MMRRC:043125-MU

T to A, chromosome 1 at 17,750,271 bp
T to C, chromosome 1 at 55,696,150 bp
T to A, chromosome 1 at 58,992,742 bp
A to G, chromosome 1 at 65,103,228 bp
A to G, chromosome 1 at 90,807,958 bp
C to T, chromosome 1 at 175,743,597 bp
A to G, chromosome 2 at 24,607,600 bp
T to A, chromosome 2 at 30,277,010 bp
C to T, chromosome 2 at 31,779,074 bp
T to G, chromosome 2 at 76,750,578 bp
T to C, chromosome 2 at 82,986,564 bp
T to A, chromosome 2 at 84,725,978 bp
A to G, chromosome 2 at 120,433,812 bp
A to T, chromosome 2 at 135,370,593 bp
T to A, chromosome 2 at 156,762,901 bp
A to G, chromosome 2 at 167,029,519 bp
A to T, chromosome 2 at 181,199,695 bp
A to G, chromosome 3 at 19,989,049 bp
A to G, chromosome 3 at 79,104,001 bp
T to A, chromosome 4 at 40,222,140 bp
C to A, chromosome 4 at 43,522,692 bp
T to G, chromosome 4 at 62,084,572 bp
T to C, chromosome 4 at 62,524,431 bp
T to C, chromosome 4 at 107,619,635 bp
T to C, chromosome 4 at 124,857,144 bp
T to G, chromosome 4 at 139,392,038 bp
T to C, chromosome 4 at 144,622,794 bp
T to A, chromosome 5 at 23,525,699 bp
A to C, chromosome 5 at 36,046,530 bp
A to G, chromosome 5 at 43,709,091 bp
A to T, chromosome 5 at 110,756,205 bp
G to A, chromosome 5 at 122,791,925 bp
A to T, chromosome 5 at 145,370,646 bp
T to A, chromosome 6 at 16,867,593 bp
C to T, chromosome 6 at 88,618,627 bp
G to C, chromosome 6 at 116,022,110 bp
T to C, chromosome 6 at 120,198,709 bp
C to A, chromosome 6 at 128,645,011 bp
A to G, chromosome 6 at 128,788,914 bp
A to T, chromosome 6 at 130,520,148 bp
A to C, chromosome 6 at 142,689,016 bp
A to C, chromosome 6 at 146,576,357 bp
C to T, chromosome 7 at 11,931,135 bp
T to A, chromosome 7 at 23,754,494 bp
T to G, chromosome 7 at 44,501,004 bp
C to G, chromosome 7 at 78,780,494 bp
G to A, chromosome 7 at 79,689,967 bp
T to A, chromosome 7 at 79,695,296 bp
T to A, chromosome 7 at 98,125,930 bp
G to T, chromosome 7 at 103,042,310 bp
C to T, chromosome 7 at 104,841,208 bp
T to A, chromosome 7 at 108,924,261 bp
A to G, chromosome 7 at 142,512,040 bp
A to T, chromosome 8 at 43,520,492 bp
A to T, chromosome 8 at 80,716,530 bp
T to A, chromosome 9 at 16,376,923 bp
G to A, chromosome 9 at 21,941,129 bp
T to A, chromosome 9 at 24,313,214 bp
A to G, chromosome 9 at 39,950,687 bp
A to T, chromosome 9 at 54,423,359 bp
A to G, chromosome 9 at 59,874,628 bp
A to C, chromosome 9 at 65,280,233 bp
A to G, chromosome 9 at 67,311,865 bp
T to C, chromosome 9 at 76,164,805 bp
A to T, chromosome 9 at 111,006,420 bp
T to A, chromosome 9 at 119,361,132 bp
A to C, chromosome 10 at 7,473,281 bp
G to T, chromosome 10 at 75,052,479 bp
A to G, chromosome 10 at 127,283,428 bp
A to G, chromosome 10 at 127,520,381 bp
A to G, chromosome 11 at 69,980,037 bp
C to T, chromosome 11 at 77,973,118 bp
A to T, chromosome 11 at 99,371,384 bp
T to C, chromosome 11 at 115,000,836 bp
A to T, chromosome 12 at 31,646,713 bp
T to A, chromosome 12 at 103,424,288 bp
A to G, chromosome 12 at 113,702,217 bp
A to T, chromosome 13 at 65,072,122 bp
T to A, chromosome 13 at 89,688,671 bp
T to A, chromosome 13 at 95,442,229 bp
T to C, chromosome 13 at 98,257,925 bp
T to A, chromosome 14 at 51,906,963 bp
T to A, chromosome 15 at 81,903,586 bp
G to A, chromosome 15 at 89,157,435 bp
A to G, chromosome 15 at 101,929,785 bp
A to G, chromosome 15 at 102,563,322 bp
T to C, chromosome 16 at 56,701,087 bp
GGCTGCTGCTGCTGCTGCTGCTGCTG to GGCTGCTGCTGCTGCTGCTGCTG, chromosome 16 at 90,229,857 bp
T to A, chromosome 17 at 27,708,048 bp
A to G, chromosome 17 at 36,119,187 bp
C to A, chromosome 17 at 46,303,908 bp
T to C, chromosome 17 at 56,701,543 bp
C to T, chromosome 17 at 66,497,423 bp
A to T, chromosome 17 at 67,768,298 bp
T to C, chromosome 17 at 73,943,885 bp
T to A, chromosome 17 at 80,663,998 bp
T to C, chromosome 18 at 37,020,390 bp
T to A, chromosome 18 at 37,491,800 bp
T to C, chromosome 18 at 38,197,367 bp
T to C, chromosome 18 at 80,235,464 bp
A to T, chromosome 18 at 80,649,822 bp
A to T, chromosome 19 at 3,786,538 bp
G to T, chromosome 19 at 30,039,088 bp
A to T, chromosome 19 at 39,689,082 bp
T to C, chromosome 19 at 44,299,703 bp

Genotype Determination

Genotyping Protocol(s)
Center protocol and contact for technical support will be shipped with mice.

Strain Description [Including phenotype, strain background, strain development and suggested control mice]

Phenotype

G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.

Strain Development

C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Suggested Control Mice

Wild-type littermates or C57BL/6J mice

MMRRC Genetic QC

MMRRC Genetic QC Summary

The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.

Strain Origin

Donor

Bruce Beutler, M.D., University of Texas Southwestern Medical Center.

Primary Reference

MUTAGENETIX record for R5568 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information Expand All

Health Status Report

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .

Appearance

Coat Color

Black

Breeding

MMRRC Breeding System

Random intra-strain mating

Breeding Scheme(s)

When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.

Overall Breeding Performance

Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain

Reproductive Statistics

Average litter size

Undetermined

Recommended wean age

3 weeks

Order Request Information Expand All

Availability Level

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Conditions of Distribution [Including applicable technology transfer agreements]

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Fees

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)

MMRRC Item #	Description	Distribution Fee / Unit (US $) Shipping & Handling not included	Units	Notes
043125-MU-RESUS	Litter recovered from cryo-archive	$5,475.00 / Non-Profit	Litter	Recovered litter⁴; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

¹ The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

² An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

³ An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

⁴ The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.

Strain Detail Sheet

Strain Information Expand All

Colony and Husbandry Information Expand All

Order Request Information Expand All