Strain Name:
C57BL/6J-MtgxR5715Btlr/Mmmh
Stock Number:
043336-MU
Citation ID:
RRID:MMRRC_043336-MU
Other Names:
R5715 (G1)
Major Collection:

Gene Information

Ubn2
Name: ubinuclein 2
Synonyms: 6030408G03Rik, 2900060J04Rik, D130059P03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 320538
Homologene: 45564
Drd2
Name: dopamine receptor D2
Synonyms: D2 receptor, D2R, Drd-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 13489
VEGA: 9
HGNC: HGNC:3023
Homologene: 22561
Upf1
Name: UPF1 regulator of nonsense transcripts homolog (yeast)
Synonyms: PNORF-1, B430202H16Rik, Rent1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 19704
HGNC: HGNC:9962
Homologene: 2185
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 11426
Homologene: 136191
Ubr5
Name: ubiquitin protein ligase E3 component n-recognin 5
Synonyms: 4432411E13Rik, Edd1, Edd
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 70790
VEGA: 15
Homologene: 9295
Msi2
Name: musashi RNA-binding protein 2
Synonyms: msi2h, Musashi2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 76626
Homologene: 62199
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, D530039E11Rik, 4921505C17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Smarcc1
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1
Synonyms: BAF155, SRG3, msp3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 20588
Homologene: 68296
Fbxo31
Name: F-box protein 31
Synonyms: 2310046N15Rik, Fbx14, Fbxo14, 1110003O08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 76454
Homologene: 11684
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, Bruce, A430032G04Rik, D630005A10Rik, A430040A19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 12211
Homologene: 7248
Ptpn23
Name: protein tyrosine phosphatase, non-receptor type 23
Synonyms: PTP-TD14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 104831
Homologene: 135706
Vps39
Name: VPS39 HOPS complex subunit
Synonyms: A230065P22Rik, Vam6P, Vam6, mVam6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 269338
Homologene: 41025
Nckap5l
Name: NCK-associated protein 5-like
Synonyms: C230021P08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 380969
Homologene: 18924
Atg4c
Name: autophagy related 4C, cysteine peptidase
Synonyms: Apg4-C, autophagin 3, Autl1, Apg4c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242557
Homologene: 56296
Dnah7a
Name: dynein, axonemal, heavy chain 7A
Synonyms: LOC381341, Dnahc7, Dnahc7a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 627872
Homologene: 41287
Serinc5
Name: serine incorporator 5
Synonyms: AIGP3, A130038L21Rik, TPO1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218442
VEGA: 13
Homologene: 65246
Tap1
Name: transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
Synonyms: RING4, PSF-1, MTP1, Tap-1, Ham-1, Ham1, Abcb2, TAP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 21354
HGNC: HGNC:43
Homologene: 495
Clca4b
Name: chloride channel accessory 4B
Synonyms: AI747448
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 99709
HGNC: HGNC:2018
Homologene: 40808
Slc3a2
Name: solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2
Synonyms: Mgp-2hc, Ly-m10, Ly-10, Mdu1, 4F2HC, Cd98
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 17254
Homologene: 1795
Ikbkb
Name: inhibitor of kappaB kinase beta
Synonyms: IKK-beta, IKK-2, IKK2, IKK[b], IKKbeta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 16150
HGNC: HGNC:5960
Homologene: 7782
Cdc20
Name: cell division cycle 20
Synonyms: p55CDC, 2310042N09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 107995
HGNC: HGNC:1723
Homologene: 37459
Chd6
Name: chromodomain helicase DNA binding protein 6
Synonyms: 6330406J24Rik, 5430439G14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 71389
Homologene: 32772
Fam13c
Name: family with sequence similarity 13, member C
Synonyms: C030038O19Rik, 1200015N20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 71721
Homologene: 11490
Sh3bp5l
Name: SH3 binding domain protein 5 like
Synonyms: 2310074E09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 79566
Homologene: 32584
Znrf3
Name: zinc and ring finger 3
Synonyms: LOC382477
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 407821
Homologene: 46592
Tmprss2
Name: transmembrane protease, serine 2
Synonyms: epitheliasin, D16Ertd61e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 50528
VEGA: 16
Homologene: 4136
Hoxd4
Name: homeobox D4
Synonyms: Hox-4.2, Hox-5.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 15436
HGNC: HGNC:5138
Homologene: 7773
Nxph1
Name: neurexophilin 1
Synonyms: C130005L03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 18231
Homologene: 8284
Insc
Name: INSC spindle orientation adaptor protein
Synonyms: Inscuteable, 3830422K02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233752
Homologene: 78662
Fam20a
Name: FAM20A, golgi associated secretory pathway pseudokinase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 208659
Homologene: 9719
Dusp19
Name: dual specificity phosphatase 19
Synonyms: C79103, 5930436K22Rik, SKRP1, TS-DSP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 68082
Homologene: 41565
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Col12a1
Name: collagen, type XII, alpha 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12816
HGNC: HGNC:2188
Homologene: 3217
Vmn2r103
Name: vomeronasal 2, receptor 103
Synonyms: EG627636
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 627636
Homologene: 115024
Tmem209
Name: transmembrane protein 209
Synonyms: 2700094F01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 72649
Homologene: 18021
Neb
Name: nebulin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Sptbn5
Name: spectrin beta, non-erythrocytic 5
Synonyms: EG640524, Spnb5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 640524
Homologene: 41150
Gdpd4
Name: glycerophosphodiester phosphodiesterase domain containing 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233537
Homologene: 18606
Irak3
Name: interleukin-1 receptor-associated kinase 3
Synonyms: IRAK-M, 4833428C18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 73914
Homologene: 36215
Gucy2g
Name: guanylate cyclase 2g
Synonyms: 2410077I05Rik, GC-G
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 73707
Homologene: 44544
Fshr
Name: follicle stimulating hormone receptor
Synonyms: follicle-stimulating hormone receptor, Follitropin receptor, FSH-R
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 14309
VEGA: 17
HGNC: HGNC:3969
Homologene: 117
Cspg4
Name: chondroitin sulfate proteoglycan 4
Synonyms: NG2, AN2, 4732461B14Rik, Cspg4a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 121021
VEGA: 9
HGNC: HGNC:2466
Homologene: 20445
Grm5
Name: glutamate receptor, metabotropic 5
Synonyms: mGluR5, Gprc1e, 6430542K11Rik, Glu5R
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 108071
HGNC: HGNC:4597
Homologene: 37354
Myo5b
Name: myosin VB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 17919
HGNC: HGNC:7603
Homologene: 49481
Pramel30
Name: PRAME like 30
Synonyms: Gm13128
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 626995
Homologene: 129642
Ugt3a1
Name: UDP glycosyltransferases 3 family, polypeptide A1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 105887
Homologene: 122787
Slc14a2
Name: solute carrier family 14 (urea transporter), member 2
Synonyms: UT-A3, UT-A5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 27411
VEGA: 18
Homologene: 5183
Mlxip
Name: MLX interacting protein
Synonyms: Mondoa, Mir, bHLHe36
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 208104
Homologene: 22851
Ttbk1
Name: tau tubulin kinase 1
Synonyms: C330008L01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 106763
VEGA: 17
Homologene: 50342
Smarca2
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
Synonyms: brm, Snf2l2, 2610209L14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 67155
Homologene: 2308
Tgfbrap1
Name: transforming growth factor, beta receptor associated protein 1
Synonyms: 3110018K12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 73122
Homologene: 3141
Asprv1
Name: aspartic peptidase, retroviral-like 1
Synonyms: Taps, TPA-induced aspartic proteinase-like, SASPase, SASP, 2300003P22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 67855
Homologene: 23582
Zfp109
Name: zinc finger protein 109
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 56869
Hivep3
Name: human immunodeficiency virus type I enhancer binding protein 3
Synonyms: Krc, 2900056N03Rik, E030045D18Rik, Shn3, Schnurri-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 16656
Homologene: 7803
Itpripl1
Name: inositol 1,4,5-triphosphate receptor interacting protein-like 1
Synonyms: 1700041B20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 73338
Homologene: 77641
Ttll10
Name: tubulin tyrosine ligase-like family, member 10
Synonyms: 4930595O22Rik, Ttll5, 4833412E22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 330010
Homologene: 51912
Musk
Name: muscle, skeletal, receptor tyrosine kinase
Synonyms: MDK4, Nsk1, Nsk2, Nsk3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18198
HGNC: HGNC:7525
Homologene: 4084
Pla2g12a
Name: phospholipase A2, group XIIA
Synonyms: 2310004B05Rik, mGXII-1, Pla2g12, GXII, Rossy
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 66350
Homologene: 11328
Slc26a3
Name: solute carrier family 26, member 3
Synonyms: Dra, 9030623B18Rik, 9130013M11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 13487
HGNC: HGNC:3018
Homologene: 55435
Fstl4
Name: follistatin-like 4
Synonyms: B230374F23Rik, SPIG1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 320027
Homologene: 18543
Potegl
Name: POTE ankyrin domain family, member G like
Synonyms: 4931423N10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 70981
Homologene: 86765
Mpp2
Name: membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)
Synonyms: Dlg2, Dlgh2, Pals4, D11Bwg0652e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 50997
HGNC: HGNC:7220
Homologene: 3920
Coq6
Name: coenzyme Q6 monooxygenase
Synonyms: 5930427M12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217707
Homologene: 6039
Sox13
Name: SRY (sex determining region Y)-box 13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20668
Homologene: 4159
Mrgprb4
Name: MAS-related GPR, member B4
Synonyms: MrgB4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233230
Homologene: 115575
Rfk
Name: riboflavin kinase
Synonyms: ATP:riboflavin 5'-phosphotransferase, flavokinase, 0610038L10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 54391
Homologene: 115690
Mab21l3
Name: mab-21-like 3
Synonyms: BC037703
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 242125
Homologene: 17564
Lurap1l
Name: leucine rich adaptor protein 1-like
Synonyms: 1110029A09Rik, WI-13707, D4Bwg0951e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 52829
Homologene: 12281
Stard10
Name: START domain containing 10
Synonyms: TISP-81, PC-TP2, Pctpl, PCTP2, NY-C0-28, CGI-52, Sdccag28
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 56018
Homologene: 4841
Hoxb1
Name: homeobox B1
Synonyms: Hox-2.9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 15407
HGNC: HGNC:5111
Homologene: 1615
9930111J21Rik2
Name: RIKEN cDNA 9930111J21 gene 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 245240
Olfr622
Name: olfactory receptor 622
Synonyms: GA_x6K02T2PBJ9-6362863-6361910, MOR26-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259087
Homologene: 100540
Mettl21a
Name: methyltransferase like 21A
Synonyms: 2310038H17Rik, Fam119a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67099
Homologene: 41658
Cmtm1
Name: CKLF-like MARVEL transmembrane domain containing 1
Synonyms: CHLFH1a, CKLFH1, Cklfsf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 100504164
Homologene: 134399
Scn2a1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Pts
Name: 6-pyruvoyl-tetrahydropterin synthase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 19286
VEGA: 9
HGNC: HGNC:9689
Homologene: 268
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 43,059,937 bp
  • A to G, chromosome 1 at 53,413,778 bp
  • A to T, chromosome 1 at 64,615,155 bp
  • A to G, chromosome 1 at 133,386,183 bp
  • T to C, chromosome 2 at 23,207,977 bp
  • T to C, chromosome 2 at 52,251,768 bp
  • T to A, chromosome 2 at 65,717,584 bp
  • T to C, chromosome 2 at 74,727,364 bp
  • T to A, chromosome 2 at 80,630,986 bp
  • T to C, chromosome 2 at 120,072,504 bp
  • T to C, chromosome 2 at 120,325,236 bp
  • T to C, chromosome 2 at 127,142,007 bp
  • T to C, chromosome 2 at 160,949,878 bp
  • C to T, chromosome 3 at 101,823,407 bp
  • A to G, chromosome 3 at 129,894,942 bp
  • A to G, chromosome 3 at 144,913,257 bp
  • A to T, chromosome 4 at 58,333,663 bp
  • T to A, chromosome 4 at 80,953,721 bp
  • G to T, chromosome 4 at 99,258,402 bp
  • T to C, chromosome 4 at 118,434,818 bp
  • T to C, chromosome 4 at 120,096,373 bp
  • T to C, chromosome 4 at 123,684,014 bp
  • A to G, chromosome 4 at 144,331,300 bp
  • A to T, chromosome 4 at 156,045,391 bp
  • T to A, chromosome 5 at 123,440,058 bp
  • T to A, chromosome 6 at 9,247,740 bp
  • A to T, chromosome 6 at 30,497,923 bp
  • T to A, chromosome 6 at 38,461,477 bp
  • T to A, chromosome 6 at 86,628,614 bp
  • T to C, chromosome 7 at 24,229,570 bp
  • T to C, chromosome 7 at 48,199,039 bp
  • C to A, chromosome 7 at 88,130,256 bp
  • A to T, chromosome 7 at 97,961,597 bp
  • A to G, chromosome 7 at 101,321,903 bp
  • A to C, chromosome 7 at 103,639,802 bp
  • T to C, chromosome 7 at 114,849,841 bp
  • A to G, chromosome 8 at 22,678,850 bp
  • A to T, chromosome 8 at 70,352,978 bp
  • CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT, chromosome 8 at 104,309,470 bp
  • A to G, chromosome 8 at 121,578,563 bp
  • T to A, chromosome 9 at 49,404,889 bp
  • C to T, chromosome 9 at 50,522,278 bp
  • T to A, chromosome 9 at 56,891,051 bp
  • A to T, chromosome 9 at 79,616,065 bp
  • T to C, chromosome 9 at 110,196,367 bp
  • G to A, chromosome 9 at 110,387,075 bp
  • T to G, chromosome 10 at 70,534,840 bp
  • A to T, chromosome 10 at 120,142,736 bp
  • A to C, chromosome 11 at 5,286,239 bp
  • T to A, chromosome 11 at 49,019,950 bp
  • T to C, chromosome 11 at 53,000,416 bp
  • A to G, chromosome 11 at 58,346,015 bp
  • A to G, chromosome 11 at 88,386,063 bp
  • A to G, chromosome 11 at 96,366,326 bp
  • T to A, chromosome 11 at 102,062,261 bp
  • T to C, chromosome 11 at 109,678,431 bp
  • T to A, chromosome 12 at 31,448,843 bp
  • C to A, chromosome 12 at 84,366,907 bp
  • A to C, chromosome 13 at 92,706,202 bp
  • A to T, chromosome 15 at 6,750,716 bp
  • A to C, chromosome 15 at 9,306,344 bp
  • A to T, chromosome 15 at 38,002,233 bp
  • T to C, chromosome 15 at 99,423,576 bp
  • C to T, chromosome 16 at 32,751,916 bp
  • T to A, chromosome 16 at 97,568,983 bp
  • A to T, chromosome 17 at 19,794,939 bp
  • A to T, chromosome 17 at 34,192,894 bp
  • T to C, chromosome 17 at 46,479,207 bp
  • C to T, chromosome 17 at 74,631,620 bp
  • T to A, chromosome 17 at 88,986,396 bp
  • G to T, chromosome 18 at 74,742,175 bp
  • T to C, chromosome 18 at 78,158,336 bp
  • G to T, chromosome 19 at 8,708,230 bp
  • A to T, chromosome 19 at 17,398,638 bp
  • A to T, chromosome 19 at 26,649,122 bp
  • A to C, chromosome 19 at 55,233,155 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5715 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
043336-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.