Strain Name:
C57BL/6J-MtgxR6026Btlr
Stock Number:
044198-MU
Citation ID:
RRID:MMRRC_044198-MU
Other Names:
R6026 (G1)
Major Collection:

Gene Information

Phb
Name: prohibitin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 18673
HGNC: HGNC:8912
Homologene: 1980
Gad2
Name: glutamic acid decarboxylase 2
Synonyms: 6330404F12Rik, GAD(65), GAD65, Gad-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 14417
HGNC: HGNC:4093
Homologene: 20223
Utp20
Name: UTP20 small subunit processome component
Synonyms: DRIM, 3830408P06Rik, mDRIM
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 70683
VEGA: 10
Homologene: 38373
Fancd2
Name: Fanconi anemia, complementation group D2
Synonyms: 2410150O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 211651
HGNC: HGNC:3585
Homologene: 13212
Odf2l
Name: outer dense fiber of sperm tails 2-like
Synonyms: 4733401D09Rik, 9630045K08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 52184
Homologene: 12011
Cops4
Name: COP9 signalosome subunit 4
Synonyms: D5Ertd774e, COP9 complex S4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 26891
Homologene: 8067
Fryl
Name: FRY like transcription coactivator
Synonyms: 2510002A14Rik, 2310004H21Rik, 9030227G01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 72313
Homologene: 103956
Abcc8
Name: ATP-binding cassette, sub-family C (CFTR/MRP), member 8
Synonyms: SUR1, Sur, D930031B21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 20927
HGNC: HGNC:59
Homologene: 68048
Lrrfip2
Name: leucine rich repeat (in FLII) interacting protein 2
Synonyms: 5133400F20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 71268
HGNC: HGNC:6703
Homologene: 22476
Ddx27
Name: DEAD (Asp-Glu-Ala-Asp) box polypeptide 27
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 228889
Homologene: 6431
Clasp2
Name: CLIP associating protein 2
Synonyms: CLASP2alpha, 1500004F14Rik, CLASP2, 8030404L10Rik, CLASP2gamma, CLASP2beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 76499
VEGA: 9
Homologene: 24944
Ncapg2
Name: non-SMC condensin II complex, subunit G2
Synonyms: 5830426I05Rik, Luzp5, Mtb, mCAP-G2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 76044
VEGA: 12
Homologene: 9820
Hif1a
Name: hypoxia inducible factor 1, alpha subunit
Synonyms: MOP1, HIF1alpha, HIF-1alpha, bHLHe78
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 15251
HGNC: HGNC:4910
Homologene: 1171
Cct3
Name: chaperonin containing Tcp1, subunit 3 (gamma)
Synonyms: Cctg, Tcp1-rs3, TriC-P5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 12462
HGNC: HGNC:1616
Homologene: 4373
Tenm2
Name: teneurin transmembrane protein 2
Synonyms: D3Bwg1534e, 2610040L17Rik, Ten-m2, Odz2, 9330187F13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 23964
Homologene: 22672
Gstz1
Name: glutathione transferase zeta 1 (maleylacetoacetate isomerase)
Synonyms: maleylacetoacetate isomerase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 14874
VEGA: 12
HGNC: HGNC:4643
Homologene: 7747
Rfc2
Name: replication factor C (activator 1) 2
Synonyms: Recc2, 2610008M13Rik, 40kDa, 40kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 19718
HGNC: HGNC:9970
Homologene: 6885
Afg3l2
Name: AFG3-like AAA ATPase 2
Synonyms: 2310036I02Rik, Emv66, par
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 69597
VEGA: 18
HGNC: HGNC:315
Homologene: 4947
Ncbp3
Name: nuclear cap binding subunit 3
Synonyms: 1200014J11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 66874
Homologene: 10231
Ash1l
Name: ASH1 like histone lysine methyltransferase
Synonyms: E430018P19Rik, 8030453L17Rik, KMT2H, chromatin remodeling factor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 192195
Homologene: 10225
Pikfyve
Name: phosphoinositide kinase, FYVE type zinc finger containing
Synonyms: Pip5k3, 5230400C17Rik, PipkIII
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 18711
Homologene: 32115
Grm7
Name: glutamate receptor, metabotropic 7
Synonyms: Tg(SMN2)89Ahmb, SMN2, 6330570A01Rik, mGlu7a receptor, E130018M02Rik, Gpr1g, mGluR7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 108073
HGNC: HGNC:4599
Homologene: 20233
Iqgap3
Name: IQ motif containing GTPase activating protein 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 404710
Homologene: 26400
Ptprc
Name: protein tyrosine phosphatase, receptor type, C
Synonyms: Lyt-4, CD45, Ly-5, T200, B220
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 19264
HGNC: HGNC:9666
Homologene: 2126
Gigyf2
Name: GRB10 interacting GYF protein 2
Synonyms: Tnrc15, A830080H02Rik, 2610016F01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 227331
Homologene: 41048
Lmo7
Name: LIM domain only 7
Synonyms: FBXO20, LOC380928
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 380928
HGNC: HGNC:6646
Homologene: 83924
Hhip
Name: Hedgehog-interacting protein
Synonyms: Hip1, Hhip1, Hip
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 15245
Homologene: 32469
Muc16
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 73732
Homologene: 141193
Txnl4a
Name: thioredoxin-like 4A
Synonyms: Txnl4, D18Wsu98e, ENSMUSG00000057130, U5-15kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 27366
Homologene: 7150
Abcf3
Name: ATP-binding cassette, sub-family F (GCN20), member 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 27406
HGNC: HGNC:72
Homologene: 22784
Tomm40
Name: translocase of outer mitochondrial membrane 40
Synonyms: Tom40
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 53333
Homologene: 101105
Retreg3
Name: reticulophagy regulator family member 3
Synonyms: Fam134c, 4933404C01Rik, 1300010M03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 67998
Homologene: 23585
Plxna2
Name: plexin A2
Synonyms: 2810428A13Rik, PlexA2, Plxn2, OCT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 18845
HGNC: HGNC:9100
Homologene: 56427
Eif4e
Name: eukaryotic translation initiation factor 4E
Synonyms: If4e, eIF-4E
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 13684
HGNC: HGNC:3287
Homologene: 123817
Lct
Name: lactase
Synonyms: LOC226413, Lphl, LPH
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 226413
HGNC: HGNC:6530
Homologene: 124204
Stat5a
Name: signal transducer and activator of transcription 5A
Synonyms: STAT5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 20850
Homologene: 20680
Lrp1
Name: low density lipoprotein receptor-related protein 1
Synonyms: A2mr, b2b1554Clo, CD91
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 16971
HGNC: HGNC:6692
Homologene: 1744
Smarcd1
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1
Synonyms: Baf60a, D15Kz1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 83797
VEGA: 15
Homologene: 20670
Grk2
Name: G protein-coupled receptor kinase 2
Synonyms: Adrbk1, beta-adrenergic receptor kinase-1, Bark-1, betaARK1, beta ARK, beta ARK1, beta-AR kinase-1, Adrbk-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 110355
HGNC: HGNC:289
Homologene: 1223
Ppp6r2
Name: protein phosphatase 6, regulatory subunit 2
Synonyms: Pp6r2, 1110033O10Rik, B230107H12Rik, Saps2, 8430411H09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 71474
VEGA: 15
Homologene: 36455
Zfp652
Name: zinc finger protein 652
Synonyms: 9530033F24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 268469
Homologene: 54768
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 380698
Homologene: 70869
Pear1
Name: platelet endothelial aggregation receptor 1
Synonyms: 3110045G13Rik, Jedi-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 73182
Homologene: 12492
Fbxw7
Name: F-box and WD-40 domain protein 7
Synonyms: Fbxw6, AGO, Cdc4, Fbw7, SEL-10, 1110001A17Rik, Fbxo30
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 50754
Homologene: 117451
Gm19410
Name: predicted gene, 19410
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 100502846
Homologene: 132117
Ihh
Name: Indian hedgehog
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 16147
HGNC: HGNC:5956
Homologene: 22586
Ugt2a3
Name: UDP glucuronosyltransferase 2 family, polypeptide A3
Synonyms: 2010321J07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 72094
Homologene: 55988
Morc2b
Name: microrchidia 2B
Synonyms: 4932411A10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 240069
Homologene: 18615
1810065E05Rik
Name: RIKEN cDNA 1810065E05 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 69864
Homologene: 87042
Prkce
Name: protein kinase C, epsilon
Synonyms: PKCepsilon, PKC[e], 5830406C15Rik, Pkce
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 18754
HGNC: HGNC:9401
Homologene: 48343
Vmn1r22
Name: vomeronasal 1 receptor 22
Synonyms: V1rc23
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 171196
Homologene: 110825
Aatk
Name: apoptosis-associated tyrosine kinase
Synonyms: AATYK1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 11302
HGNC: HGNC:21
Homologene: 74861
Pdzrn3
Name: PDZ domain containing RING finger 3
Synonyms: 1110020C07Rik, LNX3, Semcap3, semaphorin cytoplasmic domain-associated protein 3A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 55983
Homologene: 10328
Prl5a1
Name: prolactin family 5, subfamily a, member 1
Synonyms: D13Wsu14e, 1600013P04Rik, Prlpl, PLP-L
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 28078
Homologene: 11378
Capn9
Name: calpain 9
Synonyms: GC36, nCL-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 73647
HGNC: HGNC:1486
Homologene: 38208
Barhl2
Name: BarH like homeobox 2
Synonyms: MBH1, E130309B19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 104382
HGNC: HGNC:954
Homologene: 10572
Ercc3
Name: excision repair cross-complementing rodent repair deficiency, complementation group 3
Synonyms: XPB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 13872
HGNC: HGNC:3435
Homologene: 96
Prss3
Name: protease, serine 3
Synonyms: Try3, TRY4, MTG, mesotrypsin, Tb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 22073
Homologene: 88408
Olfr410
Name: olfactory receptor 410
Synonyms: GA_x6K02T2P1NL-4467421-4466474, MOR255-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 258702
Homologene: 68262
Cpox
Name: coproporphyrinogen oxidase
Synonyms: nct, clone 560, cac, Cpo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 12892
VEGA: 16
HGNC: HGNC:2321
Homologene: 76
Col26a1
Name: collagen, type XXVI, alpha 1
Synonyms: Collagen XXVI, 9430032K24Rik, Emid2, Emu2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 140709
Homologene: 136636
Gsdmc3
Name: gasdermin C3
Synonyms: 9930109F21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 270328
HGNC: HGNC:7151
Homologene: 69487
Hyal2
Name: hyaluronoglucosaminidase 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 15587
HGNC: HGNC:5321
Homologene: 7776
Actrt2
Name: actin-related protein T2
Synonyms: Arp-T2, 1700052K15Rik, Arpm2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 73353
Homologene: 23647
Blvrb
Name: biliverdin reductase B (flavin reductase (NADPH))
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 233016
HGNC: HGNC:1063
Homologene: 573
Tcirg1
Name: T cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3
Synonyms: OC-116, Atp6i, V-ATPase a3, TIRC7, ATP6a3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 27060
Homologene: 4392
Hax1
Name: HCLS1 associated X-1
Synonyms: mHAX-1s, Silg111, HAX-1, HS1-associated protein X-1, Hs1bp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 23897
Homologene: 4463
Olfr883
Name: olfactory receptor 883
Synonyms: MOR162-6, GA_x6K02T2PVTD-31705144-31706073
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 258414
Homologene: 86689
4933421I07Rik
Name: RIKEN cDNA 4933421I07 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 71162
Homologene: 86127
Adam1a
Name: a disintegrin and metallopeptidase domain 1a
Synonyms: Ftna, PH-30 alpha, fertilin alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 280668
HGNC: HGNC:187
Homologene: 73803
Tcstv1
Name: 2-cell-stage, variable group, member 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 54382
Gm13090
Name: predicted gene 13090
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 105704528
Esp38
Name: exocrine gland secreted peptide 38
Synonyms: Gm21946
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 100126775
VEGA: 17
Gm28051
Name: predicted gene, 28051
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
Gm44511
Name: predicted gene 44511
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 65,272,697 bp
  • T to C, chromosome 1 at 74,946,727 bp
  • A to G, chromosome 1 at 87,440,732 bp
  • A to G, chromosome 1 at 128,300,018 bp
  • A to T, chromosome 1 at 138,071,249 bp
  • A to G, chromosome 1 at 194,799,814 bp
  • G to A, chromosome 2 at 22,623,736 bp
  • A to G, chromosome 2 at 167,033,640 bp
  • T to A, chromosome 3 at 84,952,641 bp
  • T to A, chromosome 3 at 87,756,913 bp
  • T to A, chromosome 3 at 88,090,171 bp
  • T to C, chromosome 3 at 88,311,722 bp
  • T to C, chromosome 3 at 88,985,019 bp
  • GTCATCATCATCATCATC to GTCATCATCATCATCATCATC, chromosome 3 at 89,997,940 bp
  • T to C, chromosome 3 at 138,550,900 bp
  • T to C, chromosome 3 at 145,149,036 bp
  • T to A, chromosome 4 at 151,090,700 bp
  • T to C, chromosome 4 at 154,666,590 bp
  • T to G, chromosome 5 at 73,099,997 bp
  • A to T, chromosome 5 at 87,336,477 bp
  • T to A, chromosome 5 at 100,542,328 bp
  • T to A, chromosome 5 at 106,455,608 bp
  • A to T, chromosome 5 at 121,519,362 bp
  • T to A, chromosome 5 at 134,595,331 bp
  • A to G, chromosome 5 at 136,847,500 bp
  • T to C, chromosome 6 at 41,377,554 bp
  • T to A, chromosome 6 at 57,900,405 bp
  • A to C, chromosome 6 at 101,362,144 bp
  • C to T, chromosome 6 at 111,501,539 bp
  • T to C, chromosome 6 at 113,551,770 bp
  • T to C, chromosome 6 at 128,820,277 bp
  • A to G, chromosome 7 at 19,710,964 bp
  • A to G, chromosome 7 at 27,462,690 bp
  • A to T, chromosome 7 at 42,446,284 bp
  • T to C, chromosome 7 at 46,167,000 bp
  • G to A, chromosome 8 at 35,812,426 bp
  • A to T, chromosome 8 at 79,972,440 bp
  • A to G, chromosome 8 at 124,605,862 bp
  • A to G, chromosome 9 at 18,659,858 bp
  • ATTGCTGTTT to ATTGCTGTTTGCTGTTT, chromosome 9 at 38,026,540 bp
  • A to G, chromosome 9 at 107,572,199 bp
  • A to T, chromosome 9 at 111,214,171 bp
  • A to G, chromosome 9 at 113,911,578 bp
  • T to C, chromosome 10 at 88,768,679 bp
  • C to T, chromosome 10 at 127,573,403 bp
  • C to T, chromosome 11 at 36,072,729 bp
  • A to G, chromosome 11 at 58,425,755 bp
  • T to A, chromosome 11 at 59,067,090 bp
  • T to C, chromosome 11 at 73,067,722 bp
  • T to A, chromosome 11 at 74,335,088 bp
  • C to T, chromosome 11 at 95,671,419 bp
  • T to G, chromosome 11 at 95,749,962 bp
  • T to C, chromosome 11 at 100,880,316 bp
  • T to C, chromosome 11 at 101,106,400 bp
  • T to C, chromosome 11 at 120,012,364 bp
  • A to C, chromosome 12 at 73,932,281 bp
  • A to C, chromosome 12 at 87,160,174 bp
  • A to T, chromosome 12 at 102,720,185 bp
  • A to T, chromosome 12 at 116,443,021 bp
  • A to T, chromosome 13 at 28,151,264 bp
  • C to A, chromosome 13 at 119,894,451 bp
  • T to C, chromosome 14 at 101,880,990 bp
  • T to A, chromosome 15 at 63,866,751 bp
  • A to G, chromosome 15 at 89,282,910 bp
  • G to T, chromosome 15 at 99,705,738 bp
  • A to G, chromosome 16 at 20,550,570 bp
  • T to A, chromosome 16 at 58,670,935 bp
  • A to G, chromosome 17 at 33,137,983 bp
  • G to A, chromosome 17 at 39,955,141 bp
  • A to T, chromosome 17 at 86,493,230 bp
  • T to C, chromosome 18 at 32,245,921 bp
  • G to T, chromosome 18 at 67,421,259 bp
  • T to C, chromosome 18 at 80,207,267 bp
  • T to C, chromosome 19 at 3,897,487 bp
  • C to T, chromosome 19 at 4,290,783 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6026 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
044198-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.