Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6091Btlr
Stock Number:
044248-MU
Citation ID:
RRID:MMRRC_044248-MU
Other Names:
R6091 (G1)
Major Collection:

Strain Information

Ncor1
Name: nuclear receptor co-repressor 1
Synonyms: N-CoR, Rxrip13, A230020K14Rik, 5730405M06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20185
HGNC: HGNC:7672
Homologene: 38166
Chd7
Name: chromodomain helicase DNA binding protein 7
Synonyms: GENA 60, GENA 47, Gena 52, Cyn, A730019I05Rik, WBE1, Whi, Todo, Obt, Mt, Lda, Flo, Edy, Dz, Cycn
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320790
Homologene: 19067
Ano1
Name: anoctamin 1, calcium activated chloride channel
Synonyms: Tmem16a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101772
Homologene: 75079
Rbm47
Name: RNA binding motif protein 47
Synonyms: 9530077J19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 245945
Homologene: 36932
Zbtb32
Name: zinc finger and BTB domain containing 32
Synonyms: Tzfp, 4930524C15Rik, PLZP, Rog
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 58206
Homologene: 8661
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, C130061D10Rik, Phr1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105689
Homologene: 9005
Ddx42
Name: DEAD box helicase 42
Synonyms: B430002H05Rik, 1810047H21Rik, SF3b125, DEAD (Asp-Glu-Ala-Asp) box polypeptide 42
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72047
Homologene: 49137
Ptprg
Name: protein tyrosine phosphatase receptor type G
Synonyms: 5430405N12Rik, RPTPgamma
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19270
HGNC: HGNC:9671
Homologene: 2129
Chd9
Name: chromodomain helicase DNA binding protein 9
Synonyms: 1810014J18Rik, AD013, A330063D19Rik, 9030205D12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 109151
Homologene: 11844
Sec16a
Name: SEC16 homolog A, endoplasmic reticulum export factor
Synonyms: C230052J16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227648
Homologene: 10533
Sall1
Name: spalt like transcription factor 1
Synonyms: Msal-3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 58198
Homologene: 2230
Cep170
Name: centrosomal protein 170
Synonyms: 4933426L22Rik, A330004A13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545389
Homologene: 22844
Tfcp2
Name: transcription factor CP2
Synonyms: LBP-1d, LBP-1c, LSF, UBP-1, CP-2, LBP1, CP2, D230015P20Rik, Tcfcp2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 21422
VEGA: 15
Homologene: 4134
Snap91
Name: synaptosomal-associated protein 91
Synonyms: F1-20, 91kDa, AP180
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20616
Homologene: 8429
Nr3c1
Name: nuclear receptor subfamily 3, group C, member 1
Synonyms: GR, Grl-1, Grl1, glucocorticoid receptor
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 14815
HGNC: HGNC:7978
Homologene: 30960
Frem1
Name: Fras1 related extracellular matrix protein 1
Synonyms: eyem02Jus, heb, QBRICK, crf11, eyes2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329872
Homologene: 27049
Dcc
Name: DCC netrin 1 receptor
Synonyms: C030036D22Rik, Igdcc1, deleted in colorectal carcinoma
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13176
HGNC: HGNC:2701
Homologene: 21081
C3
Name: complement component 3
Synonyms: complement factor 3, acylation stimulating protein, Plp
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12266
HGNC: HGNC:1318
Homologene: 68031
Ints2
Name: integrator complex subunit 2
Synonyms: 2810417D08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70422
Homologene: 10801
Nbeal1
Name: neurobeachin like 1
Synonyms: A530050O19Rik, ALS2CR17, A530083I02Rik, 2310076G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269198
Homologene: 16453
Taf6l
Name: TATA-box binding protein associated factor 6 like
Synonyms: PAF65A, C530024J06Rik, 2810417N14Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225895
Homologene: 4728
Ryr1
Name: ryanodine receptor 1, skeletal muscle
Synonyms: calcium release channel isoform 1, Ryr, skrr
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20190
Homologene: 68069
Adamtsl3
Name: ADAMTS-like 3
Synonyms: punctin-2, 9230119C12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269959
Homologene: 18912
Sorcs1
Name: sortilin-related VPS10 domain containing receptor 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 58178
Homologene: 10967
Ppp1r3a
Name: protein phosphatase 1, regulatory subunit 3A
Synonyms: GM, RGL
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 140491
HGNC: HGNC:9291
Homologene: 48124
Ush2a
Name: usherin
Synonyms: MUSH2A, A930011D15Rik, LOC381317, LOC269160, A930037M10Rik, Ushrn, Ush2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Col7a1
Name: collagen, type VII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12836
HGNC: HGNC:2214
Homologene: 73
Mroh2a
Name: maestro heat-like repeat family member 2A
Synonyms: ENSMUSG00000044873, OTTMUSG00000020804, Heatr7b1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100040766
Homologene: 85300
Adad1
Name: adenosine deaminase domain containing 1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 21744
Homologene: 7569
Tnxb
Name: tenascin XB
Synonyms: Tnx, TN-MHC
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 81877
Homologene: 49589
Vmn2r93
Name: vomeronasal 2, receptor 93
Synonyms: EG627132
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627132
Homologene: 129750
Myo3b
Name: myosin IIIB
Synonyms: A430065P19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329421
Homologene: 51393
Ikzf4
Name: IKAROS family zinc finger 4
Synonyms: Eos, A630026H08Rik, Zfpn1a4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22781
Homologene: 69103
Tex10
Name: testis expressed gene 10
Synonyms: clone 18330, 2810462N03Rik, 2610206N19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269536
Homologene: 32361
AI606181
Name: expressed sequence AI606181
Type: Gene
Species: Mouse
Chromosome: 19
4930568D16Rik
Name: RIKEN cDNA 4930568D16 gene
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75859
Homologene: 86865
Myrfl
Name: myelin regulatory factor-like
Synonyms: LOC237558, Gm239
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237558
VEGA: 10
Homologene: 88588
Mx2
Name: MX dynamin-like GTPase 2
Synonyms: Mx-2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17858
Slc22a19
Name: solute carrier family 22 (organic anion transporter), member 19
Synonyms: Oat5, D630043A20Rik, Slc22a9
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 207151
Homologene: 133125
Fcgbp
Name: Fc fragment of IgG binding protein
Synonyms: A430096B05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 215384
Homologene: 68369
Vmn2r28
Name: vomeronasal 2, receptor 28
Synonyms: EG665255, V2r28
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 665255
Homologene: 129605
Fpr-rs3
Name: formyl peptide receptor, related sequence 3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14290
Homologene: 130087
Xirp1
Name: xin actin-binding repeat containing 1
Synonyms: Xin, mXin alpha, Cmya1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22437
VEGA: 9
Homologene: 7998
Ifnb1
Name: interferon beta 1, fibroblast
Synonyms: interferon beta 1, fibroblast, Ifb, IFNB, IFN-beta
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15977
HGNC: HGNC:5434
Homologene: 1640
Nfxl1
Name: nuclear transcription factor, X-box binding-like 1
Synonyms: TCF9, LOC381696, D430033A06Rik, 1700012H24Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100978
Homologene: 26752
Gbp11
Name: guanylate binding protein 11
Synonyms: Gm7141
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 634650
Homologene: 128731
Wbp1
Name: WW domain binding protein 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22377
Homologene: 8267
Or5aq1b
Name: olfactory receptor family 5 subfamily AQ member 1B
Synonyms: GA_x6K02T2Q125-48565383-48564445, MOR172-2, Olfr1107
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258841
Homologene: 131138
Mrps11
Name: mitochondrial ribosomal protein S11
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67994
Homologene: 32554
Mfsd1
Name: major facilitator superfamily domain containing 1
Synonyms: 1200003O06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66868
Homologene: 11228
Vmn1r3
Name: vomeronasal 1 receptor 3
Synonyms: Gm11778
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100312471
Homologene: 128342
Hs3st1
Name: heparan sulfate (glucosamine) 3-O-sulfotransferase 1
Synonyms: 3-OST, D5Wsu110e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15476
HGNC: HGNC:5194
Homologene: 3751
Zfp24
Name: zinc finger protein 24
Synonyms: KOX17, ZF-12, 3526401F17Rik, 5033419P20Rik, Zfp191
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 59057
Homologene: 5068
Mterf4
Name: mitochondrial transcription termination factor 4
Synonyms: 1810059A23Rik, 4933412H03Rik, Mterfd2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69821
Homologene: 45600
Plscr5
Name: phospholipid scramblase family, member 5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 100504689
Homologene: 28688
Frmpd2
Name: FERM and PDZ domain containing 2
Synonyms: LOC380890, LOC268729, Frmpd2, ENSMUSG00000071536, Gm626
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 268729
Homologene: 51854
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 60,181,556 bp
  • GCCC to GC, chromosome 1 at 88,232,257 bp
  • T to C, chromosome 1 at 93,301,569 bp
  • C to T, chromosome 1 at 176,755,831 bp
  • T to G, chromosome 1 at 188,399,803 bp
  • G to A, chromosome 2 at 26,426,470 bp
  • T to G, chromosome 2 at 35,362,336 bp
  • A to G, chromosome 2 at 70,238,769 bp
  • T to A, chromosome 2 at 87,071,361 bp
  • A to G, chromosome 3 at 37,084,969 bp
  • C to A, chromosome 3 at 67,599,937 bp
  • T to A, chromosome 4 at 3,184,684 bp
  • T to C, chromosome 4 at 8,751,875 bp
  • T to C, chromosome 4 at 48,459,891 bp
  • A to G, chromosome 4 at 82,900,559 bp
  • T to A, chromosome 4 at 88,522,576 bp
  • G to A, chromosome 5 at 39,614,664 bp
  • G to C, chromosome 5 at 66,026,283 bp
  • G to T, chromosome 5 at 72,514,190 bp
  • G to T, chromosome 5 at 105,331,388 bp
  • G to A, chromosome 6 at 14,719,340 bp
  • T to C, chromosome 6 at 83,119,487 bp
  • T to A, chromosome 7 at 5,493,791 bp
  • A to G, chromosome 7 at 28,104,965 bp
  • T to C, chromosome 7 at 29,071,973 bp
  • A to G, chromosome 7 at 30,591,829 bp
  • G to A, chromosome 7 at 78,788,718 bp
  • T to A, chromosome 7 at 82,465,621 bp
  • A to T, chromosome 7 at 144,669,434 bp
  • A to G, chromosome 8 at 89,028,619 bp
  • A to G, chromosome 8 at 91,035,063 bp
  • T to A, chromosome 9 at 86,839,628 bp
  • A to G, chromosome 9 at 92,204,384 bp
  • A to G, chromosome 9 at 108,955,334 bp
  • A to G, chromosome 9 at 120,017,963 bp
  • T to C, chromosome 10 at 116,849,206 bp
  • G to A, chromosome 10 at 128,634,673 bp
  • A to G, chromosome 11 at 62,419,617 bp
  • A to T, chromosome 11 at 86,236,603 bp
  • A to T, chromosome 11 at 106,234,970 bp
  • T to C, chromosome 12 at 115,193,877 bp
  • T to A, chromosome 13 at 19,125,123 bp
  • G to A, chromosome 14 at 12,215,979 bp
  • T to C, chromosome 14 at 33,522,863 bp
  • A to C, chromosome 14 at 103,223,046 bp
  • G to T, chromosome 15 at 100,512,313 bp
  • A to G, chromosome 16 at 97,546,435 bp
  • A to G, chromosome 17 at 18,325,696 bp
  • A to G, chromosome 17 at 20,624,270 bp
  • G to A, chromosome 17 at 34,710,364 bp
  • T to A, chromosome 17 at 57,221,967 bp
  • A to G, chromosome 18 at 24,014,212 bp
  • GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC to GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC, chromosome 18 at 39,486,958 bp
  • C to T, chromosome 18 at 71,809,114 bp
  • A to G, chromosome 19 at 7,711,063 bp
  • T to C, chromosome 19 at 8,778,556 bp
  • T to C, chromosome 19 at 41,593,624 bp
  • T to C, chromosome 19 at 50,288,101 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6091 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044248-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.