Strain Name:
Stock Number:
Citation ID:
Other Names:
R5913 (G1)
Major Collection:

Strain Information

Name: gulonolactone (L-) oxidase
Synonyms: L-gulono-gamma-lactone oxidase, sfx
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 268756
VEGA: 14
Homologene: 6566
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 11426
Homologene: 136191
Name: phosphorylated CTD interacting factor 1
Synonyms: 2310022K11Rik, F730014I05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228866
Homologene: 11134
Name: chemokine (C-X-C motif) ligand 17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 232983
Homologene: 18875
Name: TBC1 domain family, member 22a
Synonyms: D15Ertd781e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223754
VEGA: 15
Homologene: 105406
Name: zinc finger E-box binding homeobox 1
Synonyms: Nil2, [delta]EF1, MEB1, Tcf8, Zfx1a, Tcf18, AREB6, ZEB, Zfhep, 3110032K11Rik, Zfhx1a, Tw
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 21417
Homologene: 31779
Name: B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
Synonyms: TFIIIB150, TFIIIB90, TAF3B1, TFC5, Tfnr, G630013P12Rik, B130055N23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 544971
Homologene: 34582
Name: bora, aurora kinase A activator
Synonyms: 6720463M24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 77744
VEGA: 14
Homologene: 11728
Name: G-protein coupled receptor 3
Synonyms: Gpcr21, Gpcr3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 14748
Homologene: 31303
Name: transmembrane protein 131
Synonyms: CC28, 2610524E03Rik, YR-23, D1Bwg0491e, Neg, Rw1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 56030
Homologene: 32428
Name: ubiquitin protein ligase E3 component n-recognin 3
Synonyms: 4833421P10Rik, A130030D10Rik, 1110059H15Rik, Zfp650
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 68795
Homologene: 52092
Name: CD200 receptor 1
Synonyms: OX2R, CD200R, Mox2r
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 57781
Homologene: 10957
Name: matrix-remodelling associated 8
Synonyms: 1200013A08Rik, Asp3, limitrin, DICAM
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 74761
Homologene: 11500
Name: Rous sarcoma oncogene
Synonyms: pp60c-src
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20779
Homologene: 21120
Name: CUGBP, Elav-like family member 2
Synonyms: Napor-2, ETR-3, B230345P09Rik, Cugbp2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14007
Homologene: 4783
Name: coactivator-associated arginine methyltransferase 1
Synonyms: Prmt4, m9Bei
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 59035
Homologene: 10990
Name: ubiquitin specific peptidase 33
Synonyms: Vdu1, 9830169D19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 170822
Homologene: 8996
Name: centrosomal protein 95
Synonyms: F630025I20Rik, 4732496G21Rik, Ccdc45
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 320162
Homologene: 16297
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 269700
Homologene: 28297
Name: polycystic kidney disease 1 like 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 171395
Homologene: 51376
Name: CD209a antigen
Synonyms: CIRE, CD209, Dcsign, DC-SIGN1, DC-SIGN, SIGNR5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 170786
Homologene: 129771
Name: interferon regulatory factor 4
Synonyms: Spip, IRF-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 16364
Homologene: 1842
Name: basic helix-loop-helix family, member e40
Synonyms: eip1 (E47 interaction protein 1), Stra13, CR8, cytokine response gene 8, Clast5, C130042M06Rik, Stra14, DEC1, Sharp2, Bhlhb2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 20893
Homologene: 2722
Name: tumor necrosis factor (ligand) superfamily, member 13b
Synonyms: BAFF, zTNF4, BLyS, TALL-1, D8Ertd387e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 24099
Homologene: 48443
Name: dynein, axonemal, heavy chain 2
Synonyms: D330014H01Rik, 2900022L05Rik, Dnhd3, Dnahc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 327954
Homologene: 72110
Name: heme oxygenase 2
Synonyms: HO-2, HO2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 15369
Homologene: 1611
Name: armadillo repeat containing 3
Synonyms: 4921513G22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 70882
Homologene: 31589
Name: syntabulin (syntaxin-interacting)
Synonyms: A830027B17Rik, Golsyn/Syntabulin, 5730410E15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 319613
VEGA: 15
Homologene: 9838
Name: NLR family, pyrin domain containing 2
Synonyms: PYPAF2, E330007A02Rik, Nalp2, Pan1, Nbs1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 232827
Homologene: 56789
Name: tudor domain containing 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 210510
Homologene: 19364
Name: TSPY-like 3
Synonyms: LOC241732
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241732
Homologene: 19093
Name: protocadherin gamma subfamily A, 11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93723
Homologene: 110934
Name: solute carrier family 8 (sodium/calcium exchanger), member 1
Synonyms: Ncx1, D930008O12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 20541
VEGA: 17
Homologene: 69090
Name: SEC22 homolog C, vesicle trafficking protein
Synonyms: 5930407I15Rik, Sec22l3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 215474
Homologene: 41948
Name: sarcoglycan zeta
Synonyms: C230085N17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244431
Homologene: 26726
Name: zinc finger, CW type with PWWP domain 1
Synonyms: LOC381678
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 381678
Homologene: 9944
Name: dipeptidylpeptidase 10
Synonyms: DPRP3, 6430601K09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269109
Homologene: 41400
Name: CUB and Sushi multiple domains 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 329942
Homologene: 89034
Name: vomeronasal 2, receptor 74
Synonyms: EG546980
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 546980
Homologene: 115466
Name: peptidyl arginine deiminase, type II
Synonyms: PAD type II, Pdi, Pdi2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18600
Homologene: 7214
Name: CTD nuclear envelope phosphatase 1
Synonyms: 2610507E10Rik, Dullard
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 67181
Homologene: 9100
Name: pleckstrin homology domain containing, family N member 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 231002
Homologene: 12949
Name: ALS2 C-terminal like
Synonyms: mRn.49018, D930044G19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235633
Homologene: 17152
Name: multiple C2 domains, transmembrane 1
Synonyms: 2810465F10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 78771
Homologene: 75211
Name: solute carrier family 27 (fatty acid transporter), member 1
Synonyms: FATP1, Fatp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 26457
Homologene: 8063
Name: fukutin
Synonyms: Fukutin, Fcmd
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 246179
Homologene: 31402
Name: protocadherin beta 15
Synonyms: Pcdhb7, PcdhbO
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93886
Homologene: 32429
Name: Rho guanine nucleotide exchange factor (GEF) 19
Synonyms: 6430573B13Rik, WGEF
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 213649
Homologene: 17710
Name: mucin 21
Synonyms: epiglycanin, Gm9573
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 672682
Name: purinergic receptor P2Y, G-protein coupled 13
Synonyms: 2010001L06Rik, P2Y13, SP174, Gpr86
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 74191
Homologene: 12543
Name: tubulin tyrosine ligase
Synonyms: 2410003M22Rik, 2700049H19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 69737
Homologene: 32678
Name: cytochrome P450, family 2, subfamily u, polypeptide 1
Synonyms: 8430436A10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 71519
Homologene: 77704
Name: killer cell lectin-like receptor subfamily B member 1A
Synonyms: Nkrp1-a, Ly55a, NKR-P1A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 17057
Homologene: 84369
Name: ubiquitin-conjugating enzyme E2Z
Synonyms: C030047H17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 268470
Homologene: 11319
Name: CAP-GLY domain containing linker protein family, member 4
Synonyms: 1700074B05Rik, 5830409B12Rik, 4833417L20Rik, 1700024K14Rik, Rsnl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 78785
VEGA: 17
Homologene: 11662
Name: casein kappa
Synonyms: CSN10, Csnk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 12994
Homologene: 3818
Name: dimethylglycine dehydrogenase precursor
Synonyms: 1200014D15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 74129
Homologene: 8372
Name: interferon lambda receptor 1
Synonyms: IFNLR1, CRF2-12, Il28ra
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242700
Homologene: 52086
Name: centrosomal protein 112
Synonyms: 1700001M19Rik, 1700029K01Rik, 8430407H02Rik, Macoco, Ccdc46
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 76380
Homologene: 44915
Name: calcium channel, voltage-dependent, beta 4 subunit
Synonyms: Cchb4, 3110038O15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 12298
Homologene: 20188
Name: HCLS1 associated X-1
Synonyms: mHAX-1s, HAX-1, Silg111, Hs1bp1, HS1-associated protein X-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 23897
Homologene: 4463
Name: olfactory receptor family 1 subfamily E member 16
Synonyms: MOR135-13, GA_x6K02T2P1NL-3556334-3555390, I54, Olfr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 258923
Homologene: 115482
Name: pleckstrin homology domain containing, family G (with RhoGef domain) member 2
Synonyms: Clg
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 101497
Homologene: 16341
Name: eukaryotic translation initiation factor 2, subunit 3, structural gene Y-linked
Synonyms: Tfy, Eif-2gy, Spy
Type: Gene
Species: Mus musculus (mouse)
Chromosome: Y
NCBI: 26908
Homologene: 99414
Name: vitelline membrane outer layer 1 homolog (chicken)
Synonyms: LOC327956
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 327956
Homologene: 45649
Name: triggering receptor expressed on myeloid cells 2
Synonyms: Trem2c, Trem2b, Trem2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 83433
Homologene: 10352
Name: predicted gene, 37240
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 36,819,128 bp
  • A to C, chromosome 1 at 123,384,289 bp
  • A to T, chromosome 2 at 7,081,158 bp
  • A to G, chromosome 2 at 19,310,047 bp
  • G to A, chromosome 2 at 52,434,784 bp
  • A to G, chromosome 2 at 70,021,215 bp
  • A to G, chromosome 2 at 129,076,041 bp
  • T to A, chromosome 2 at 153,224,716 bp
  • T to A, chromosome 2 at 157,466,030 bp
  • C to A, chromosome 2 at 164,884,492 bp
  • T to C, chromosome 3 at 59,209,365 bp
  • T to C, chromosome 3 at 84,967,598 bp
  • GTCATCATCATCATCATC to GTCATCATCATCATCATCATC, chromosome 3 at 89,997,940 bp
  • G to A, chromosome 3 at 131,303,211 bp
  • T to C, chromosome 3 at 152,380,592 bp
  • G to A, chromosome 4 at 53,735,035 bp
  • A to T, chromosome 4 at 123,476,039 bp
  • A to G, chromosome 4 at 128,551,988 bp
  • A to G, chromosome 4 at 133,211,178 bp
  • C to A, chromosome 4 at 135,705,269 bp
  • A to T, chromosome 4 at 135,705,270 bp
  • G to A, chromosome 4 at 140,917,641 bp
  • A to T, chromosome 4 at 141,249,298 bp
  • A to T, chromosome 4 at 155,843,303 bp
  • T to C, chromosome 4 at 156,222,695 bp
  • T to A, chromosome 5 at 87,927,611 bp
  • T to A, chromosome 5 at 121,323,974 bp
  • T to A, chromosome 5 at 137,800,007 bp
  • T to G, chromosome 6 at 108,665,193 bp
  • T to G, chromosome 6 at 128,618,509 bp
  • T to A, chromosome 7 at 5,324,903 bp
  • C to T, chromosome 7 at 25,402,246 bp
  • C to A, chromosome 7 at 28,364,602 bp
  • G to A, chromosome 7 at 85,951,890 bp
  • A to G, chromosome 8 at 3,748,742 bp
  • T to A, chromosome 8 at 10,006,988 bp
  • T to A, chromosome 8 at 37,526,271 bp
  • C to T, chromosome 8 at 71,584,263 bp
  • T to C, chromosome 9 at 21,587,552 bp
  • A to T, chromosome 9 at 110,889,705 bp
  • A to G, chromosome 9 at 121,690,302 bp
  • T to C, chromosome 11 at 8,863,849 bp
  • T to C, chromosome 11 at 69,448,430 bp
  • T to C, chromosome 11 at 69,988,865 bp
  • A to T, chromosome 11 at 70,514,415 bp
  • AGCGGTCGTAGGC to AGC, chromosome 11 at 73,395,654 bp
  • A to G, chromosome 11 at 96,061,063 bp
  • T to C, chromosome 11 at 106,818,509 bp
  • A to G, chromosome 11 at 108,757,688 bp
  • T to A, chromosome 13 at 30,757,758 bp
  • G to T, chromosome 13 at 76,759,825 bp
  • A to T, chromosome 13 at 93,752,323 bp
  • A to T, chromosome 13 at 100,051,104 bp
  • T to C, chromosome 14 at 66,000,021 bp
  • C to T, chromosome 14 at 99,068,512 bp
  • T to A, chromosome 15 at 44,787,621 bp
  • T to C, chromosome 15 at 86,351,728 bp
  • G to T, chromosome 16 at 4,764,868 bp
  • A to G, chromosome 16 at 44,789,671 bp
  • C to T, chromosome 17 at 35,623,231 bp
  • T to C, chromosome 17 at 43,628,411 bp
  • T to A, chromosome 17 at 48,346,633 bp
  • G to A, chromosome 17 at 71,824,765 bp
  • T to A, chromosome 17 at 81,648,002 bp
  • T to G, chromosome 18 at 5,766,765 bp
  • A to T, chromosome 18 at 37,474,654 bp
  • A to G, chromosome 18 at 37,755,992 bp
  • A to G, chromosome 18 at 37,758,089 bp
  • T to C, chromosome Y at 1,017,365 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5913 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044110-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.