Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6035Btlr/Mmmh
Stock Number:
044207-MU
Citation ID:
RRID:MMRRC_044207-MU
Other Names:
R6035 (G1)
Major Collection:

Strain Information

Itga8
Name: integrin alpha 8
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241226
HGNC: HGNC:6144
Homologene: 37396
Shh
Name: sonic hedgehog
Synonyms: Hhg1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20423
Homologene: 30961
Ebf2
Name: early B cell factor 2
Synonyms: O/E-3, D14Ggc1e, Mmot1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13592
Homologene: 56471
Adcy9
Name: adenylate cyclase 9
Synonyms: D16Wsu65e, ACtp10
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11515
HGNC: HGNC:240
Homologene: 868
Nup155
Name: nucleoporin 155
Synonyms: D930027M19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170762
VEGA: 15
HGNC: HGNC:8063
Homologene: 43155
Lhx9
Name: LIM homeobox protein 9
Synonyms: LH2B, Lhx9 alpha, 3110009O07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16876
Homologene: 7816
Arhgap39
Name: Rho GTPase activating protein 39
Synonyms: D15Wsu169e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223666
Homologene: 27825
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 87,410,728 bp
  • G to A, chromosome 1 at 88,230,668 bp
  • T to C, chromosome 1 at 138,838,543 bp
  • A to C, chromosome 1 at 162,964,036 bp
  • T to A, chromosome 1 at 164,141,510 bp
  • T to C, chromosome 2 at 12,191,714 bp
  • T to A, chromosome 2 at 36,479,984 bp
  • C to A, chromosome 2 at 104,787,123 bp
  • A to T, chromosome 2 at 160,779,543 bp
  • T to C, chromosome 3 at 88,985,019 bp
  • GTCATCATCATCATCATC to GTCATCATCATCATCATCATC, chromosome 3 at 89,997,940 bp
  • T to C, chromosome 3 at 116,125,957 bp
  • A to G, chromosome 4 at 98,929,845 bp
  • G to T, chromosome 4 at 116,097,469 bp
  • G to A, chromosome 5 at 28,461,399 bp
  • T to C, chromosome 5 at 29,601,163 bp
  • C to A, chromosome 5 at 31,048,824 bp
  • A to G, chromosome 5 at 35,517,585 bp
  • T to C, chromosome 5 at 87,139,682 bp
  • T to C, chromosome 5 at 98,275,526 bp
  • T to A, chromosome 5 at 107,593,880 bp
  • A to T, chromosome 6 at 41,202,634 bp
  • G to A, chromosome 6 at 50,229,326 bp
  • A to G, chromosome 6 at 88,841,806 bp
  • G to A, chromosome 6 at 91,263,353 bp
  • A to G, chromosome 6 at 97,247,273 bp
  • G to A, chromosome 6 at 106,741,265 bp
  • G to T, chromosome 6 at 121,638,394 bp
  • G to A, chromosome 6 at 128,893,624 bp
  • C to T, chromosome 7 at 7,334,351 bp
  • A to G, chromosome 7 at 13,084,927 bp
  • T to A, chromosome 7 at 21,360,609 bp
  • G to A, chromosome 7 at 85,951,890 bp
  • ATGGCG to ATGGCGACGGTGGCG, chromosome 7 at 97,579,904 bp
  • A to G, chromosome 7 at 97,662,109 bp
  • G to A, chromosome 7 at 100,354,795 bp
  • A to G, chromosome 8 at 21,734,549 bp
  • G to T, chromosome 8 at 34,918,461 bp
  • A to G, chromosome 8 at 86,517,404 bp
  • G to T, chromosome 8 at 105,692,563 bp
  • A to G, chromosome 8 at 118,505,698 bp
  • ATTGCTGTTT to ATTGCTGTTTGCTGTTT, chromosome 9 at 38,026,540 bp
  • A to G, chromosome 9 at 57,611,747 bp
  • T to A, chromosome 9 at 79,759,746 bp
  • G to T, chromosome 10 at 52,077,971 bp
  • A to G, chromosome 10 at 62,751,785 bp
  • T to C, chromosome 10 at 89,592,075 bp
  • T to C, chromosome 11 at 73,353,756 bp
  • T to C, chromosome 11 at 74,317,459 bp
  • C to T, chromosome 11 at 99,333,589 bp
  • G to A, chromosome 11 at 106,019,152 bp
  • A to G, chromosome 11 at 106,266,889 bp
  • A to T, chromosome 11 at 109,971,860 bp
  • C to A, chromosome 12 at 24,608,450 bp
  • G to C, chromosome 12 at 83,774,680 bp
  • A to T, chromosome 12 at 117,255,595 bp
  • T to A, chromosome 13 at 22,806,032 bp
  • A to T, chromosome 13 at 51,461,432 bp
  • T to C, chromosome 13 at 55,533,968 bp
  • T to A, chromosome 13 at 60,761,199 bp
  • A to G, chromosome 13 at 95,027,597 bp
  • C to A, chromosome 13 at 96,832,213 bp
  • C to T, chromosome 14 at 20,377,917 bp
  • G to A, chromosome 14 at 47,087,872 bp
  • A to G, chromosome 14 at 50,424,527 bp
  • A to G, chromosome 14 at 67,238,974 bp
  • G to A, chromosome 15 at 7,887,349 bp
  • A to G, chromosome 15 at 8,144,093 bp
  • A to T, chromosome 15 at 74,540,443 bp
  • G to T, chromosome 15 at 76,737,224 bp
  • T to C, chromosome 16 at 4,304,513 bp
  • A to T, chromosome 16 at 18,258,314 bp
  • T to A, chromosome 16 at 97,744,187 bp
  • A to G, chromosome 17 at 6,728,265 bp
  • A to T, chromosome 17 at 24,281,245 bp
  • A to G, chromosome 17 at 88,711,534 bp
  • T to C, chromosome 18 at 10,501,025 bp
  • T to A, chromosome 18 at 15,452,853 bp
  • T to C, chromosome 18 at 35,654,782 bp
  • T to G, chromosome 18 at 65,623,934 bp
  • G to T, chromosome 18 at 67,421,259 bp
  • G to A, chromosome 19 at 29,446,035 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6035 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044207-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.