at 43,522,692 bp
  • T to G, chromosome 4 at 62,084,572 bp
  • T to C, chromosome 4 at 62,524,431 bp
  • T to C, chromosome 4 at 107,619,635 bp
  • T to C, chromosome 4 at 124,857,144 bp
  • T to G, chromosome 4 at 139,392,038 bp
  • T to C, chromosome 4 at 144,622,794 bp
  • T to A, chromosome 5 at 23,525,699 bp
  • A to C, chromosome 5 at 36,046,530 bp
  • A to G, chromosome 5 at 43,709,091 bp
  • A to T, chromosome 5 at 110,756,205 bp
  • G to A, chromosome 5 at 122,791,925 bp
  • A to T, chromosome 5 at 145,370,646 bp
  • T to A, chromosome 6 at 16,867,593 bp
  • C to T, chromosome 6 at 88,618,627 bp
  • G to C, chromosome 6 at 116,022,110 bp
  • T to C, chromosome 6 at 120,198,709 bp
  • C to A, chromosome 6 at 128,645,011 bp
  • A to G, chromosome 6 at 128,788,914 bp
  • A to T, chromosome 6 at 130,520,148 bp
  • A to C, chromosome 6 at 142,689,016 bp
  • A to C, chromosome 6 at 146,576,357 bp
  • C to T, chromosome 7 at 11,931,135 bp
  • T to A, chromosome 7 at 23,754,494 bp
  • T to G, chromosome 7 at 44,501,004 bp
  • C to G, chromosome 7 at 78,780,494 bp
  • G to A, chromosome 7 at 79,689,967 bp
  • T to A, chromosome 7 at 79,695,296 bp
  • T to A, chromosome 7 at 98,125,930 bp
  • G to T, chromosome 7 at 103,042,310 bp
  • C to T, chromosome 7 at 104,841,208 bp
  • T to A, chromosome 7 at 108,924,261 bp
  • A to G, chromosome 7 at 142,512,040 bp
  • A to T, chromosome 8 at 43,520,492 bp
  • A to T, chromosome 8 at 80,716,530 bp
  • T to A, chromosome 9 at 16,376,923 bp
  • G to A, chromosome 9 at 21,941,129 bp
  • T to A, chromosome 9 at 24,313,214 bp
  • A to G, chromosome 9 at 39,950,687 bp
  • A to T, chromosome 9 at 54,423,359 bp
  • A to G, chromosome 9 at 59,874,628 bp
  • A to C, chromosome 9 at 65,280,233 bp
  • A to G, chromosome 9 at 67,311,865 bp
  • T to C, chromosome 9 at 76,164,805 bp
  • A to T, chromosome 9 at 111,006,420 bp
  • T to A, chromosome 9 at 119,361,132 bp
  • A to C, chromosome 10 at 7,473,281 bp
  • G to T, chromosome 10 at 75,052,479 bp
  • A to G, chromosome 10 at 127,283,428 bp
  • A to G, chromosome 10 at 127,520,381 bp
  • A to G, chromosome 11 at 69,980,037 bp
  • C to T, chromosome 11 at 77,973,118 bp
  • A to T, chromosome 11 at 99,371,384 bp
  • T to C, chromosome 11 at 115,000,836 bp
  • A to T, chromosome 12 at 31,646,713 bp
  • T to A, chromosome 12 at 103,424,288 bp
  • A to G, chromosome 12 at 113,702,217 bp
  • A to T, chromosome 13 at 65,072,122 bp
  • T to A, chromosome 13 at 89,688,671 bp
  • T to A, chromosome 13 at 95,442,229 bp
  • T to C, chromosome 13 at 98,257,925 bp
  • T to A, chromosome 14 at 51,906,963 bp
  • T to A, chromosome 15 at 81,903,586 bp
  • G to A, chromosome 15 at 89,157,435 bp
  • A to G, chromosome 15 at 101,929,785 bp
  • A to G, chromosome 15 at 102,563,322 bp
  • T to C, chromosome 16 at 56,701,087 bp
  • GGCTGCTGCTGCTGCTGCTGCTGCTG to GGCTGCTGCTGCTGCTGCTGCTG, chromosome 16 at 90,229,857 bp
  • T to A, chromosome 17 at 27,708,048 bp
  • A to G, chromosome 17 at 36,119,187 bp
  • C to A, chromosome 17 at 46,303,908 bp
  • T to C, chromosome 17 at 56,701,543 bp
  • C to T, chromosome 17 at 66,497,423 bp
  • A to T, chromosome 17 at 67,768,298 bp
  • T to C, chromosome 17 at 73,943,885 bp
  • T to A, chromosome 17 at 80,663,998 bp
  • T to C, chromosome 18 at 37,020,390 bp
  • T to A, chromosome 18 at 37,491,800 bp
  • T to C, chromosome 18 at 38,197,367 bp
  • T to C, chromosome 18 at 80,235,464 bp
  • A to T, chromosome 18 at 80,649,822 bp
  • A to T, chromosome 19 at 3,786,538 bp
  • G to T, chromosome 19 at 30,039,088 bp
  • A to T, chromosome 19 at 39,689,082 bp
  • T to C, chromosome 19 at 44,299,703 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5568 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The submitter or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043125-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.