Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5611Btlr/Mmmh
Stock Number:
043273-MU
Citation ID:
RRID:MMRRC_043273-MU
Other Names:
R5611 (G1)
Major Collection:

Strain Information

Tle4
Name: transducin-like enhancer of split 4
Synonyms: Grg4, ESTM13, ESTM14, Bce1, 5730411M05Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21888
VEGA: 19
Homologene: 38259
Adamts20
Name: ADAM metallopeptidase with thrombospondin type 1 motif 20
Synonyms: ADAMTS-20, bt
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223838
Homologene: 11808
Sh3gl2
Name: SH3-domain GRB2-like 2
Synonyms: EEN-B1, endophilin I, Sh3d2a, 9530001L19Rik, B930049H17Rik, endophilin A1, EEN1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20404
Homologene: 20652
Gfap
Name: glial fibrillary acidic protein
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14580
HGNC: HGNC:4235
Homologene: 1554
Vps54
Name: VPS54 GARP complex subunit
Synonyms: Vps54l, 5330404P15Rik, mSLP8, wr
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245944
Homologene: 5605
Asxl2
Name: ASXL transcriptional regulator 2
Synonyms: 4930556B16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 75302
Homologene: 10102
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 59,710,513 bp
  • C to A, chromosome 1 at 65,256,088 bp
  • T to C, chromosome 1 at 95,627,684 bp
  • A to G, chromosome 2 at 29,702,436 bp
  • G to A, chromosome 2 at 30,079,661 bp
  • C to T, chromosome 2 at 76,732,525 bp
  • A to G, chromosome 3 at 30,691,155 bp
  • A to G, chromosome 3 at 53,478,875 bp
  • G to A, chromosome 3 at 87,367,775 bp
  • G to A, chromosome 3 at 92,428,451 bp
  • G to A, chromosome 3 at 119,194,293 bp
  • A to T, chromosome 4 at 46,804,105 bp
  • T to C, chromosome 4 at 85,355,331 bp
  • G to A, chromosome 5 at 22,039,665 bp
  • A to G, chromosome 5 at 31,206,097 bp
  • A to G, chromosome 5 at 31,553,829 bp
  • A to T, chromosome 5 at 87,677,644 bp
  • T to A, chromosome 5 at 109,428,164 bp
  • T to C, chromosome 6 at 57,002,377 bp
  • A to G, chromosome 6 at 68,910,675 bp
  • A to T, chromosome 6 at 84,064,878 bp
  • T to A, chromosome 6 at 90,129,710 bp
  • A to T, chromosome 6 at 149,513,456 bp
  • A to G, chromosome 7 at 13,044,627 bp
  • T to A, chromosome 7 at 30,878,150 bp
  • T to C, chromosome 7 at 43,532,118 bp
  • T to C, chromosome 7 at 45,553,641 bp
  • T to A, chromosome 7 at 85,005,743 bp
  • A to G, chromosome 7 at 105,559,483 bp
  • T to C, chromosome 7 at 135,411,704 bp
  • A to T, chromosome 8 at 43,651,712 bp
  • CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT, chromosome 8 at 104,309,470 bp
  • T to G, chromosome 8 at 122,408,370 bp
  • A to G, chromosome 9 at 76,323,314 bp
  • T to A, chromosome 10 at 78,585,891 bp
  • T to C, chromosome 10 at 107,786,769 bp
  • A to G, chromosome 11 at 21,311,130 bp
  • G to C, chromosome 11 at 49,020,001 bp
  • T to A, chromosome 11 at 102,897,069 bp
  • T to C, chromosome 12 at 3,484,598 bp
  • T to C, chromosome 12 at 85,267,445 bp
  • A to C, chromosome 13 at 23,232,573 bp
  • G to A, chromosome 13 at 34,305,239 bp
  • G to T, chromosome 14 at 20,483,106 bp
  • A to T, chromosome 14 at 75,330,908 bp
  • C to A, chromosome 15 at 55,082,173 bp
  • T to A, chromosome 15 at 77,051,040 bp
  • A to G, chromosome 15 at 94,273,280 bp
  • A to T, chromosome 16 at 20,738,974 bp
  • G to T, chromosome 16 at 34,175,780 bp
  • A to G, chromosome 17 at 19,793,642 bp
  • A to G, chromosome 17 at 21,464,092 bp
  • A to G, chromosome 17 at 34,872,384 bp
  • A to T, chromosome 17 at 37,752,084 bp
  • A to G, chromosome 17 at 50,735,967 bp
  • T to C, chromosome 18 at 61,507,263 bp
  • T to A, chromosome 19 at 8,063,333 bp
  • T to C, chromosome 19 at 14,449,795 bp
  • A to T, chromosome 19 at 16,725,572 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5611 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043273-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.