Strain Name:
C57BL/6J-MtgxR5611Btlr/Mmmh
Stock Number:
043273-MU
Citation ID:
RRID:MMRRC_043273-MU
Other Names:
R5611 (G1)
Major Collection:

Strain Information

Tle4
Name: transducin-like enhancer of split 4
Synonyms: Grg4, ESTM13, ESTM14, Bce1, 5730411M05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 21888
VEGA: 19
Homologene: 38259
Adamts20
Name: ADAM metallopeptidase with thrombospondin type 1 motif 20
Synonyms: ADAMTS-20, bt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223838
Homologene: 11808
Sh3gl2
Name: SH3-domain GRB2-like 2
Synonyms: EEN-B1, endophilin I, Sh3d2a, 9530001L19Rik, B930049H17Rik, endophilin A1, EEN1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 20404
Homologene: 20652
Gfap
Name: glial fibrillary acidic protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 14580
HGNC: HGNC:4235
Homologene: 1554
Dysf
Name: dysferlin
Synonyms: 2310004N10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 26903
HGNC: HGNC:3097
Homologene: 20748
Vps54
Name: VPS54 GARP complex subunit
Synonyms: Vps54l, 5330404P15Rik, mSLP8, wr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 245944
Homologene: 5605
Asxl2
Name: ASXL transcriptional regulator 2
Synonyms: 4930556B16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 75302
Homologene: 10102
Proser1
Name: proline and serine rich 1
Synonyms: 2810046L04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 212127
Homologene: 13463
Nop58
Name: NOP58 ribonucleoprotein
Synonyms: SIK similar protein, MSSP, Nol5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 55989
Homologene: 7024
Zc3h13
Name: zinc finger CCCH type containing 13
Synonyms: C87618, 4930570G11Rik, 2600010B19Rik, 3110050K21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 67302
VEGA: 14
Tbc1d5
Name: TBC1 domain family, member 5
Synonyms: 1600014N05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 72238
VEGA: 17
Homologene: 8834
Rapgef1
Name: Rap guanine nucleotide exchange factor (GEF) 1
Synonyms: C3G, 4932418O06Rik, Grf2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 107746
HGNC: HGNC:4568
Homologene: 50501
Bicd1
Name: BICD cargo adaptor 1
Synonyms: B830009D06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 12121
HGNC: HGNC:1049
Homologene: 37518
Mlh3
Name: mutL homolog 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217716
VEGA: 12
HGNC: HGNC:7128
Homologene: 91153
Ppm1g
Name: protein phosphatase 1G (formerly 2C), magnesium-dependent, gamma isoform
Synonyms: Fin13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 14208
HGNC: HGNC:9278
Homologene: 31106
Pikfyve
Name: phosphoinositide kinase, FYVE type zinc finger containing
Synonyms: 5230400C17Rik, Pip5k3, PipkIII
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18711
Homologene: 32115
Foxi2
Name: forkhead box I2
Synonyms: B130055A05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 270004
Homologene: 18838
Zc3h18
Name: zinc finger CCCH-type containing 18
Synonyms: 1190001B23Rik, 5830416A07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 76014
Homologene: 44894
Vps13a
Name: vacuolar protein sorting 13A
Synonyms: 4930516E05Rik, D330038K10Rik, 4930543C13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 271564
VEGA: 19
HGNC: HGNC:1908
Homologene: 22068
Kalrn
Name: kalirin, RhoGEF kinase
Synonyms: LOC224126, Hapip, 2210407G14Rik, E530005C20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 545156
HGNC: HGNC:4814
Homologene: 57160
Cd22
Name: CD22 antigen
Synonyms: Lyb-8, Lyb8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 12483
HGNC: HGNC:1643
Homologene: 31052
Reln
Name: reelin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 19699
HGNC: HGNC:9957
Homologene: 3699
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, D830007G01Rik, shru
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Vmn2r103
Name: vomeronasal 2, receptor 103
Synonyms: EG627636
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 627636
Homologene: 115024
Csn1s1
Name: casein alpha s1
Synonyms: Csna
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 12990
HGNC: HGNC:2445
Dpyd
Name: dihydropyrimidine dehydrogenase
Synonyms: DPD, E330028L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 99586
HGNC: HGNC:3012
Homologene: 85
Syde1
Name: synapse defective 1, Rho GTPase, homolog 1 (C. elegans)
Synonyms: 1200008N06Rik, mSYD1A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 71709
VEGA: 10
Homologene: 13195
Chrd
Name: chordin
Synonyms: Chd
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 12667
HGNC: HGNC:1949
Homologene: 2774
Hcrtr2
Name: hypocretin (orexin) receptor 2
Synonyms: OX2r, mOX2bR, mOX2aR, mOXR2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 387285
HGNC: HGNC:4849
Homologene: 1168
Adam34
Name: a disintegrin and metallopeptidase domain 34
Synonyms: testase 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 252866
Homologene: 78104
Otogl
Name: otogelin-like
Synonyms: Gm6924
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 628870
Homologene: 46008
Plekha4
Name: pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4
Synonyms: PEPP1, 2410005C22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 69217
Homologene: 10848
Apbb1
Name: amyloid beta precursor protein binding family B member 1
Synonyms: Fe65, Rir
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11785
HGNC: HGNC:581
Homologene: 898
Vmn2r66
Name: vomeronasal 2, receptor 66
Synonyms: F830104D24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233437
Homologene: 115466
Or10al5
Name: olfactory receptor family 10 subfamily AL member 5
Synonyms: MOR263-4, GA_x6K02T2PSCP-2211113-2212078, Olfr121
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 258622
Homologene: 17195
Dscc1
Name: DNA replication and sister chromatid cohesion 1
Synonyms: 2010006I05Rik, 2600005O03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 72107
Homologene: 5464
Mss51
Name: MSS51 mitochondrial translational activator
Synonyms: 4833444M15Rik, Zmynd17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 74843
VEGA: 14
Homologene: 27997
Vmn1r222
Name: vomeronasal 1 receptor 222
Synonyms: V1rh16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 171274
Homologene: 110880
C2
Name: complement C2
Synonyms: classical-complement pathway C3/C5 convertase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 12263
HGNC: HGNC:1248
Homologene: 45
Gabbr2
Name: gamma-aminobutyric acid type B receptor subunit 2
Synonyms: Gababr2, LOC242425, Gpr51, GB2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242425
HGNC: HGNC:4507
Homologene: 55902
Slc22a23
Name: solute carrier family 22, member 23
Synonyms: 3110004L20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 73102
Homologene: 41457
Pkn3
Name: protein kinase N3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 263803
Homologene: 50980
Lrrc31
Name: leucine rich repeat containing 31
Synonyms: E230002P03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 320352
St8sia4
Name: ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
Synonyms: ST8SiaIV, PST, PST-1, Siat8d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20452
Homologene: 4147
Vmn2r17
Name: vomeronasal 2, receptor 17
Synonyms: EG384221
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 384221
Homologene: 104825
Apol6
Name: apolipoprotein L 6
Synonyms: 2310076O14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 71939
Homologene: 49940
Vmn1r6
Name: vomeronasal 1 receptor 6
Synonyms: V1rc20
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 171193
Homologene: 128340
Adrm1b
Name: adhesion regulating molecule 1B
Synonyms: Gm9774
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 100043022
Arhgef37
Name: Rho guanine nucleotide exchange factor 37
Synonyms: 4933429F08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 328967
VEGA: 18
Homologene: 28467
Slc22a28
Name: solute carrier family 22, member 28
Synonyms: Gm5631
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 434674
VEGA: 19
Homologene: 77136
Cd33
Name: CD33 molecule
Synonyms: gp67, Siglec-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 12489
HGNC: HGNC:1659
Mzf1
Name: myeloid zinc finger 1
Synonyms: Znf42, Mzf2, Zfp121, Zfp98
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 109889
Homologene: 9633
Cd5l
Name: CD5 antigen-like
Synonyms: AAC-11, AIM/Spalpha, Sp-alpha, Pdp 1/6, Api6, AIM
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 11801
HGNC: HGNC:1690
Homologene: 55936
Slc4a1ap
Name: solute carrier family 4 (anion exchanger), member 1, adaptor protein
Synonyms: kanadaptin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 20534
Homologene: 7543
Zfp51
Name: zinc finger protein 51
Synonyms: zfec12, Zfp-51
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 22709
VEGA: 17
Homologene: 134003
9930111J21Rik2
Name: RIKEN cDNA 9930111J21 gene 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 245240
Cmtm1
Name: CKLF-like MARVEL transmembrane domain containing 1
Synonyms: CHLFH1a, CKLFH1, Cklfsf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 100504164
Homologene: 134399
Vmn1r51
Name: vomeronasal 1 receptor 51
Synonyms: VN12, V1r1, V1ra1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 22296
Homologene: 130651
Igkv4-86
Name: immunoglobulin kappa variable 4-86
Synonyms: LOC243451
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243451
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 59,710,513 bp
  • C to A, chromosome 1 at 65,256,088 bp
  • T to C, chromosome 1 at 95,627,684 bp
  • A to G, chromosome 2 at 29,702,436 bp
  • G to A, chromosome 2 at 30,079,661 bp
  • C to T, chromosome 2 at 76,732,525 bp
  • A to G, chromosome 3 at 30,691,155 bp
  • A to G, chromosome 3 at 53,478,875 bp
  • G to A, chromosome 3 at 87,367,775 bp
  • G to A, chromosome 3 at 92,428,451 bp
  • G to A, chromosome 3 at 119,194,293 bp
  • A to T, chromosome 4 at 46,804,105 bp
  • T to C, chromosome 4 at 85,355,331 bp
  • G to A, chromosome 5 at 22,039,665 bp
  • A to G, chromosome 5 at 31,206,097 bp
  • A to G, chromosome 5 at 31,553,829 bp
  • A to T, chromosome 5 at 87,677,644 bp
  • T to A, chromosome 5 at 109,428,164 bp
  • T to C, chromosome 6 at 57,002,377 bp
  • A to G, chromosome 6 at 68,910,675 bp
  • A to T, chromosome 6 at 84,064,878 bp
  • T to A, chromosome 6 at 90,129,710 bp
  • A to T, chromosome 6 at 149,513,456 bp
  • A to G, chromosome 7 at 13,044,627 bp
  • T to A, chromosome 7 at 30,878,150 bp
  • T to C, chromosome 7 at 43,532,118 bp
  • T to C, chromosome 7 at 45,553,641 bp
  • T to A, chromosome 7 at 85,005,743 bp
  • A to G, chromosome 7 at 105,559,483 bp
  • T to C, chromosome 7 at 135,411,704 bp
  • A to T, chromosome 8 at 43,651,712 bp
  • CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT, chromosome 8 at 104,309,470 bp
  • T to G, chromosome 8 at 122,408,370 bp
  • A to G, chromosome 9 at 76,323,314 bp
  • T to A, chromosome 10 at 78,585,891 bp
  • T to C, chromosome 10 at 107,786,769 bp
  • A to G, chromosome 11 at 21,311,130 bp
  • G to C, chromosome 11 at 49,020,001 bp
  • T to A, chromosome 11 at 102,897,069 bp
  • T to C, chromosome 12 at 3,484,598 bp
  • T to C, chromosome 12 at 85,267,445 bp
  • A to C, chromosome 13 at 23,232,573 bp
  • G to A, chromosome 13 at 34,305,239 bp
  • G to T, chromosome 14 at 20,483,106 bp
  • A to T, chromosome 14 at 75,330,908 bp
  • C to A, chromosome 15 at 55,082,173 bp
  • T to A, chromosome 15 at 77,051,040 bp
  • A to G, chromosome 15 at 94,273,280 bp
  • A to T, chromosome 16 at 20,738,974 bp
  • G to T, chromosome 16 at 34,175,780 bp
  • A to G, chromosome 17 at 19,793,642 bp
  • A to G, chromosome 17 at 21,464,092 bp
  • A to G, chromosome 17 at 34,872,384 bp
  • A to T, chromosome 17 at 37,752,084 bp
  • A to G, chromosome 17 at 50,735,967 bp
  • T to C, chromosome 18 at 61,507,263 bp
  • T to A, chromosome 19 at 8,063,333 bp
  • T to C, chromosome 19 at 14,449,795 bp
  • A to T, chromosome 19 at 16,725,572 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5611 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043273-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.