Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6026Btlr/Mmmh
Stock Number:
044198-MU
Citation ID:
RRID:MMRRC_044198-MU
Other Names:
R6026 (G1)
Major Collection:

Strain Information

Phb1
Name: prohibitin 1
Synonyms: Phb
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18673
HGNC: HGNC:8912
Homologene: 1980
Gad2
Name: glutamic acid decarboxylase 2
Synonyms: GAD65, Gad-2, 6330404F12Rik, GAD(65)
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14417
HGNC: HGNC:4093
Homologene: 20223
Utp20
Name: UTP20 small subunit processome component
Synonyms: mDRIM, DRIM, 3830408P06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Fancd2
Name: Fanconi anemia, complementation group D2
Synonyms: 2410150O07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 211651
HGNC: HGNC:3585
Homologene: 13212
Odf2l
Name: outer dense fiber of sperm tails 2-like
Synonyms: 4733401D09Rik, 9630045K08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 52184
Homologene: 12011
Cops4
Name: COP9 signalosome subunit 4
Synonyms: COP9 complex S4, D5Ertd774e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26891
Homologene: 8067
Fryl
Name: FRY like transcription coactivator
Synonyms: 2310004H21Rik, 2510002A14Rik, 9030227G01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72313
Homologene: 103956
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 65,272,697 bp
  • T to C, chromosome 1 at 74,946,727 bp
  • A to G, chromosome 1 at 87,440,732 bp
  • A to G, chromosome 1 at 128,300,018 bp
  • A to T, chromosome 1 at 138,071,249 bp
  • A to G, chromosome 1 at 194,799,814 bp
  • G to A, chromosome 2 at 22,623,736 bp
  • A to G, chromosome 2 at 167,033,640 bp
  • T to A, chromosome 3 at 84,952,641 bp
  • T to A, chromosome 3 at 87,756,913 bp
  • T to A, chromosome 3 at 88,090,171 bp
  • T to C, chromosome 3 at 88,311,722 bp
  • T to C, chromosome 3 at 88,985,019 bp
  • GTCATCATCATCATCATC to GTCATCATCATCATCATCATC, chromosome 3 at 89,997,940 bp
  • T to C, chromosome 3 at 138,550,900 bp
  • T to C, chromosome 3 at 145,149,036 bp
  • T to A, chromosome 4 at 151,090,700 bp
  • T to C, chromosome 4 at 154,666,590 bp
  • T to G, chromosome 5 at 73,099,997 bp
  • A to T, chromosome 5 at 87,336,477 bp
  • T to A, chromosome 5 at 100,542,328 bp
  • T to A, chromosome 5 at 106,455,608 bp
  • A to T, chromosome 5 at 121,519,362 bp
  • T to A, chromosome 5 at 134,595,331 bp
  • A to G, chromosome 5 at 136,847,500 bp
  • T to C, chromosome 6 at 41,377,554 bp
  • T to A, chromosome 6 at 57,900,405 bp
  • A to C, chromosome 6 at 101,362,144 bp
  • C to T, chromosome 6 at 111,501,539 bp
  • T to C, chromosome 6 at 113,551,770 bp
  • T to C, chromosome 6 at 128,820,277 bp
  • A to G, chromosome 7 at 19,710,964 bp
  • A to G, chromosome 7 at 27,462,690 bp
  • A to T, chromosome 7 at 42,446,284 bp
  • T to C, chromosome 7 at 46,167,000 bp
  • G to A, chromosome 8 at 35,812,426 bp
  • A to T, chromosome 8 at 79,972,440 bp
  • A to G, chromosome 8 at 124,605,862 bp
  • A to G, chromosome 9 at 18,659,858 bp
  • ATTGCTGTTT to ATTGCTGTTTGCTGTTT, chromosome 9 at 38,026,540 bp
  • A to G, chromosome 9 at 107,572,199 bp
  • A to T, chromosome 9 at 111,214,171 bp
  • A to G, chromosome 9 at 113,911,578 bp
  • T to C, chromosome 10 at 88,768,679 bp
  • C to T, chromosome 10 at 127,573,403 bp
  • C to T, chromosome 11 at 36,072,729 bp
  • A to G, chromosome 11 at 58,425,755 bp
  • T to A, chromosome 11 at 59,067,090 bp
  • T to C, chromosome 11 at 73,067,722 bp
  • T to A, chromosome 11 at 74,335,088 bp
  • C to T, chromosome 11 at 95,671,419 bp
  • T to G, chromosome 11 at 95,749,962 bp
  • T to C, chromosome 11 at 100,880,316 bp
  • T to C, chromosome 11 at 101,106,400 bp
  • T to C, chromosome 11 at 120,012,364 bp
  • A to C, chromosome 12 at 73,932,281 bp
  • A to C, chromosome 12 at 87,160,174 bp
  • A to T, chromosome 12 at 102,720,185 bp
  • A to T, chromosome 12 at 116,443,021 bp
  • A to T, chromosome 13 at 28,151,264 bp
  • C to A, chromosome 13 at 119,894,451 bp
  • T to C, chromosome 14 at 101,880,990 bp
  • T to A, chromosome 15 at 63,866,751 bp
  • A to G, chromosome 15 at 89,282,910 bp
  • G to T, chromosome 15 at 99,705,738 bp
  • A to G, chromosome 16 at 20,550,570 bp
  • T to A, chromosome 16 at 58,670,935 bp
  • A to G, chromosome 17 at 33,137,983 bp
  • G to A, chromosome 17 at 39,955,141 bp
  • A to T, chromosome 17 at 86,493,230 bp
  • T to C, chromosome 18 at 32,245,921 bp
  • G to T, chromosome 18 at 67,421,259 bp
  • T to C, chromosome 18 at 80,207,267 bp
  • T to C, chromosome 19 at 3,897,487 bp
  • C to T, chromosome 19 at 4,290,783 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6026 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044198-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.