Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5884Btlr/Mmmh
Stock Number:
044087-MU
Citation ID:
RRID:MMRRC_044087-MU
Other Names:
R5884 (G1)
Major Collection:

Strain Information

Ide
Name: insulin degrading enzyme
Synonyms: 1300012G03Rik, 4833415K22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 15925
HGNC: HGNC:5381
Homologene: 3645
Emx2
Name: empty spiracles homeobox 2
Synonyms: Pdo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13797
HGNC: HGNC:3341
Homologene: 3023
Cacna1g
Name: calcium channel, voltage-dependent, T type, alpha 1G subunit
Synonyms: a1G, Cav3.1d
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12291
HGNC: HGNC:1394
Homologene: 22544
Psmb2
Name: proteasome (prosome, macropain) subunit, beta type 2
Synonyms: HC7-I, D4Wsu33e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 26445
HGNC: HGNC:9539
Homologene: 2088
Gpa33
Name: glycoprotein A33 transmembrane
Synonyms: A33 antigen, 2210401D16Rik, 2010310L10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 59290
HGNC: HGNC:4445
Homologene: 4245
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 33,724,886 bp
  • T to C, chromosome 1 at 44,117,100 bp
  • G to A, chromosome 1 at 164,195,646 bp
  • T to C, chromosome 1 at 166,152,760 bp
  • T to C, chromosome 1 at 181,187,541 bp
  • T to A, chromosome 2 at 85,777,055 bp
  • A to G, chromosome 2 at 88,093,796 bp
  • T to A, chromosome 2 at 120,404,124 bp
  • A to T, chromosome 2 at 164,404,608 bp
  • T to C, chromosome 3 at 5,561,299 bp
  • A to T, chromosome 3 at 10,316,224 bp
  • C to T, chromosome 3 at 152,368,330 bp
  • T to C, chromosome 3 at 152,450,658 bp
  • A to T, chromosome 4 at 11,199,411 bp
  • A to G, chromosome 4 at 75,982,690 bp
  • T to A, chromosome 4 at 126,684,221 bp
  • A to G, chromosome 4 at 130,312,338 bp
  • A to T, chromosome 5 at 53,069,380 bp
  • A to G, chromosome 5 at 110,216,895 bp
  • A to T, chromosome 5 at 124,603,832 bp
  • T to C, chromosome 6 at 24,743,369 bp
  • T to A, chromosome 6 at 57,259,008 bp
  • C to T, chromosome 6 at 78,428,217 bp
  • T to A, chromosome 6 at 84,186,081 bp
  • C to A, chromosome 7 at 6,501,843 bp
  • T to A, chromosome 7 at 49,597,169 bp
  • A to C, chromosome 7 at 86,165,370 bp
  • A to C, chromosome 7 at 119,772,329 bp
  • A to G, chromosome 7 at 126,970,156 bp
  • C to T, chromosome 8 at 22,088,801 bp
  • A to G, chromosome 8 at 86,641,626 bp
  • A to C, chromosome 8 at 92,360,630 bp
  • A to G, chromosome 8 at 93,306,930 bp
  • C to T, chromosome 8 at 124,751,769 bp
  • A to G, chromosome 9 at 44,404,088 bp
  • T to C, chromosome 9 at 75,898,554 bp
  • A to G, chromosome 9 at 78,328,557 bp
  • C to T, chromosome 10 at 119,213,765 bp
  • A to G, chromosome 11 at 43,443,418 bp
  • C to T, chromosome 11 at 94,437,867 bp
  • A to G, chromosome 11 at 108,570,316 bp
  • GAAAAGGAAACTATTTAAAA to GAAAA, chromosome 12 at 11,457,533 bp
  • A to T, chromosome 12 at 114,320,186 bp
  • A to T, chromosome 12 at 118,177,534 bp
  • C to T, chromosome 14 at 14,116,526 bp
  • T to A, chromosome 14 at 56,614,750 bp
  • A to T, chromosome 16 at 19,061,991 bp
  • C to G, chromosome 16 at 35,932,233 bp
  • T to A, chromosome 16 at 70,528,875 bp
  • A to T, chromosome 18 at 10,099,361 bp
  • A to T, chromosome 19 at 37,272,153 bp
  • T to G, chromosome 19 at 59,464,029 bp
  • C to T, chromosome 19 at 61,175,926 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5884 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044087-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.