Strain Name:
C57BL/6J-MtgxR5715Btlr/Mmmh
Stock Number:
043336-MU
Citation ID:
RRID:MMRRC_043336-MU
Other Names:
R5715 (G1)
Major Collection:

Strain Information

Ubn2
Name: ubinuclein 2
Synonyms: 2900060J04Rik, D130059P03Rik, 6030408G03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320538
Homologene: 45564
Drd2
Name: dopamine receptor D2
Synonyms: D2R, Drd-2, D2 receptor
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13489
VEGA: 9
HGNC: HGNC:3023
Homologene: 22561
Upf1
Name: UPF1 RNA helicase and ATPase
Synonyms: PNORF-1, B430202H16Rik, Rent1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19704
HGNC: HGNC:9962
Homologene: 2185
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Aclp7, trabeculin alpha, Acf7
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Ubr5
Name: ubiquitin protein ligase E3 component n-recognin 5
Synonyms: Edd, 4432411E13Rik, Edd1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70790
VEGA: 15
Homologene: 9295
Msi2
Name: musashi RNA-binding protein 2
Synonyms: msi2h, Musashi2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76626
Homologene: 62199
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, 4921505C17Rik, D530039E11Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Smarcc1
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1
Synonyms: BAF155, SRG3, msp3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20588
Homologene: 68296
Fbxo31
Name: F-box protein 31
Synonyms: Fbx14, 2310046N15Rik, Fbxo14, 1110003O08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76454
Homologene: 11684
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: A430040A19Rik, D630005A10Rik, apollon, A430032G04Rik, Bruce
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Ptpn23
Name: protein tyrosine phosphatase, non-receptor type 23
Synonyms: PTP-TD14
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 104831
Homologene: 135706
Vps39
Name: VPS39 HOPS complex subunit
Synonyms: mVam6, Vam6, Vam6P, A230065P22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269338
Homologene: 41025
Nckap5l
Name: NCK-associated protein 5-like
Synonyms: C230021P08Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 380969
Homologene: 18924
Atg4c
Name: autophagy related 4C, cysteine peptidase
Synonyms: Apg4-C, Autl1, autophagin 3, Apg4c
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242557
Homologene: 56296
Dnah7a
Name: dynein, axonemal, heavy chain 7A
Synonyms: Dnahc7, LOC381341, Dnahc7a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 627872
Homologene: 41287
Serinc5
Name: serine incorporator 5
Synonyms: TPO1, A130038L21Rik, AIGP3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218442
VEGA: 13
Homologene: 65246
Tap1
Name: transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
Synonyms: Tap-1, MTP1, Abcb2, RING4, Ham-1, TAP, PSF-1, Ham1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21354
HGNC: HGNC:43
Homologene: 495
Clca4b
Name: chloride channel accessory 4B
Synonyms: AI747448
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99709
HGNC: HGNC:2018
Homologene: 40808
Slc3a2
Name: solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2
Synonyms: 4F2HC, Ly-m10, Ly-10, Cd98, Mdu1, Mgp-2hc
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 17254
Homologene: 1795
Ikbkb
Name: inhibitor of kappaB kinase beta
Synonyms: IKK2, IKK-2, IKK[b], IKKbeta, IKK-beta
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16150
HGNC: HGNC:5960
Homologene: 7782
Cdc20
Name: cell division cycle 20
Synonyms: 2310042N09Rik, p55CDC
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 107995
HGNC: HGNC:1723
Homologene: 37459
Chd6
Name: chromodomain helicase DNA binding protein 6
Synonyms: 5430439G14Rik, 6330406J24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71389
Homologene: 32772
Fam13c
Name: family with sequence similarity 13, member C
Synonyms: C030038O19Rik, 1200015N20Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71721
Homologene: 11490
Sh3bp5l
Name: SH3 binding domain protein 5 like
Synonyms: 2310074E09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 79566
Homologene: 32584
Znrf3
Name: zinc and ring finger 3
Synonyms: LOC382477
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 407821
Homologene: 46592
Tmprss2
Name: transmembrane protease, serine 2
Synonyms: epitheliasin, D16Ertd61e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 50528
VEGA: 16
Homologene: 4136
Hoxd4
Name: homeobox D4
Synonyms: Hox-4.2, Hox-5.1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15436
HGNC: HGNC:5138
Homologene: 7773
Nxph1
Name: neurexophilin 1
Synonyms: C130005L03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18231
Homologene: 8284
Insc
Name: INSC spindle orientation adaptor protein
Synonyms: Inscuteable, 3830422K02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233752
Homologene: 78662
Fam20a
Name: FAM20A, golgi associated secretory pathway pseudokinase
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 208659
Homologene: 9719
Dusp19
Name: dual specificity phosphatase 19
Synonyms: C79103, 5930436K22Rik, TS-DSP1, SKRP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68082
Homologene: 41565
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Col12a1
Name: collagen, type XII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12816
HGNC: HGNC:2188
Homologene: 3217
Vmn2r103
Name: vomeronasal 2, receptor 103
Synonyms: EG627636
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627636
Homologene: 115024
Tmem209
Name: transmembrane protein 209
Synonyms: 2700094F01Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72649
Homologene: 18021
Sptbn5
Name: spectrin beta, non-erythrocytic 5
Synonyms: EG640524, Spnb5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 640524
Homologene: 41150
Gdpd4
Name: glycerophosphodiester phosphodiesterase domain containing 4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233537
Homologene: 18606
Irak3
Name: interleukin-1 receptor-associated kinase 3
Synonyms: IRAK-M, 4833428C18Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73914
Homologene: 36215
Gucy2g
Name: guanylate cyclase 2g
Synonyms: GC-G, 2410077I05Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73707
Homologene: 44544
Fshr
Name: follicle stimulating hormone receptor
Synonyms: follicle-stimulating hormone receptor, Follitropin receptor, FSH-R
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14309
VEGA: 17
HGNC: HGNC:3969
Homologene: 117
Cspg4
Name: chondroitin sulfate proteoglycan 4
Synonyms: Cspg4a, NG2, 4732461B14Rik, AN2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 121021
VEGA: 9
HGNC: HGNC:2466
Homologene: 20445
Grm5
Name: glutamate receptor, metabotropic 5
Synonyms: Gprc1e, Glu5R, mGluR5, 6430542K11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 108071
HGNC: HGNC:4597
Homologene: 37354
Ugt3a2
Name: UDP glycosyltransferases 3 family, polypeptide A2
Synonyms: Ugt3a, Ugt3a1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105887
Homologene: 122787
Slc14a2
Name: solute carrier family 14 (urea transporter), member 2
Synonyms: UT-A3, UT-A5
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 27411
VEGA: 18
Homologene: 5183
Mlxip
Name: MLX interacting protein
Synonyms: Mir, Mondoa, bHLHe36
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208104
Homologene: 22851
Ttbk1
Name: tau tubulin kinase 1
Synonyms: C330008L01Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106763
VEGA: 17
Homologene: 50342
Smarca2
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
Synonyms: brm, 2610209L14Rik, Snf2l2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 67155
Homologene: 2308
Tgfbrap1
Name: transforming growth factor, beta receptor associated protein 1
Synonyms: 3110018K12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73122
Homologene: 3141
Asprv1
Name: aspartic peptidase, retroviral-like 1
Synonyms: 2300003P22Rik, TPA-induced aspartic proteinase-like, Taps, SASPase, SASP
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67855
Homologene: 23582
Hivep3
Name: human immunodeficiency virus type I enhancer binding protein 3
Synonyms: Schnurri-3, E030045D18Rik, Shn3, 2900056N03Rik, Krc
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16656
Homologene: 7803
Itpripl1
Name: inositol 1,4,5-triphosphate receptor interacting protein-like 1
Synonyms: 1700041B20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 73338
Homologene: 77641
Ttll10
Name: tubulin tyrosine ligase-like family, member 10
Synonyms: 4833412E22Rik, Ttll5, 4930595O22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 330010
Homologene: 51912
Musk
Name: muscle, skeletal, receptor tyrosine kinase
Synonyms: Nsk1, MDK4, Nsk3, Nsk2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18198
HGNC: HGNC:7525
Homologene: 4084
Pla2g12a
Name: phospholipase A2, group XIIA
Synonyms: Pla2g12, mGXII-1, 2310004B05Rik, GXII, Rossy
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66350
Homologene: 11328
Slc26a3
Name: solute carrier family 26, member 3
Synonyms: Dra, 9030623B18Rik, 9130013M11Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13487
HGNC: HGNC:3018
Homologene: 55435
Fstl4
Name: follistatin-like 4
Synonyms: B230374F23Rik, SPIG1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 320027
Homologene: 18543
Mpp2
Name: membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)
Synonyms: Dlgh2, Pals4, Dlg2, D11Bwg0652e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 50997
HGNC: HGNC:7220
Homologene: 3920
Coq6
Name: coenzyme Q6 monooxygenase
Synonyms: 5930427M12Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217707
Homologene: 6039
Sox13
Name: SRY (sex determining region Y)-box 13
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20668
Homologene: 4159
Mrgprb4
Name: MAS-related GPR, member B4
Synonyms: MrgB4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233230
Homologene: 115575
Rfk
Name: riboflavin kinase
Synonyms: flavokinase, 0610038L10Rik, ATP:riboflavin 5'-phosphotransferase
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 54391
Homologene: 115690
Mab21l3
Name: mab-21-like 3
Synonyms: BC037703
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242125
Homologene: 17564
Lurap1l
Name: leucine rich adaptor protein 1-like
Synonyms: D4Bwg0951e, 1110029A09Rik, WI-13707
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 52829
Homologene: 12281
Stard10
Name: StAR related lipid transfer domain containing 10
Synonyms: CGI-52, Sdccag28, TISP-81, Pctpl, PCTP2, PC-TP2, NY-C0-28
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56018
Homologene: 4841
Hoxb1
Name: homeobox B1
Synonyms: Hox-2.9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15407
HGNC: HGNC:5111
Homologene: 1615
Or52a33
Name: olfactory receptor family 52 subfamily A member 33
Synonyms: GA_x6K02T2PBJ9-6362863-6361910, Olfr622, MOR26-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259087
Homologene: 100540
Mettl21a
Name: methyltransferase 21A, HSPA lysine
Synonyms: 2310038H17Rik, Fam119a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67099
Homologene: 41658
Cmtm1
Name: CKLF-like MARVEL transmembrane domain containing 1
Synonyms: CHLFH1a, Cklfsf1, CKLFH1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100504164
Homologene: 134399
Scn2a1
Name:
Type: Gene
Species: Mouse
Chromosome: 2
Pts
Name: 6-pyruvoyl-tetrahydropterin synthase
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19286
VEGA: 9
HGNC: HGNC:9689
Homologene: 268
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 43,059,937 bp
  • A to G, chromosome 1 at 53,413,778 bp
  • A to T, chromosome 1 at 64,615,155 bp
  • A to G, chromosome 1 at 133,386,183 bp
  • T to C, chromosome 2 at 23,207,977 bp
  • T to C, chromosome 2 at 52,251,768 bp
  • T to A, chromosome 2 at 65,717,584 bp
  • T to C, chromosome 2 at 74,727,364 bp
  • T to A, chromosome 2 at 80,630,986 bp
  • T to C, chromosome 2 at 120,072,504 bp
  • T to C, chromosome 2 at 120,325,236 bp
  • T to C, chromosome 2 at 127,142,007 bp
  • T to C, chromosome 2 at 160,949,878 bp
  • C to T, chromosome 3 at 101,823,407 bp
  • A to G, chromosome 3 at 129,894,942 bp
  • A to G, chromosome 3 at 144,913,257 bp
  • A to T, chromosome 4 at 58,333,663 bp
  • T to A, chromosome 4 at 80,953,721 bp
  • G to T, chromosome 4 at 99,258,402 bp
  • T to C, chromosome 4 at 118,434,818 bp
  • T to C, chromosome 4 at 120,096,373 bp
  • T to C, chromosome 4 at 123,684,014 bp
  • A to G, chromosome 4 at 144,331,300 bp
  • A to T, chromosome 4 at 156,045,391 bp
  • T to A, chromosome 5 at 123,440,058 bp
  • T to A, chromosome 6 at 9,247,740 bp
  • A to T, chromosome 6 at 30,497,923 bp
  • T to A, chromosome 6 at 38,461,477 bp
  • T to A, chromosome 6 at 86,628,614 bp
  • T to C, chromosome 7 at 24,229,570 bp
  • T to C, chromosome 7 at 48,199,039 bp
  • C to A, chromosome 7 at 88,130,256 bp
  • A to T, chromosome 7 at 97,961,597 bp
  • A to G, chromosome 7 at 101,321,903 bp
  • A to C, chromosome 7 at 103,639,802 bp
  • T to C, chromosome 7 at 114,849,841 bp
  • A to G, chromosome 8 at 22,678,850 bp
  • A to T, chromosome 8 at 70,352,978 bp
  • CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT, chromosome 8 at 104,309,470 bp
  • A to G, chromosome 8 at 121,578,563 bp
  • T to A, chromosome 9 at 49,404,889 bp
  • C to T, chromosome 9 at 50,522,278 bp
  • T to A, chromosome 9 at 56,891,051 bp
  • A to T, chromosome 9 at 79,616,065 bp
  • T to C, chromosome 9 at 110,196,367 bp
  • G to A, chromosome 9 at 110,387,075 bp
  • T to G, chromosome 10 at 70,534,840 bp
  • A to T, chromosome 10 at 120,142,736 bp
  • A to C, chromosome 11 at 5,286,239 bp
  • T to A, chromosome 11 at 49,019,950 bp
  • T to C, chromosome 11 at 53,000,416 bp
  • A to G, chromosome 11 at 58,346,015 bp
  • A to G, chromosome 11 at 88,386,063 bp
  • A to G, chromosome 11 at 96,366,326 bp
  • T to A, chromosome 11 at 102,062,261 bp
  • T to C, chromosome 11 at 109,678,431 bp
  • T to A, chromosome 12 at 31,448,843 bp
  • C to A, chromosome 12 at 84,366,907 bp
  • A to C, chromosome 13 at 92,706,202 bp
  • A to T, chromosome 15 at 6,750,716 bp
  • A to C, chromosome 15 at 9,306,344 bp
  • A to T, chromosome 15 at 38,002,233 bp
  • T to C, chromosome 15 at 99,423,576 bp
  • C to T, chromosome 16 at 32,751,916 bp
  • T to A, chromosome 16 at 97,568,983 bp
  • A to T, chromosome 17 at 19,794,939 bp
  • A to T, chromosome 17 at 34,192,894 bp
  • T to C, chromosome 17 at 46,479,207 bp
  • C to T, chromosome 17 at 74,631,620 bp
  • T to A, chromosome 17 at 88,986,396 bp
  • G to T, chromosome 18 at 74,742,175 bp
  • T to C, chromosome 18 at 78,158,336 bp
  • G to T, chromosome 19 at 8,708,230 bp
  • A to T, chromosome 19 at 17,398,638 bp
  • A to T, chromosome 19 at 26,649,122 bp
  • A to C, chromosome 19 at 55,233,155 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5715 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043336-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.