Strain Name:
C57BL/6J-MtgxR6035Btlr/Mmmh
Stock Number:
044207-MU
Citation ID:
RRID:MMRRC_044207-MU
Other Names:
R6035 (G1)
Major Collection:

Strain Information

Itga8
Name: integrin alpha 8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241226
HGNC: HGNC:6144
Homologene: 37396
Shh
Name: sonic hedgehog
Synonyms: Hhg1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 20423
Homologene: 30961
Ebf2
Name: early B cell factor 2
Synonyms: O/E-3, Mmot1, D14Ggc1e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 13592
Homologene: 56471
Adcy9
Name: adenylate cyclase 9
Synonyms: D16Wsu65e, ACtp10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 11515
HGNC: HGNC:240
Homologene: 868
Nup155
Name: nucleoporin 155
Synonyms: D930027M19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 170762
VEGA: 15
HGNC: HGNC:8063
Homologene: 43155
Lhx9
Name: LIM homeobox protein 9
Synonyms: LH2B, Lhx9 alpha, 3110009O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16876
Homologene: 7816
Arhgap39
Name: Rho GTPase activating protein 39
Synonyms: D15Wsu169e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223666
Homologene: 27825
Rad54l
Name: RAD54 like (S. cerevisiae)
Synonyms: RAD54
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 19366
HGNC: HGNC:9826
Homologene: 48227
Usp1
Name: ubiquitin specific peptidase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230484
Homologene: 2528
Wdr70
Name: WD repeat domain 70
Synonyms: 4833422F06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 545085
VEGA: 15
Homologene: 9972
Zfp532
Name: zinc finger protein 532
Synonyms: C530030I18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 328977
Homologene: 138627
Ube3c
Name: ubiquitin protein ligase E3C
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100763
Homologene: 8783
Tnks
Name: tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
Synonyms: 4930554K12Rik, D130072O21Rik, tankyrase 1, TANK1, mTNKS1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 21951
Homologene: 18405
Ccar1
Name: cell division cycle and apoptosis regulator 1
Synonyms: Carp1, 2610511G16Rik, 9430036H15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 67500
VEGA: 10
Homologene: 10086
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233532
Homologene: 41142
Afg3l2
Name: AFG3-like AAA ATPase 2
Synonyms: 2310036I02Rik, par, Emv66
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 69597
VEGA: 18
HGNC: HGNC:315
Homologene: 4947
Smarcd2
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2
Synonyms: Baf60b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 83796
Homologene: 20671
Ash1l
Name: ASH1 like histone lysine methyltransferase
Synonyms: chromatin remodeling factor, 8030453L17Rik, E430018P19Rik, KMT2H
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 192195
Homologene: 10225
Gigyf2
Name: GRB10 interacting GYF protein 2
Synonyms: A830080H02Rik, 2610016F01Rik, Tnrc15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227331
Homologene: 41048
Abca17
Name: ATP-binding cassette, sub-family A member 17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 381072
Homologene: 86807
Slc17a8
Name: solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8
Synonyms: Vglut3, Vgt3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216227
Homologene: 13584
Pdcd1lg2
Name: programmed cell death 1 ligand 2
Synonyms: B7-DC, PD-L2, Btdc, F730015O22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 58205
Homologene: 10973
Grhl1
Name: grainyhead like transcription factor 1
Synonyms: p70 MGR, p61 MGR, LBP-32, Tcfcp2l2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 195733
VEGA: 12
Homologene: 32219
Lman1l
Name: lectin, mannose-binding 1 like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235416
HGNC: HGNC:6632
Homologene: 11047
Dapk1
Name: death associated protein kinase 1
Synonyms: 2310039H24Rik, D13Ucla1, 2810425C21Rik, DAP-Kinase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 69635
VEGA: 13
HGNC: HGNC:2674
Homologene: 3626
Ppme1
Name: protein phosphatase methylesterase 1
Synonyms: 1110069N17Rik, 2700017M01Rik, PME-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 72590
Homologene: 6099
Ddx41
Name: DEAD box helicase 41
Synonyms: 2900024F02Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 41
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 72935
VEGA: 13
Homologene: 9431
Qser1
Name: glutamine and serine rich 1
Synonyms: 4732486I23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 99003
Homologene: 11710
Dgcr8
Name: DGCR8, microprocessor complex subunit
Synonyms: N41, D16H22S788E, D16Wis2, Gy1, D16H22S1742E, Vo59c07, DiGeorge syndrome critical region gene 8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 94223
HGNC: HGNC:2847
Homologene: 11223
Papln
Name: papilin, proteoglycan-like sulfated glycoprotein
Synonyms: E030033C16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 170721
Homologene: 71541
Chst9
Name: carbohydrate sulfotransferase 9
Synonyms: GalNAc4ST-2, 5430438D01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 71367
Homologene: 12861
Fgf5
Name: fibroblast growth factor 5
Synonyms: Fgf-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 14176
HGNC: HGNC:3683
Homologene: 3283
Samd4
Name: sterile alpha motif domain containing 4
Synonyms: 4933436G17Rik, 1700111L17Rik, 1700024G08Rik, Smaug, sunk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 74480
Homologene: 19167
Cdh13
Name: cadherin 13
Synonyms: T-cadherin, Tcad, 4932416G01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12554
HGNC: HGNC:1753
Homologene: 20335
Abcc12
Name: ATP-binding cassette, sub-family C member 12
Synonyms: MRP9, 4930467B22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244562
Homologene: 57211
Mroh2a
Name: maestro heat-like repeat family member 2A
Synonyms: ENSMUSG00000044873, OTTMUSG00000020804, Heatr7b1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 100040766
Homologene: 85300
Il5ra
Name: interleukin 5 receptor, alpha
Synonyms: IL-5 receptor alpha chain, CD125, Il5r, CDw125
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 16192
HGNC: HGNC:6017
Homologene: 473
A2m
Name: alpha-2-macroglobulin
Synonyms: A2mp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232345
HGNC: HGNC:7
Homologene: 37248
Ros1
Name: Ros1 proto-oncogene
Synonyms: Ros-1, c-ros
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 19886
Homologene: 2207
Abca8b
Name: ATP-binding cassette, sub-family A member 8b
Synonyms: Abca8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 27404
HGNC: HGNC:38
Homologene: 56029
Gsdme
Name: gasdermin E
Synonyms: 4932441K13Rik, 2310037D07Rik, Fin15, Dfna5h, Dfna5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 54722
HGNC: HGNC:2810
Homologene: 3242
Ripk4
Name: receptor-interacting serine-threonine kinase 4
Synonyms: PKK, DIk, RIP4, ANKK2, Ankrd3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 72388
HGNC: HGNC:496
Homologene: 10772
Ptprn2
Name: protein tyrosine phosphatase receptor type N polypeptide 2
Synonyms: PTP-NP, IA-2 beta, phogrin, IA-2beta, 4930425H11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 19276
HGNC: HGNC:9677
Homologene: 2134
Glmn
Name: glomulin, FKBP associated protein
Synonyms: Fap68, Fap48, 9330160J16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 170823
Homologene: 14239
Lmod3
Name: leiomodin 3 (fetal)
Synonyms: 5430424A14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 320502
HGNC: HGNC:6649
Homologene: 28097
Kcnh6
Name: potassium voltage-gated channel, subfamily H (eag-related), member 6
Synonyms: m-erg2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 192775
Homologene: 32740
Greb1l
Name: growth regulation by estrogen in breast cancer-like
Synonyms: mKIAA4095, AK220484
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 381157
Homologene: 73393
Fbln2
Name: fibulin 2
Synonyms: 5730577E14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 14115
HGNC: HGNC:3601
Homologene: 1514
Vmn2r74
Name: vomeronasal 2, receptor 74
Synonyms: EG546980
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 546980
Homologene: 115466
Krt26
Name: keratin 26
Synonyms: 4732407F15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 320864
Homologene: 37118
Adgrb1
Name: adhesion G protein-coupled receptor B1
Synonyms: B830018M07Rik, Bai1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 107831
HGNC: HGNC:943
Homologene: 1287
Prob1
Name: proline rich basic protein 1
Synonyms: LOC381148, Gm1614
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 381148
Homologene: 83773
Vcam1
Name: vascular cell adhesion molecule 1
Synonyms: CD106, Vcam-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 22329
Homologene: 838
Pde8b
Name: phosphodiesterase 8B
Synonyms: B230331L10Rik, C030047E14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218461
HGNC: HGNC:8794
Homologene: 2758
Abtb1
Name: ankyrin repeat and BTB domain containing 1
Synonyms: BPOZ, EF1ABP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 80283
Homologene: 32731
Cpz
Name: carboxypeptidase Z
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 242939
HGNC: HGNC:2333
Homologene: 2709
Fam149b
Name: family with sequence similarity 149, member B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 105428
VEGA: 14
Homologene: 67023
Ugt2b5
Name: UDP glucuronosyltransferase 2 family, polypeptide B5
Synonyms: Udpgt-3, m-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 22238
Homologene: 137225
Vmn1r85
Name: vomeronasal 1 receptor 85
Synonyms: V1rj3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 252909
Homologene: 74338
Vmn1r209
Name: vomeronasal 1 receptor 209
Synonyms: Gm11315
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 432736
Homologene: 110880
Or11g24
Name: olfactory receptor family 11 subfamily G member 24
Synonyms: GA_x6K02T2PMLR-6121675-6122604, MOR106-2, Olfr739
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 258663
Homologene: 121549
Clec2i
Name: C-type lectin domain family 2, member i
Synonyms: Clr-g, OCILrP2, Clrg, Dcl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 93675
Homologene: 136309
Zhx3
Name: zinc fingers and homeoboxes 3
Synonyms: 4932418O04Rik, 1810059C13Rik, 9530010N21Rik, Tix1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 320799
Homologene: 9000
Shc3
Name: src homology 2 domain-containing transforming protein C3
Synonyms: ShcC, N-Shc, Rai
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 20418
VEGA: 13
Homologene: 7536
Carmil2
Name: capping protein regulator and myosin 1 linker 2
Synonyms: D130029J02Rik, Rltpr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234695
Homologene: 128439
Fmo3
Name: flavin containing monooxygenase 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14262
HGNC: HGNC:3771
Homologene: 128199
Or1e1
Name: olfactory receptor family 1 subfamily E member 1
Synonyms: MTPCR55, MTPCR06, Olfr21, MOR135-11, GA_x6K02T2P1NL-3514066-3515010, Olfr20
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 258925
Homologene: 128054
Trbv21
Name: T cell receptor beta, variable 21
Synonyms: Tcrb-V19, Gm16778
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 100124686
Hax1
Name: HCLS1 associated X-1
Synonyms: mHAX-1s, HAX-1, Silg111, Hs1bp1, HS1-associated protein X-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 23897
Homologene: 4463
Gtf2a1l
Name: general transcription factor IIA, 1-like
Synonyms: 1700011N16Rik, Alf, Gtf2a1lf
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 71828
Homologene: 86732
Or8b36
Name: olfactory receptor family 8 subfamily B member 36
Synonyms: GA_x6K02T2PVTD-31705144-31706073, MOR162-6, Olfr883
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258414
Homologene: 86689
Or1j13
Name: olfactory receptor family 1 subfamily J member 13
Synonyms: GA_x6K02T2NLDC-33174915-33173974, MOR136-2, Olfr341
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258952
Homologene: 74160
Slc5a6
Name: solute carrier family 5 (sodium-dependent vitamin transporter), member 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 330064
Homologene: 23277
Cox7a2
Name: cytochrome c oxidase subunit 7A2
Synonyms: COX7AL, Cox7a3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12866
VEGA: 9
Homologene: 36082
Sytl3
Name: synaptotagmin-like 3
Synonyms: Slp3-a, Slp3-b, Slp3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 83672
Homologene: 12855
Vmn1r129
Name: vomeronasal 1 receptor 129
Synonyms: Gm6237
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 621510
Homologene: 104166
Selp
Name: selectin, platelet
Synonyms: CD62P, P-selectin, Grmp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20344
Homologene: 2260
Defa24
Name: defensin, alpha, 24
Synonyms: Defcr24
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 503491
Homologene: 113382
Vmn2r30
Name: vomeronasal 2, receptor 30
Synonyms: V2r15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 22306
Homologene: 113703
Ankrd31
Name: ankyrin repeat domain 31
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 625662
Homologene: 110355
Or1p4-ps1
Name: olfactory receptor family 1 subfamily P member 4, pseudogene 1
Synonyms: GA_x6K02T2P1NL-4449217-4450187, MOR133-2, Olfr409-ps1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 258131
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 87,410,728 bp
  • G to A, chromosome 1 at 88,230,668 bp
  • T to C, chromosome 1 at 138,838,543 bp
  • A to C, chromosome 1 at 162,964,036 bp
  • T to A, chromosome 1 at 164,141,510 bp
  • T to C, chromosome 2 at 12,191,714 bp
  • T to A, chromosome 2 at 36,479,984 bp
  • C to A, chromosome 2 at 104,787,123 bp
  • A to T, chromosome 2 at 160,779,543 bp
  • T to C, chromosome 3 at 88,985,019 bp
  • GTCATCATCATCATCATC to GTCATCATCATCATCATCATC, chromosome 3 at 89,997,940 bp
  • T to C, chromosome 3 at 116,125,957 bp
  • A to G, chromosome 4 at 98,929,845 bp
  • G to T, chromosome 4 at 116,097,469 bp
  • G to A, chromosome 5 at 28,461,399 bp
  • T to C, chromosome 5 at 29,601,163 bp
  • C to A, chromosome 5 at 31,048,824 bp
  • A to G, chromosome 5 at 35,517,585 bp
  • T to C, chromosome 5 at 87,139,682 bp
  • T to C, chromosome 5 at 98,275,526 bp
  • T to A, chromosome 5 at 107,593,880 bp
  • A to T, chromosome 6 at 41,202,634 bp
  • G to A, chromosome 6 at 50,229,326 bp
  • A to G, chromosome 6 at 88,841,806 bp
  • G to A, chromosome 6 at 91,263,353 bp
  • A to G, chromosome 6 at 97,247,273 bp
  • G to A, chromosome 6 at 106,741,265 bp
  • G to T, chromosome 6 at 121,638,394 bp
  • G to A, chromosome 6 at 128,893,624 bp
  • C to T, chromosome 7 at 7,334,351 bp
  • A to G, chromosome 7 at 13,084,927 bp
  • T to A, chromosome 7 at 21,360,609 bp
  • G to A, chromosome 7 at 85,951,890 bp
  • ATGGCG to ATGGCGACGGTGGCG, chromosome 7 at 97,579,904 bp
  • A to G, chromosome 7 at 97,662,109 bp
  • G to A, chromosome 7 at 100,354,795 bp
  • A to G, chromosome 8 at 21,734,549 bp
  • G to T, chromosome 8 at 34,918,461 bp
  • A to G, chromosome 8 at 86,517,404 bp
  • G to T, chromosome 8 at 105,692,563 bp
  • A to G, chromosome 8 at 118,505,698 bp
  • ATTGCTGTTT to ATTGCTGTTTGCTGTTT, chromosome 9 at 38,026,540 bp
  • A to G, chromosome 9 at 57,611,747 bp
  • T to A, chromosome 9 at 79,759,746 bp
  • G to T, chromosome 10 at 52,077,971 bp
  • A to G, chromosome 10 at 62,751,785 bp
  • T to C, chromosome 10 at 89,592,075 bp
  • T to C, chromosome 11 at 73,353,756 bp
  • T to C, chromosome 11 at 74,317,459 bp
  • C to T, chromosome 11 at 99,333,589 bp
  • G to A, chromosome 11 at 106,019,152 bp
  • A to G, chromosome 11 at 106,266,889 bp
  • A to T, chromosome 11 at 109,971,860 bp
  • C to A, chromosome 12 at 24,608,450 bp
  • G to C, chromosome 12 at 83,774,680 bp
  • A to T, chromosome 12 at 117,255,595 bp
  • T to A, chromosome 13 at 22,806,032 bp
  • A to T, chromosome 13 at 51,461,432 bp
  • T to C, chromosome 13 at 55,533,968 bp
  • T to A, chromosome 13 at 60,761,199 bp
  • A to G, chromosome 13 at 95,027,597 bp
  • C to A, chromosome 13 at 96,832,213 bp
  • C to T, chromosome 14 at 20,377,917 bp
  • G to A, chromosome 14 at 47,087,872 bp
  • A to G, chromosome 14 at 50,424,527 bp
  • A to G, chromosome 14 at 67,238,974 bp
  • G to A, chromosome 15 at 7,887,349 bp
  • A to G, chromosome 15 at 8,144,093 bp
  • A to T, chromosome 15 at 74,540,443 bp
  • G to T, chromosome 15 at 76,737,224 bp
  • T to C, chromosome 16 at 4,304,513 bp
  • A to T, chromosome 16 at 18,258,314 bp
  • T to A, chromosome 16 at 97,744,187 bp
  • A to G, chromosome 17 at 6,728,265 bp
  • A to T, chromosome 17 at 24,281,245 bp
  • A to G, chromosome 17 at 88,711,534 bp
  • T to C, chromosome 18 at 10,501,025 bp
  • T to A, chromosome 18 at 15,452,853 bp
  • T to C, chromosome 18 at 35,654,782 bp
  • T to G, chromosome 18 at 65,623,934 bp
  • G to T, chromosome 18 at 67,421,259 bp
  • G to A, chromosome 19 at 29,446,035 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6035 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044207-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.