Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5783Btlr/Mmmh
Stock Number:
043380-MU
Citation ID:
RRID:MMRRC_043380-MU
Other Names:
R5783 (G1)
Major Collection:

Strain Information

St8sia1
Name: ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1
Synonyms: alpha-2,8-sialyltransferase, ST8Sia I, GD3S, GD3 synthase, Siat8, Siat8a, 9330109E03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20449
Homologene: 2282
Mtss1
Name: MTSS I-BAR domain containing 1
Synonyms: MIM, D130001D01Rik, 2310003N14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 211401
VEGA: 15
Homologene: 8841
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: DNA-PKcs, slip, DNAPDcs, XRCC7, DNA-PK, DOXNPH, dxnph
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Rapgef2
Name: Rap guanine nucleotide exchange factor (GEF) 2
Synonyms: 5830453M24Rik, Pdzgef1, RA-GEF-1, CNRasGEF, nRapGEP
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76089
Homologene: 35477
Kcnc4
Name: potassium voltage gated channel, Shaw-related subfamily, member 4
Synonyms: Kv3.4, Kcr2-4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99738
HGNC: HGNC:6236
Homologene: 68427
Zfp638
Name: zinc finger protein 638
Synonyms: Np220, Zfml
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18139
Homologene: 7447
Chka
Name: choline kinase alpha
Synonyms: choline/ethanolamine kinase alpha, CK/EK-alpha, ChoK, EtnK-alpha, Chk
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12660
HGNC: HGNC:1937
Homologene: 88575
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 162,355,471 bp
  • A to T, chromosome 1 at 191,354,640 bp
  • T to C, chromosome 2 at 86,508,638 bp
  • C to T, chromosome 2 at 112,652,998 bp
  • A to C, chromosome 2 at 130,739,083 bp
  • T to C, chromosome 3 at 54,794,442 bp
  • T to G, chromosome 3 at 79,087,993 bp
  • T to C, chromosome 3 at 89,088,145 bp
  • T to C, chromosome 3 at 96,221,299 bp
  • T to C, chromosome 3 at 107,447,872 bp
  • A to G, chromosome 3 at 135,261,580 bp
  • TTTAATGAAGAGCT to TT, chromosome 4 at 34,771,261 bp
  • A to T, chromosome 4 at 59,076,239 bp
  • T to G, chromosome 5 at 114,064,935 bp
  • A to T, chromosome 6 at 29,206,343 bp
  • G to A, chromosome 6 at 34,753,533 bp
  • C to T, chromosome 6 at 83,118,671 bp
  • G to A, chromosome 6 at 83,944,847 bp
  • T to C, chromosome 6 at 90,619,542 bp
  • T to C, chromosome 6 at 142,963,614 bp
  • G to T, chromosome 7 at 45,310,389 bp
  • T to A, chromosome 7 at 83,895,675 bp
  • A to T, chromosome 7 at 103,928,942 bp
  • C to A, chromosome 7 at 106,873,334 bp
  • A to C, chromosome 7 at 109,894,636 bp
  • G to T, chromosome 7 at 141,858,428 bp
  • C to A, chromosome 8 at 71,932,464 bp
  • A to G, chromosome 8 at 105,386,980 bp
  • A to G, chromosome 9 at 26,882,336 bp
  • G to T, chromosome 9 at 55,397,803 bp
  • A to G, chromosome 9 at 57,446,070 bp
  • T to G, chromosome 9 at 123,461,596 bp
  • T to A, chromosome 10 at 111,267,783 bp
  • T to C, chromosome 11 at 6,405,081 bp
  • T to A, chromosome 11 at 23,518,787 bp
  • A to C, chromosome 11 at 98,390,464 bp
  • A to G, chromosome 12 at 8,001,022 bp
  • A to G, chromosome 12 at 72,456,053 bp
  • T to A, chromosome 12 at 84,650,477 bp
  • T to A, chromosome 12 at 98,757,175 bp
  • A to G, chromosome 13 at 30,545,204 bp
  • T to C, chromosome 15 at 44,746,414 bp
  • C to T, chromosome 15 at 58,943,524 bp
  • C to T, chromosome 15 at 101,359,479 bp
  • T to C, chromosome 16 at 15,717,801 bp
  • C to A, chromosome 17 at 12,877,446 bp
  • TGAAGAAGAAGAAGAAGAAGAAGAAGAAG to TGAAGAAGAAGAAGAAGAAGAAG, chromosome 17 at 46,412,514 bp
  • T to C, chromosome 17 at 56,211,655 bp
  • T to C, chromosome 18 at 36,962,481 bp
  • A to G, chromosome 19 at 3,864,661 bp
  • A to C, chromosome 19 at 6,853,916 bp
  • G to T, chromosome 19 at 10,200,830 bp
  • G to T, chromosome 19 at 15,956,359 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5783 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043380-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.