Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5884Btlr/Mmmh
Stock Number:
044087-MU
Citation ID:
RRID:MMRRC_044087-MU
Other Names:
R5884 (G1)
Major Collection:

Strain Information

Ide
Name: insulin degrading enzyme
Synonyms: 1300012G03Rik, 4833415K22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 15925
HGNC: HGNC:5381
Homologene: 3645
Emx2
Name: empty spiracles homeobox 2
Synonyms: Pdo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13797
HGNC: HGNC:3341
Homologene: 3023
Cacna1g
Name: calcium channel, voltage-dependent, T type, alpha 1G subunit
Synonyms: a1G, Cav3.1d
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12291
HGNC: HGNC:1394
Homologene: 22544
Psmb2
Name: proteasome (prosome, macropain) subunit, beta type 2
Synonyms: HC7-I, D4Wsu33e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 26445
HGNC: HGNC:9539
Homologene: 2088
Gpa33
Name: glycoprotein A33 transmembrane
Synonyms: A33 antigen, 2210401D16Rik, 2010310L10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 59290
HGNC: HGNC:4445
Homologene: 4245
Nav2
Name: neuron navigator 2
Synonyms: POMFIL2, Unc53H2, HELAD1, RAINB2, 5330421F07Rik, Rainb1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 78286
Homologene: 52330
Tmem87a
Name: transmembrane protein 87A
Synonyms: A930025J12Rik, Elkin1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 211499
Homologene: 9165
Parp4
Name: poly (ADP-ribose) polymerase family, member 4
Synonyms: VPARP, VAULT3, p193, PH5P, E230037B21Rik, Adprtl1, C030027K23Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 328417
HGNC: HGNC:271
Homologene: 124423
Slu7
Name: SLU7 splicing factor homolog (S. cerevisiae)
Synonyms: D3Bwg0878e, D11Ertd730e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 193116
Homologene: 4690
Lonp2
Name: lon peptidase 2, peroxisomal
Synonyms: 1300002A08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66887
Homologene: 12050
Wdr26
Name: WD repeat domain 26
Synonyms: 1600024A01Rik, Gid7
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226757
Homologene: 11857
Trappc4
Name: trafficking protein particle complex 4
Synonyms: Sbd, 1500017G03Rik, HSPC172, PTD009, TRS23, Sbdn
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 60409
VEGA: 9
Homologene: 105453
Rock1
Name: Rho-associated coiled-coil containing protein kinase 1
Synonyms: Rock-I, 1110055K06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 19877
VEGA: 18
Homologene: 55899
Fabp3
Name: fatty acid binding protein 3, muscle and heart
Synonyms: H-FABP, Fabph-4, Fabph-1, Fabph4, Fabph1, Mdgi, Fabp3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14077
HGNC: HGNC:3557
Homologene: 68379
Sez6l2
Name: seizure related 6 homolog like 2
Synonyms: Psk1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233878
Homologene: 8237
Zzz3
Name: zinc finger, ZZ domain containing 3
Synonyms: 3110065C23Rik, 6430567E01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 108946
Homologene: 9182
Cand1
Name: cullin associated and neddylation disassociated 1
Synonyms: 6330512O03Rik, 2310038O07Rik, D10Ertd516e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71902
Homologene: 10202
Golga3
Name: golgin A3
Synonyms: Mea-2, Mea2, 5430416E01Rik, G1-499-14, repro27
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269682
HGNC: HGNC:4426
Homologene: 4308
Rab23
Name: RAB23, member RAS oncogene family
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19335
Homologene: 7503
Usp33
Name: ubiquitin specific peptidase 33
Synonyms: Vdu1, 9830169D19Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 170822
Homologene: 8996
Mplkipl1
Name: M-phase specific PLK1 intereacting protein like 1
Synonyms: Gm7102
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 633057
Pex2
Name: peroxisomal biogenesis factor 2
Synonyms: PMP35, D3Ertd138e, Pxmp3, Zellweger syndrome homolog
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 19302
HGNC: HGNC:9717
Homologene: 269
Ptprd
Name: protein tyrosine phosphatase receptor type D
Synonyms: 3000002J10Rik, B230219D21Rik, 1110002J03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19266
HGNC: HGNC:9668
Dnah11
Name: dynein, axonemal, heavy chain 11
Synonyms: lrd, b2b1279Clo, b2b1203Clo, b2b598Clo, b2b1289Clo, b2b1727Clo, Dnahc11, avc4
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13411
HGNC: HGNC:2942
Homologene: 2801
F5
Name: coagulation factor V
Synonyms: Cf-5, Cf5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14067
HGNC: HGNC:3542
Homologene: 104
Gbe1
Name: 1,4-alpha-glucan branching enzyme 1
Synonyms: 2310045H19Rik, 2810426P10Rik, D16Ertd536e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74185
HGNC: HGNC:4180
Homologene: 129
Vmn2r75
Name: vomeronasal 2, receptor 75
Synonyms: EG546981
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 546981
Homologene: 115466
Slc34a2
Name: solute carrier family 34 (sodium phosphate), member 2
Synonyms: type IIb Na/Picotransporter, Npt2b, NaPi-2b, D5Ertd227e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20531
Homologene: 2297
Tctn2
Name: tectonic family member 2
Synonyms: Tect2, 4432405B04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 67978
Homologene: 11729
Eri2
Name: exoribonuclease 2
Synonyms: 4933424N09Rik, Exod1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71151
Homologene: 12383
Impa1
Name: inositol (myo)-1(or 4)-monophosphatase 1
Synonyms: lithium-sensitive myo-inositol monophosphatase A1, 2610002K09Rik, 2900059K10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 55980
HGNC: HGNC:6050
Homologene: 4043
Rad51ap2
Name: RAD51 associated protein 2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 209550
VEGA: 12
Homologene: 85245
Or5d37
Name: olfactory receptor family 5 subfamily D member 37
Synonyms: GA_x6K02T2Q125-49585842-49584862, MOR174-11, Olfr1164
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258634
Homologene: 74077
Fam89a
Name: family with sequence similarity 89, member A
Synonyms: 2310031A18Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69627
Homologene: 18887
Ces1g
Name: carboxylesterase 1G
Synonyms: Ces-1, Ses-1, Ces1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12623
Homologene: 137354
Poglut2
Name: protein O-glucosyltransferase 2
Synonyms: EP58, 1810049A15Rik, 5730416C13Rik, Kdel1, Kdelc1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72050
Homologene: 11367
Hyal6
Name: hyaluronoglucosaminidase 6
Synonyms: 4932701A20Rik, Hyal-ps1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74409
HGNC: HGNC:5324
Homologene: 78028
Omt2b
Name: oocyte maturation, beta
Synonyms: OM2b
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382088
Homologene: 136010
Nek5
Name: NIMA (never in mitosis gene a)-related expressed kinase 5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 330721
HGNC: HGNC:7748
Homologene: 87952
Vmn1r15
Name: vomeronasal 1 receptor 15
Synonyms: V1rc6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113863
Homologene: 123826
Dtx3l
Name: deltex 3-like, E3 ubiquitin ligase
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 209200
Homologene: 51375
Reg1
Name: regenerating islet-derived 1
Synonyms: pancreatic stone protein
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19692
Homologene: 68282
Cep112
Name: centrosomal protein 112
Synonyms: 1700001M19Rik, 1700029K01Rik, 8430407H02Rik, Macoco, Ccdc46
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76380
Homologene: 44915
Irx5
Name: Iroquois homeobox 5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54352
Homologene: 38105
Bmp5
Name: bone morphogenetic protein 5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12160
HGNC: HGNC:1072
Homologene: 22412
Or9g8
Name: olfactory receptor family 9 subfamily G member 8
Synonyms: GA_x6K02T2Q125-47255337-47256254, MOR213-5, Olfr1014
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258562
Homologene: 83447
Psmd6
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 6
Synonyms: 2400006A19Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66413
HGNC: HGNC:9564
Homologene: 7157
Or6z1
Name: olfactory receptor family 6 subfamily Z member 1
Synonyms: GA_x6K02T2QGBW-3232059-3231121, MOR103-9, Olfr1348
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258915
Homologene: 17435
Matn4
Name: matrilin 4
Synonyms: matrilin-4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17183
HGNC: HGNC:6910
Homologene: 2844
Ighv5-21
Name: immunoglobulin heavy variable V5-21
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 780832
Iglc1
Name: immunoglobulin lambda constant 1
Synonyms: Clambda1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 110785
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 33,724,886 bp
  • T to C, chromosome 1 at 44,117,100 bp
  • G to A, chromosome 1 at 164,195,646 bp
  • T to C, chromosome 1 at 166,152,760 bp
  • T to C, chromosome 1 at 181,187,541 bp
  • T to A, chromosome 2 at 85,777,055 bp
  • A to G, chromosome 2 at 88,093,796 bp
  • T to A, chromosome 2 at 120,404,124 bp
  • A to T, chromosome 2 at 164,404,608 bp
  • T to C, chromosome 3 at 5,561,299 bp
  • A to T, chromosome 3 at 10,316,224 bp
  • C to T, chromosome 3 at 152,368,330 bp
  • T to C, chromosome 3 at 152,450,658 bp
  • A to T, chromosome 4 at 11,199,411 bp
  • A to G, chromosome 4 at 75,982,690 bp
  • T to A, chromosome 4 at 126,684,221 bp
  • A to G, chromosome 4 at 130,312,338 bp
  • A to T, chromosome 5 at 53,069,380 bp
  • A to G, chromosome 5 at 110,216,895 bp
  • A to T, chromosome 5 at 124,603,832 bp
  • T to C, chromosome 6 at 24,743,369 bp
  • T to A, chromosome 6 at 57,259,008 bp
  • C to T, chromosome 6 at 78,428,217 bp
  • T to A, chromosome 6 at 84,186,081 bp
  • C to A, chromosome 7 at 6,501,843 bp
  • T to A, chromosome 7 at 49,597,169 bp
  • A to C, chromosome 7 at 86,165,370 bp
  • A to C, chromosome 7 at 119,772,329 bp
  • A to G, chromosome 7 at 126,970,156 bp
  • C to T, chromosome 8 at 22,088,801 bp
  • A to G, chromosome 8 at 86,641,626 bp
  • A to C, chromosome 8 at 92,360,630 bp
  • A to G, chromosome 8 at 93,306,930 bp
  • C to T, chromosome 8 at 124,751,769 bp
  • A to G, chromosome 9 at 44,404,088 bp
  • T to C, chromosome 9 at 75,898,554 bp
  • A to G, chromosome 9 at 78,328,557 bp
  • C to T, chromosome 10 at 119,213,765 bp
  • A to G, chromosome 11 at 43,443,418 bp
  • C to T, chromosome 11 at 94,437,867 bp
  • A to G, chromosome 11 at 108,570,316 bp
  • GAAAAGGAAACTATTTAAAA to GAAAA, chromosome 12 at 11,457,533 bp
  • A to T, chromosome 12 at 114,320,186 bp
  • A to T, chromosome 12 at 118,177,534 bp
  • C to T, chromosome 14 at 14,116,526 bp
  • T to A, chromosome 14 at 56,614,750 bp
  • A to T, chromosome 16 at 19,061,991 bp
  • C to G, chromosome 16 at 35,932,233 bp
  • T to A, chromosome 16 at 70,528,875 bp
  • A to T, chromosome 18 at 10,099,361 bp
  • A to T, chromosome 19 at 37,272,153 bp
  • T to G, chromosome 19 at 59,464,029 bp
  • C to T, chromosome 19 at 61,175,926 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5884 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044087-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.