Strain Name:
C57BL/6J-MtgxR5913Btlr
Stock Number:
044110-MU
Citation ID:
RRID:MMRRC_044110-MU
Other Names:
R5913 (G1)
Major Collection:

Gene Information

Gulo
Name: gulonolactone (L-) oxidase
Synonyms: sfx, L-gulono-gamma-lactone oxidase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 268756
VEGA: 14
HGNC: HGNC:4695
Homologene: 6566
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Aclp7, Acf7, trabeculin alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 11426
Homologene: 136191
Pcif1
Name: PDX1 C-terminal inhibiting factor 1
Synonyms: 2310022K11Rik, F730014I05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 228866
Homologene: 11134
Cxcl17
Name: chemokine (C-X-C motif) ligand 17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 232983
Homologene: 18875
Tbc1d22a
Name: TBC1 domain family, member 22a
Synonyms: D15Ertd781e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 223754
VEGA: 15
HGNC: HGNC:1309
Homologene: 105406
Zeb1
Name: zinc finger E-box binding homeobox 1
Synonyms: ZEB, [delta]EF1, Tw, Zfx1a, Zfhx1a, Tcf8, 3110032K11Rik, Zfhep, Tcf18, MEB1, AREB6, Nil2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 21417
Homologene: 31779
Bdp1
Name: B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
Synonyms: G630013P12Rik, Tfnr, B130055N23Rik, TFC5, TAF3B1, TFIIIB90, TFIIIB150
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 544971
Homologene: 34582
Bora
Name: bora, aurora kinase A activator
Synonyms: 6720463M24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 77744
VEGA: 14
Homologene: 11728
Gpr3
Name: G-protein coupled receptor 3
Synonyms: Gpcr21, Gpcr3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 14748
HGNC: HGNC:4484
Homologene: 31303
Tmem131
Name: transmembrane protein 131
Synonyms: Rw1, 2610524E03Rik, CC28, D1Bwg0491e, YR-23, Neg
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 56030
Homologene: 32428
Ubr3
Name: ubiquitin protein ligase E3 component n-recognin 3
Synonyms: A130030D10Rik, 1110059H15Rik, 4833421P10Rik, Zfp650
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 68795
Homologene: 52092
Cd200r1
Name: CD200 receptor 1
Synonyms: CD200R, OX2R, Mox2r
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 57781
Homologene: 10957
Mxra8
Name: matrix-remodelling associated 8
Synonyms: 1200013A08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 74761
HGNC: HGNC:7542
Homologene: 11500
Src
Name: Rous sarcoma oncogene
Synonyms: pp60c-src
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 20779
Homologene: 21120
Celf2
Name: CUGBP, Elav-like family member 2
Synonyms: Napor-2, Cugbp2, ETR-3, B230345P09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 14007
HGNC: HGNC:2550
Homologene: 4783
Carm1
Name: coactivator-associated arginine methyltransferase 1
Synonyms: Prmt4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 59035
Homologene: 10990
Usp33
Name: ubiquitin specific peptidase 33
Synonyms: Vdu1, 9830169D19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 170822
Homologene: 8996
Cep95
Name: centrosomal protein 95
Synonyms: F630025I20Rik, 4732496G21Rik, Ccdc45
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 320162
Homologene: 16297
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 269700
Homologene: 28297
Pkd1l1
Name: polycystic kidney disease 1 like 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 171395
Homologene: 51376
Cd209a
Name: CD209a antigen
Synonyms: DC-SIGN1, SIGNR5, DC-SIGN, Dcsign, CD209, CIRE
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 170786
Homologene: 129771
Irf4
Name: interferon regulatory factor 4
Synonyms: Spip, IRF-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 16364
HGNC: HGNC:6119
Homologene: 1842
Bhlhe40
Name: basic helix-loop-helix family, member e40
Synonyms: Stra14, Sharp2, DEC1, eip1 (E47 interaction protein 1), cytokine response gene 8, Clast5, Bhlhb2, Stra13, C130042M06Rik, CR8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 20893
HGNC: HGNC:1046
Homologene: 2722
Tnfsf13b
Name: tumor necrosis factor (ligand) superfamily, member 13b
Synonyms: BLyS, BAFF, zTNF4, TALL-1, D8Ertd387e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 24099
Homologene: 48443
Dnah2
Name: dynein, axonemal, heavy chain 2
Synonyms: Dnhd3, Dnahc2, 2900022L05Rik, D330014H01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 327954
HGNC: HGNC:2948
Homologene: 72110
Hmox2
Name: heme oxygenase 2
Synonyms: HO-2, HO2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 15369
HGNC: HGNC:5014
Homologene: 1611
Armc3
Name: armadillo repeat containing 3
Synonyms: 4921513G22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 70882
Homologene: 31589
Sybu
Name: syntabulin (syntaxin-interacting)
Synonyms: 5730410E15Rik, Golsyn/Syntabulin, A830027B17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 319613
VEGA: 15
Homologene: 9838
Nlrp2
Name: NLR family, pyrin domain containing 2
Synonyms: E330007A02Rik, PYPAF2, Nalp2, Pan1, Nbs1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 232827
Homologene: 56789
Tdrd6
Name: tudor domain containing 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 210510
Homologene: 19364
Tspyl3
Name: TSPY-like 3
Synonyms: LOC241732
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 241732
Homologene: 19093
Pcdhga11
Name: protocadherin gamma subfamily A, 11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 93723
HGNC: HGNC:8698
Homologene: 110934
Slc8a1
Name: solute carrier family 8 (sodium/calcium exchanger), member 1
Synonyms: D930008O12Rik, Ncx1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 20541
VEGA: 17
Homologene: 69090
Sec22c
Name: SEC22 homolog C, vesicle trafficking protein
Synonyms: Sec22l3, 5930407I15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 215474
Homologene: 41948
Sgcz
Name: sarcoglycan zeta
Synonyms: C230085N17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 244431
Homologene: 26726
Zcwpw1
Name: zinc finger, CW type with PWWP domain 1
Synonyms: LOC381678
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 381678
Homologene: 9944
Dpp10
Name: dipeptidylpeptidase 10
Synonyms: 6430601K09Rik, DPRP3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 269109
Homologene: 41400
Csmd2
Name: CUB and Sushi multiple domains 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 329942
Homologene: 89034
Vmn2r74
Name: vomeronasal 2, receptor 74
Synonyms: EG546980
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 546980
Homologene: 115466
Padi2
Name: peptidyl arginine deiminase, type II
Synonyms: Pdi2, PAD type II, Pdi
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 18600
Homologene: 7214
Ctdnep1
Name: CTD nuclear envelope phosphatase 1
Synonyms: Dullard, 2610507E10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 67181
Homologene: 9100
Plekhn1
Name: pleckstrin homology domain containing, family N member 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 231002
VEGA: 4
Homologene: 12949
Als2cl
Name: ALS2 C-terminal like
Synonyms: D930044G19Rik, mRn.49018
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 235633
Homologene: 17152
Mctp1
Name: multiple C2 domains, transmembrane 1
Synonyms: 2810465F10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 78771
Homologene: 75211
Slc27a1
Name: solute carrier family 27 (fatty acid transporter), member 1
Synonyms: Fatp, FATP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 26457
Homologene: 8063
Fktn
Name: fukutin
Synonyms: Fcmd, Fukutin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 246179
HGNC: HGNC:3622
Homologene: 31402
Pcdhb15
Name: protocadherin beta 15
Synonyms: Pcdhb7, PcdhbO
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 93886
HGNC: HGNC:8692
Homologene: 32429
Arhgef19
Name: Rho guanine nucleotide exchange factor (GEF) 19
Synonyms: WGEF, 6430573B13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 213649
Homologene: 17710
Gm9573
Name: predicted gene 9573
Synonyms: Muc21, epiglycanin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 672682
P2ry13
Name: purinergic receptor P2Y, G-protein coupled 13
Synonyms: SP174, 2010001L06Rik, P2Y13, Gpr86
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 74191
HGNC: HGNC:4537
Homologene: 12543
Ttl
Name: tubulin tyrosine ligase
Synonyms: 2700049H19Rik, 2410003M22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 69737
Homologene: 32678
Cyp2u1
Name: cytochrome P450, family 2, subfamily u, polypeptide 1
Synonyms: 8430436A10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 71519
Homologene: 77704
Klrb1a
Name: killer cell lectin-like receptor subfamily B member 1A
Synonyms: Nkrp1-a, NKR-P1A, Ly55a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 17057
HGNC: HGNC:6373
Homologene: 84369
Ube2z
Name: ubiquitin-conjugating enzyme E2Z
Synonyms: C030047H17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 268470
Homologene: 11319
Clip4
Name: CAP-GLY domain containing linker protein family, member 4
Synonyms: 1700074B05Rik, 5830409B12Rik, 4833417L20Rik, Rsnl2, 1700024K14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 78785
VEGA: 17
Homologene: 11662
Csn3
Name: casein kappa
Synonyms: CSN10, Csnk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 12994
HGNC: HGNC:2446
Homologene: 3818
Dmgdh
Name: dimethylglycine dehydrogenase precursor
Synonyms: 1200014D15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 74129
Homologene: 8372
Ifnlr1
Name: interferon lambda receptor 1
Synonyms: Il28ra, IFNLR1, CRF2-12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 242700
Homologene: 52086
Cep112
Name: centrosomal protein 112
Synonyms: 8430407H02Rik, Ccdc46, Macoco, 1700001M19Rik, 1700029K01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 76380
Homologene: 44915
Cacnb4
Name: calcium channel, voltage-dependent, beta 4 subunit
Synonyms: Cchb4, 3110038O15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 12298
HGNC: HGNC:1404
Homologene: 20188
Hax1
Name: HCLS1 associated X-1
Synonyms: Hs1bp1, HAX-1, mHAX-1s, Silg111, HS1-associated protein X-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 23897
Homologene: 4463
Olfr1
Name: olfactory receptor 1
Synonyms: MOR135-13, I54, GA_x6K02T2P1NL-3556334-3555390
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 258923
Homologene: 115482
Plekhg2
Name: pleckstrin homology domain containing, family G (with RhoGef domain) member 2
Synonyms: Clg
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 101497
Homologene: 16341
Eif2s3y
Name: eukaryotic translation initiation factor 2, subunit 3, structural gene Y-linked
Synonyms: Tfy, Eif-2gy, Spy
Type: Gene
Species: Mus musculus (mouse)
Chromosome: Y
Alteration at locus: Chemically Induced
NCBI: 26908
Homologene: 99414
Vmo1
Name: vitelline membrane outer layer 1 homolog (chicken)
Synonyms: LOC327956
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 327956
Homologene: 45649
Trem2
Name: triggering receptor expressed on myeloid cells 2
Synonyms: Trem2b, Trem2a, Trem2c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 83433
Homologene: 10352
Gm37240
Name: predicted gene, 37240
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 36,819,128 bp
  • A to C, chromosome 1 at 123,384,289 bp
  • A to T, chromosome 2 at 7,081,158 bp
  • A to G, chromosome 2 at 19,310,047 bp
  • G to A, chromosome 2 at 52,434,784 bp
  • A to G, chromosome 2 at 70,021,215 bp
  • A to G, chromosome 2 at 129,076,041 bp
  • T to A, chromosome 2 at 153,224,716 bp
  • T to A, chromosome 2 at 157,466,030 bp
  • C to A, chromosome 2 at 164,884,492 bp
  • T to C, chromosome 3 at 59,209,365 bp
  • T to C, chromosome 3 at 84,967,598 bp
  • GTCATCATCATCATCATC to GTCATCATCATCATCATCATC, chromosome 3 at 89,997,940 bp
  • G to A, chromosome 3 at 131,303,211 bp
  • T to C, chromosome 3 at 152,380,592 bp
  • G to A, chromosome 4 at 53,735,035 bp
  • A to T, chromosome 4 at 123,476,039 bp
  • A to G, chromosome 4 at 128,551,988 bp
  • A to G, chromosome 4 at 133,211,178 bp
  • C to A, chromosome 4 at 135,705,269 bp
  • A to T, chromosome 4 at 135,705,270 bp
  • G to A, chromosome 4 at 140,917,641 bp
  • A to T, chromosome 4 at 141,249,298 bp
  • A to T, chromosome 4 at 155,843,303 bp
  • T to C, chromosome 4 at 156,222,695 bp
  • T to A, chromosome 5 at 87,927,611 bp
  • T to A, chromosome 5 at 121,323,974 bp
  • T to A, chromosome 5 at 137,800,007 bp
  • T to G, chromosome 6 at 108,665,193 bp
  • T to G, chromosome 6 at 128,618,509 bp
  • T to A, chromosome 7 at 5,324,903 bp
  • C to T, chromosome 7 at 25,402,246 bp
  • C to A, chromosome 7 at 28,364,602 bp
  • G to A, chromosome 7 at 85,951,890 bp
  • A to G, chromosome 8 at 3,748,742 bp
  • T to A, chromosome 8 at 10,006,988 bp
  • T to A, chromosome 8 at 37,526,271 bp
  • C to T, chromosome 8 at 71,584,263 bp
  • T to C, chromosome 9 at 21,587,552 bp
  • A to T, chromosome 9 at 110,889,705 bp
  • A to G, chromosome 9 at 121,690,302 bp
  • T to C, chromosome 11 at 8,863,849 bp
  • T to C, chromosome 11 at 69,448,430 bp
  • T to C, chromosome 11 at 69,988,865 bp
  • A to T, chromosome 11 at 70,514,415 bp
  • AGCGGTCGTAGGC to AGC, chromosome 11 at 73,395,654 bp
  • A to G, chromosome 11 at 96,061,063 bp
  • T to C, chromosome 11 at 106,818,509 bp
  • A to G, chromosome 11 at 108,757,688 bp
  • T to A, chromosome 13 at 30,757,758 bp
  • G to T, chromosome 13 at 76,759,825 bp
  • A to T, chromosome 13 at 93,752,323 bp
  • A to T, chromosome 13 at 100,051,104 bp
  • T to C, chromosome 14 at 66,000,021 bp
  • C to T, chromosome 14 at 99,068,512 bp
  • T to A, chromosome 15 at 44,787,621 bp
  • T to C, chromosome 15 at 86,351,728 bp
  • G to T, chromosome 16 at 4,764,868 bp
  • A to G, chromosome 16 at 44,789,671 bp
  • C to T, chromosome 17 at 35,623,231 bp
  • T to C, chromosome 17 at 43,628,411 bp
  • T to A, chromosome 17 at 48,346,633 bp
  • G to A, chromosome 17 at 71,824,765 bp
  • T to A, chromosome 17 at 81,648,002 bp
  • T to G, chromosome 18 at 5,766,765 bp
  • A to T, chromosome 18 at 37,474,654 bp
  • A to G, chromosome 18 at 37,755,992 bp
  • A to G, chromosome 18 at 37,758,089 bp
  • T to C, chromosome Y at 1,017,365 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5913 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
044110-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.