Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6091Btlr
Stock Number:
044248-MU
Citation ID:
RRID:MMRRC_044248-MU
Other Names:
R6091 (G1)
Major Collection:

Strain Information

Ncor1
Name: nuclear receptor co-repressor 1
Synonyms: N-CoR, Rxrip13, A230020K14Rik, 5730405M06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20185
HGNC: HGNC:7672
Homologene: 38166
Chd7
Name: chromodomain helicase DNA binding protein 7
Synonyms: GENA 60, GENA 47, Gena 52, Cyn, A730019I05Rik, WBE1, Whi, Todo, Obt, Mt, Lda, Flo, Edy, Dz, Cycn
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320790
Homologene: 19067
Ano1
Name: anoctamin 1, calcium activated chloride channel
Synonyms: Tmem16a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101772
Homologene: 75079
Rbm47
Name: RNA binding motif protein 47
Synonyms: 9530077J19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 245945
Homologene: 36932
Zbtb32
Name: zinc finger and BTB domain containing 32
Synonyms: Tzfp, 4930524C15Rik, PLZP, Rog
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 58206
Homologene: 8661
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, C130061D10Rik, Phr1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105689
Homologene: 9005
Ddx42
Name: DEAD box helicase 42
Synonyms: B430002H05Rik, 1810047H21Rik, SF3b125, DEAD (Asp-Glu-Ala-Asp) box polypeptide 42
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72047
Homologene: 49137
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 60,181,556 bp
  • GCCC to GC, chromosome 1 at 88,232,257 bp
  • T to C, chromosome 1 at 93,301,569 bp
  • C to T, chromosome 1 at 176,755,831 bp
  • T to G, chromosome 1 at 188,399,803 bp
  • G to A, chromosome 2 at 26,426,470 bp
  • T to G, chromosome 2 at 35,362,336 bp
  • A to G, chromosome 2 at 70,238,769 bp
  • T to A, chromosome 2 at 87,071,361 bp
  • A to G, chromosome 3 at 37,084,969 bp
  • C to A, chromosome 3 at 67,599,937 bp
  • T to A, chromosome 4 at 3,184,684 bp
  • T to C, chromosome 4 at 8,751,875 bp
  • T to C, chromosome 4 at 48,459,891 bp
  • A to G, chromosome 4 at 82,900,559 bp
  • T to A, chromosome 4 at 88,522,576 bp
  • G to A, chromosome 5 at 39,614,664 bp
  • G to C, chromosome 5 at 66,026,283 bp
  • G to T, chromosome 5 at 72,514,190 bp
  • G to T, chromosome 5 at 105,331,388 bp
  • G to A, chromosome 6 at 14,719,340 bp
  • T to C, chromosome 6 at 83,119,487 bp
  • T to A, chromosome 7 at 5,493,791 bp
  • A to G, chromosome 7 at 28,104,965 bp
  • T to C, chromosome 7 at 29,071,973 bp
  • A to G, chromosome 7 at 30,591,829 bp
  • G to A, chromosome 7 at 78,788,718 bp
  • T to A, chromosome 7 at 82,465,621 bp
  • A to T, chromosome 7 at 144,669,434 bp
  • A to G, chromosome 8 at 89,028,619 bp
  • A to G, chromosome 8 at 91,035,063 bp
  • T to A, chromosome 9 at 86,839,628 bp
  • A to G, chromosome 9 at 92,204,384 bp
  • A to G, chromosome 9 at 108,955,334 bp
  • A to G, chromosome 9 at 120,017,963 bp
  • T to C, chromosome 10 at 116,849,206 bp
  • G to A, chromosome 10 at 128,634,673 bp
  • A to G, chromosome 11 at 62,419,617 bp
  • A to T, chromosome 11 at 86,236,603 bp
  • A to T, chromosome 11 at 106,234,970 bp
  • T to C, chromosome 12 at 115,193,877 bp
  • T to A, chromosome 13 at 19,125,123 bp
  • G to A, chromosome 14 at 12,215,979 bp
  • T to C, chromosome 14 at 33,522,863 bp
  • A to C, chromosome 14 at 103,223,046 bp
  • G to T, chromosome 15 at 100,512,313 bp
  • A to G, chromosome 16 at 97,546,435 bp
  • A to G, chromosome 17 at 18,325,696 bp
  • A to G, chromosome 17 at 20,624,270 bp
  • G to A, chromosome 17 at 34,710,364 bp
  • T to A, chromosome 17 at 57,221,967 bp
  • A to G, chromosome 18 at 24,014,212 bp
  • GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC to GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC, chromosome 18 at 39,486,958 bp
  • C to T, chromosome 18 at 71,809,114 bp
  • A to G, chromosome 19 at 7,711,063 bp
  • T to C, chromosome 19 at 8,778,556 bp
  • T to C, chromosome 19 at 41,593,624 bp
  • T to C, chromosome 19 at 50,288,101 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6091 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044248-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.