Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5913Btlr/Mmmh
Stock Number:
044110-MU
Citation ID:
RRID:MMRRC_044110-MU
Other Names:
R5913 (G1)
Major Collection:

Strain Information

Gulo
Name: gulonolactone (L-) oxidase
Synonyms: L-gulono-gamma-lactone oxidase, sfx
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 268756
VEGA: 14
HGNC: HGNC:4695
Homologene: 6566
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Pcif1
Name: phosphorylated CTD interacting factor 1
Synonyms: 2310022K11Rik, F730014I05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228866
Homologene: 11134
Cxcl17
Name: C-X-C motif chemokine ligand 17
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232983
Homologene: 18875
Tbc1d22a
Name: TBC1 domain family, member 22a
Synonyms: D15Ertd781e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223754
VEGA: 15
HGNC: HGNC:1309
Homologene: 105406
Zeb1
Name: zinc finger E-box binding homeobox 1
Synonyms: Nil2, [delta]EF1, MEB1, Tcf8, Zfx1a, Tcf18, AREB6, ZEB, Zfhep, 3110032K11Rik, Zfhx1a, Tw
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 21417
Homologene: 31779
Bdp1
Name: B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
Synonyms: TFIIIB150, TFIIIB90, TAF3B1, TFC5, Tfnr, G630013P12Rik, B130055N23Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 544971
Homologene: 34582
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 36,819,128 bp
  • A to C, chromosome 1 at 123,384,289 bp
  • A to T, chromosome 2 at 7,081,158 bp
  • A to G, chromosome 2 at 19,310,047 bp
  • G to A, chromosome 2 at 52,434,784 bp
  • A to G, chromosome 2 at 70,021,215 bp
  • A to G, chromosome 2 at 129,076,041 bp
  • T to A, chromosome 2 at 153,224,716 bp
  • T to A, chromosome 2 at 157,466,030 bp
  • C to A, chromosome 2 at 164,884,492 bp
  • T to C, chromosome 3 at 59,209,365 bp
  • T to C, chromosome 3 at 84,967,598 bp
  • GTCATCATCATCATCATC to GTCATCATCATCATCATCATC, chromosome 3 at 89,997,940 bp
  • G to A, chromosome 3 at 131,303,211 bp
  • T to C, chromosome 3 at 152,380,592 bp
  • G to A, chromosome 4 at 53,735,035 bp
  • A to T, chromosome 4 at 123,476,039 bp
  • A to G, chromosome 4 at 128,551,988 bp
  • A to G, chromosome 4 at 133,211,178 bp
  • C to A, chromosome 4 at 135,705,269 bp
  • A to T, chromosome 4 at 135,705,270 bp
  • G to A, chromosome 4 at 140,917,641 bp
  • A to T, chromosome 4 at 141,249,298 bp
  • A to T, chromosome 4 at 155,843,303 bp
  • T to C, chromosome 4 at 156,222,695 bp
  • T to A, chromosome 5 at 87,927,611 bp
  • T to A, chromosome 5 at 121,323,974 bp
  • T to A, chromosome 5 at 137,800,007 bp
  • T to G, chromosome 6 at 108,665,193 bp
  • T to G, chromosome 6 at 128,618,509 bp
  • T to A, chromosome 7 at 5,324,903 bp
  • C to T, chromosome 7 at 25,402,246 bp
  • C to A, chromosome 7 at 28,364,602 bp
  • G to A, chromosome 7 at 85,951,890 bp
  • A to G, chromosome 8 at 3,748,742 bp
  • T to A, chromosome 8 at 10,006,988 bp
  • T to A, chromosome 8 at 37,526,271 bp
  • C to T, chromosome 8 at 71,584,263 bp
  • T to C, chromosome 9 at 21,587,552 bp
  • A to T, chromosome 9 at 110,889,705 bp
  • A to G, chromosome 9 at 121,690,302 bp
  • T to C, chromosome 11 at 8,863,849 bp
  • T to C, chromosome 11 at 69,448,430 bp
  • T to C, chromosome 11 at 69,988,865 bp
  • A to T, chromosome 11 at 70,514,415 bp
  • AGCGGTCGTAGGC to AGC, chromosome 11 at 73,395,654 bp
  • A to G, chromosome 11 at 96,061,063 bp
  • T to C, chromosome 11 at 106,818,509 bp
  • A to G, chromosome 11 at 108,757,688 bp
  • T to A, chromosome 13 at 30,757,758 bp
  • G to T, chromosome 13 at 76,759,825 bp
  • A to T, chromosome 13 at 93,752,323 bp
  • A to T, chromosome 13 at 100,051,104 bp
  • T to C, chromosome 14 at 66,000,021 bp
  • C to T, chromosome 14 at 99,068,512 bp
  • T to A, chromosome 15 at 44,787,621 bp
  • T to C, chromosome 15 at 86,351,728 bp
  • G to T, chromosome 16 at 4,764,868 bp
  • A to G, chromosome 16 at 44,789,671 bp
  • C to T, chromosome 17 at 35,623,231 bp
  • T to C, chromosome 17 at 43,628,411 bp
  • T to A, chromosome 17 at 48,346,633 bp
  • G to A, chromosome 17 at 71,824,765 bp
  • T to A, chromosome 17 at 81,648,002 bp
  • T to G, chromosome 18 at 5,766,765 bp
  • A to T, chromosome 18 at 37,474,654 bp
  • A to G, chromosome 18 at 37,755,992 bp
  • A to G, chromosome 18 at 37,758,089 bp
  • T to C, chromosome Y at 1,017,365 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5913 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044110-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.