Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5913Btlr/Mmmh
Stock Number:
044110-MU
Citation ID:
RRID:MMRRC_044110-MU
Other Names:
R5913 (G1)
Major Collection:

Strain Information

Gulo
Name: gulonolactone (L-) oxidase
Synonyms: L-gulono-gamma-lactone oxidase, sfx
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 268756
VEGA: 14
HGNC: HGNC:4695
Homologene: 6566
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Pcif1
Name: phosphorylated CTD interacting factor 1
Synonyms: 2310022K11Rik, F730014I05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228866
Homologene: 11134
Cxcl17
Name: C-X-C motif chemokine ligand 17
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232983
Homologene: 18875
Tbc1d22a
Name: TBC1 domain family, member 22a
Synonyms: D15Ertd781e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223754
VEGA: 15
HGNC: HGNC:1309
Homologene: 105406
Zeb1
Name: zinc finger E-box binding homeobox 1
Synonyms: Nil2, [delta]EF1, MEB1, Tcf8, Zfx1a, Tcf18, AREB6, ZEB, Zfhep, 3110032K11Rik, Zfhx1a, Tw
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 21417
Homologene: 31779
Bdp1
Name: B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
Synonyms: TFIIIB150, TFIIIB90, TAF3B1, TFC5, Tfnr, G630013P12Rik, B130055N23Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 544971
Homologene: 34582
Bora
Name: bora, aurora kinase A activator
Synonyms: 6720463M24Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 77744
VEGA: 14
Homologene: 11728
Gpr3
Name: G-protein coupled receptor 3
Synonyms: Gpcr21, Gpcr3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14748
HGNC: HGNC:4484
Homologene: 31303
Tmem131
Name: transmembrane protein 131
Synonyms: CC28, 2610524E03Rik, YR-23, D1Bwg0491e, Neg, Rw1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56030
Homologene: 32428
Ubr3
Name: ubiquitin protein ligase E3 component n-recognin 3
Synonyms: 4833421P10Rik, A130030D10Rik, 1110059H15Rik, Zfp650
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68795
Homologene: 52092
Cd200r1
Name: CD200 receptor 1
Synonyms: OX2R, CD200R, Mox2r
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 57781
Homologene: 10957
Mxra8
Name: matrix-remodelling associated 8
Synonyms: 1200013A08Rik, Asp3, limitrin, DICAM
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74761
HGNC: HGNC:7542
Homologene: 11500
Src
Name: Rous sarcoma oncogene
Synonyms: pp60c-src
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20779
Homologene: 21120
Celf2
Name: CUGBP, Elav-like family member 2
Synonyms: Napor-2, ETR-3, B230345P09Rik, Cugbp2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14007
HGNC: HGNC:2550
Homologene: 4783
Carm1
Name: coactivator-associated arginine methyltransferase 1
Synonyms: Prmt4, m9Bei
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 59035
Homologene: 10990
Usp33
Name: ubiquitin specific peptidase 33
Synonyms: Vdu1, 9830169D19Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 170822
Homologene: 8996
Cep95
Name: centrosomal protein 95
Synonyms: F630025I20Rik, 4732496G21Rik, Ccdc45
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 320162
Homologene: 16297
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269700
Homologene: 28297
Pkd1l1
Name: polycystic kidney disease 1 like 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171395
Homologene: 51376
Cd209a
Name: CD209a antigen
Synonyms: CIRE, CD209, Dcsign, DC-SIGN1, DC-SIGN, SIGNR5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 170786
HGNC: HGNC:1641
Homologene: 129771
Irf4
Name: interferon regulatory factor 4
Synonyms: Spip, IRF-4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16364
HGNC: HGNC:6119
Homologene: 1842
Bhlhe40
Name: basic helix-loop-helix family, member e40
Synonyms: eip1 (E47 interaction protein 1), Stra13, CR8, cytokine response gene 8, Clast5, C130042M06Rik, Stra14, DEC1, Sharp2, Bhlhb2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20893
HGNC: HGNC:1046
Homologene: 2722
Tnfsf13b
Name: tumor necrosis factor (ligand) superfamily, member 13b
Synonyms: BAFF, zTNF4, BLyS, TALL-1, D8Ertd387e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 24099
Homologene: 48443
Dnah2
Name: dynein, axonemal, heavy chain 2
Synonyms: D330014H01Rik, 2900022L05Rik, Dnhd3, Dnahc2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327954
HGNC: HGNC:2948
Homologene: 72110
Hmox2
Name: heme oxygenase 2
Synonyms: HO-2, HO2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 15369
HGNC: HGNC:5014
Homologene: 1611
Armc3
Name: armadillo repeat containing 3
Synonyms: 4921513G22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70882
Homologene: 31589
Sybu
Name: syntabulin (syntaxin-interacting)
Synonyms: A830027B17Rik, Golsyn/Syntabulin, 5730410E15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 319613
VEGA: 15
Homologene: 9838
Nlrp2
Name: NLR family, pyrin domain containing 2
Synonyms: PYPAF2, E330007A02Rik, Nalp2, Pan1, Nbs1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232827
Homologene: 56789
Tspyl3
Name: TSPY-like 3
Synonyms: LOC241732
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241732
Homologene: 19093
Pcdhga11
Name: protocadherin gamma subfamily A, 11
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93723
HGNC: HGNC:8698
Homologene: 110934
Slc8a1
Name: solute carrier family 8 (sodium/calcium exchanger), member 1
Synonyms: Ncx1, D930008O12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20541
VEGA: 17
Homologene: 69090
Sec22c
Name: SEC22 homolog C, vesicle trafficking protein
Synonyms: 5930407I15Rik, Sec22l3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 215474
Homologene: 41948
Sgcz
Name: sarcoglycan zeta
Synonyms: C230085N17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244431
Homologene: 26726
Zcwpw1
Name: zinc finger, CW type with PWWP domain 1
Synonyms: LOC381678
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381678
Homologene: 9944
Dpp10
Name: dipeptidylpeptidase 10
Synonyms: 6430601K09Rik, DPRP3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269109
Homologene: 41400
Csmd2
Name: CUB and Sushi multiple domains 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329942
Homologene: 89034
Vmn2r74
Name: vomeronasal 2, receptor 74
Synonyms: EG546980
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 546980
Homologene: 115466
Padi2
Name: peptidyl arginine deiminase, type II
Synonyms: PAD type II, Pdi, Pdi2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18600
Homologene: 7214
Ctdnep1
Name: CTD nuclear envelope phosphatase 1
Synonyms: 2610507E10Rik, Dullard
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67181
Homologene: 9100
Plekhn1
Name: pleckstrin homology domain containing, family N member 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 231002
VEGA: 4
Homologene: 12949
Als2cl
Name: ALS2 C-terminal like
Synonyms: mRn.49018, D930044G19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235633
Homologene: 17152
Mctp1
Name: multiple C2 domains, transmembrane 1
Synonyms: 2810465F10Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 78771
Homologene: 75211
Slc27a1
Name: solute carrier family 27 (fatty acid transporter), member 1
Synonyms: FATP1, Fatp
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 26457
Homologene: 8063
Fktn
Name: fukutin
Synonyms: Fukutin, Fcmd
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 246179
HGNC: HGNC:3622
Homologene: 31402
Pcdhb15
Name: protocadherin beta 15
Synonyms: Pcdhb7, PcdhbO
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93886
HGNC: HGNC:8692
Homologene: 32429
Arhgef19
Name: Rho guanine nucleotide exchange factor 19
Synonyms: 6430573B13Rik, WGEF
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 213649
Homologene: 17710
Muc21
Name: mucin 21
Synonyms: epiglycanin, Gm9573
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 672682
P2ry13
Name: purinergic receptor P2Y, G-protein coupled 13
Synonyms: 2010001L06Rik, P2Y13, SP174, Gpr86
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74191
HGNC: HGNC:4537
Homologene: 12543
Ttl
Name: tubulin tyrosine ligase
Synonyms: 2410003M22Rik, 2700049H19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69737
Homologene: 32678
Cyp2u1
Name: cytochrome P450, family 2, subfamily u, polypeptide 1
Synonyms: 8430436A10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71519
Homologene: 77704
Klrb1a
Name: killer cell lectin-like receptor subfamily B member 1A
Synonyms: Nkrp1-a, Ly55a, NKR-P1A
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17057
HGNC: HGNC:6373
Homologene: 84369
Ube2z
Name: ubiquitin-conjugating enzyme E2Z
Synonyms: C030047H17Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268470
Homologene: 11319
Clip4
Name: CAP-GLY domain containing linker protein family, member 4
Synonyms: 1700074B05Rik, 5830409B12Rik, 4833417L20Rik, 1700024K14Rik, Rsnl2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 78785
VEGA: 17
Homologene: 11662
Csn3
Name: casein kappa
Synonyms: CSN10, Csnk
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12994
HGNC: HGNC:2446
Homologene: 3818
Dmgdh
Name: dimethylglycine dehydrogenase precursor
Synonyms: 1200014D15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 74129
Homologene: 8372
Ifnlr1
Name: interferon lambda receptor 1
Synonyms: IFNLR1, CRF2-12, Il28ra
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242700
Homologene: 52086
Cep112
Name: centrosomal protein 112
Synonyms: 1700001M19Rik, 1700029K01Rik, 8430407H02Rik, Macoco, Ccdc46
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76380
Homologene: 44915
Cacnb4
Name: calcium channel, voltage-dependent, beta 4 subunit
Synonyms: Cchb4, 3110038O15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12298
HGNC: HGNC:1404
Homologene: 20188
Hax1
Name: HCLS1 associated X-1
Synonyms: mHAX-1s, HAX-1, Silg111, Hs1bp1, HS1-associated protein X-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 23897
Homologene: 4463
Or1e16
Name: olfactory receptor family 1 subfamily E member 16
Synonyms: MOR135-13, GA_x6K02T2P1NL-3556334-3555390, I54, Olfr1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258923
Homologene: 115482
Plekhg2
Name: pleckstrin homology domain containing, family G (with RhoGef domain) member 2
Synonyms: Clg
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101497
Homologene: 16341
Eif2s3y
Name: eukaryotic translation initiation factor 2, subunit 3, structural gene Y-linked
Synonyms: Tfy, Eif-2gy, Spy
Type: Gene
Species: Mus musculus (mouse)
Chromosome: Y
NCBI: 26908
HGNC: HGNC:3267
Homologene: 99414
Vmo1
Name: vitelline membrane outer layer 1 homolog (chicken)
Synonyms: LOC327956
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327956
Homologene: 45649
Trem2
Name: triggering receptor expressed on myeloid cells 2
Synonyms: Trem2c, Trem2b, Trem2a
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 83433
Homologene: 10352
Gm37240
Name: predicted gene, 37240
Type: Gene
Species: Mouse
Chromosome: 3
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 36,819,128 bp
  • A to C, chromosome 1 at 123,384,289 bp
  • A to T, chromosome 2 at 7,081,158 bp
  • A to G, chromosome 2 at 19,310,047 bp
  • G to A, chromosome 2 at 52,434,784 bp
  • A to G, chromosome 2 at 70,021,215 bp
  • A to G, chromosome 2 at 129,076,041 bp
  • T to A, chromosome 2 at 153,224,716 bp
  • T to A, chromosome 2 at 157,466,030 bp
  • C to A, chromosome 2 at 164,884,492 bp
  • T to C, chromosome 3 at 59,209,365 bp
  • T to C, chromosome 3 at 84,967,598 bp
  • GTCATCATCATCATCATC to GTCATCATCATCATCATCATC, chromosome 3 at 89,997,940 bp
  • G to A, chromosome 3 at 131,303,211 bp
  • T to C, chromosome 3 at 152,380,592 bp
  • G to A, chromosome 4 at 53,735,035 bp
  • A to T, chromosome 4 at 123,476,039 bp
  • A to G, chromosome 4 at 128,551,988 bp
  • A to G, chromosome 4 at 133,211,178 bp
  • C to A, chromosome 4 at 135,705,269 bp
  • A to T, chromosome 4 at 135,705,270 bp
  • G to A, chromosome 4 at 140,917,641 bp
  • A to T, chromosome 4 at 141,249,298 bp
  • A to T, chromosome 4 at 155,843,303 bp
  • T to C, chromosome 4 at 156,222,695 bp
  • T to A, chromosome 5 at 87,927,611 bp
  • T to A, chromosome 5 at 121,323,974 bp
  • T to A, chromosome 5 at 137,800,007 bp
  • T to G, chromosome 6 at 108,665,193 bp
  • T to G, chromosome 6 at 128,618,509 bp
  • T to A, chromosome 7 at 5,324,903 bp
  • C to T, chromosome 7 at 25,402,246 bp
  • C to A, chromosome 7 at 28,364,602 bp
  • G to A, chromosome 7 at 85,951,890 bp
  • A to G, chromosome 8 at 3,748,742 bp
  • T to A, chromosome 8 at 10,006,988 bp
  • T to A, chromosome 8 at 37,526,271 bp
  • C to T, chromosome 8 at 71,584,263 bp
  • T to C, chromosome 9 at 21,587,552 bp
  • A to T, chromosome 9 at 110,889,705 bp
  • A to G, chromosome 9 at 121,690,302 bp
  • T to C, chromosome 11 at 8,863,849 bp
  • T to C, chromosome 11 at 69,448,430 bp
  • T to C, chromosome 11 at 69,988,865 bp
  • A to T, chromosome 11 at 70,514,415 bp
  • AGCGGTCGTAGGC to AGC, chromosome 11 at 73,395,654 bp
  • A to G, chromosome 11 at 96,061,063 bp
  • T to C, chromosome 11 at 106,818,509 bp
  • A to G, chromosome 11 at 108,757,688 bp
  • T to A, chromosome 13 at 30,757,758 bp
  • G to T, chromosome 13 at 76,759,825 bp
  • A to T, chromosome 13 at 93,752,323 bp
  • A to T, chromosome 13 at 100,051,104 bp
  • T to C, chromosome 14 at 66,000,021 bp
  • C to T, chromosome 14 at 99,068,512 bp
  • T to A, chromosome 15 at 44,787,621 bp
  • T to C, chromosome 15 at 86,351,728 bp
  • G to T, chromosome 16 at 4,764,868 bp
  • A to G, chromosome 16 at 44,789,671 bp
  • C to T, chromosome 17 at 35,623,231 bp
  • T to C, chromosome 17 at 43,628,411 bp
  • T to A, chromosome 17 at 48,346,633 bp
  • G to A, chromosome 17 at 71,824,765 bp
  • T to A, chromosome 17 at 81,648,002 bp
  • T to G, chromosome 18 at 5,766,765 bp
  • A to T, chromosome 18 at 37,474,654 bp
  • A to G, chromosome 18 at 37,755,992 bp
  • A to G, chromosome 18 at 37,758,089 bp
  • T to C, chromosome Y at 1,017,365 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5913 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044110-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.