Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6175Btlr/Mmmh
Stock Number:
044317-MU
Citation ID:
RRID:MMRRC_044317-MU
Other Names:
R6175 (G1)
Major Collection:

Strain Information

Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Nr2f2
Name: nuclear receptor subfamily 2, group F, member 2
Synonyms: COUP-TFII, ARP-1, Tcfcoup2, Aporp1, COUP-TF2, 9430015G03Rik, EAR3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11819
HGNC: HGNC:7976
Homologene: 7628
Htr2a
Name: 5-hydroxytryptamine (serotonin) receptor 2A
Synonyms: 5-HT2A receptor, Htr-2, Htr2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 15558
VEGA: 14
HGNC: HGNC:5293
Homologene: 68073
Lefty1
Name: left right determination factor 1
Synonyms: lefty-1, Stra3, Lefty, Ebaf
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13590
HGNC: HGNC:6552
Homologene: 49231
Wwp2
Name: WW domain containing E3 ubiquitin protein ligase 2
Synonyms: 1300010O06Rik, AIP2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66894
Homologene: 48490
Mta3
Name: metastasis associated 3
Synonyms: 1110002J22Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 116871
Homologene: 14282
Ppp1r9a
Name: protein phosphatase 1, regulatory subunit 9A
Synonyms: 4930518N04Rik, neurabin-I, A230094E16Rik, 2810430P21Rik, Neurabin I, NRB
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243725
Homologene: 14247
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 43,533,569 bp
  • G to A, chromosome 1 at 53,433,022 bp
  • GT to GTT, chromosome 1 at 88,266,524 bp
  • A to G, chromosome 1 at 93,275,474 bp
  • A to T, chromosome 1 at 127,822,832 bp
  • A to G, chromosome 1 at 128,327,714 bp
  • T to C, chromosome 1 at 180,935,149 bp
  • T to C, chromosome 1 at 185,455,311 bp
  • A to G, chromosome 2 at 36,640,051 bp
  • A to T, chromosome 2 at 36,793,968 bp
  • A to T, chromosome 2 at 85,770,308 bp
  • G to T, chromosome 2 at 130,576,243 bp
  • T to A, chromosome 2 at 131,280,261 bp
  • T to C, chromosome 2 at 158,446,155 bp
  • G to T, chromosome 2 at 165,146,630 bp
  • A to G, chromosome 3 at 87,752,133 bp
  • GAGCAGCAGCAGCAGCAGCAGC to GAGCAGCAGCAGCAGCAGC, chromosome 3 at 89,322,798 bp
  • A to T, chromosome 3 at 98,162,950 bp
  • C to T, chromosome 3 at 158,023,344 bp
  • A to G, chromosome 4 at 108,189,681 bp
  • A to G, chromosome 4 at 109,244,245 bp
  • T to C, chromosome 4 at 123,137,569 bp
  • A to G, chromosome 4 at 137,569,518 bp
  • A to T, chromosome 4 at 145,624,241 bp
  • T to C, chromosome 4 at 148,961,699 bp
  • A to G, chromosome 5 at 21,757,033 bp
  • G to A, chromosome 5 at 45,776,490 bp
  • A to G, chromosome 5 at 62,714,731 bp
  • A to G, chromosome 5 at 72,663,555 bp
  • A to T, chromosome 5 at 73,012,250 bp
  • A to T, chromosome 6 at 4,905,639 bp
  • A to G, chromosome 6 at 42,314,162 bp
  • G to T, chromosome 6 at 52,259,928 bp
  • A to G, chromosome 6 at 96,115,740 bp
  • G to A, chromosome 6 at 98,966,076 bp
  • A to T, chromosome 6 at 125,992,955 bp
  • G to A, chromosome 7 at 15,963,464 bp
  • G to A, chromosome 7 at 18,067,387 bp
  • C to A, chromosome 7 at 19,100,889 bp
  • G to A, chromosome 7 at 24,198,129 bp
  • T to C, chromosome 7 at 26,378,001 bp
  • A to T, chromosome 7 at 35,465,852 bp
  • A to G, chromosome 7 at 70,358,198 bp
  • T to A, chromosome 7 at 127,031,056 bp
  • G to T, chromosome 7 at 141,696,632 bp
  • A to T, chromosome 8 at 24,786,151 bp
  • T to A, chromosome 8 at 107,483,407 bp
  • C to A, chromosome 8 at 122,357,379 bp
  • A to G, chromosome 9 at 13,272,479 bp
  • A to G, chromosome 9 at 37,528,248 bp
  • T to A, chromosome 9 at 67,224,081 bp
  • T to C, chromosome 9 at 86,825,000 bp
  • T to A, chromosome 9 at 109,676,879 bp
  • A to T, chromosome 10 at 10,398,943 bp
  • T to C, chromosome 10 at 52,101,785 bp
  • T to A, chromosome 10 at 69,927,727 bp
  • T to C, chromosome 10 at 79,066,614 bp
  • A to G, chromosome 11 at 32,603,761 bp
  • G to A, chromosome 11 at 51,731,891 bp
  • A to G, chromosome 11 at 67,354,762 bp
  • A to T, chromosome 12 at 16,674,770 bp
  • C to A, chromosome 12 at 76,198,933 bp
  • A to G, chromosome 12 at 98,794,456 bp
  • A to T, chromosome 12 at 103,183,449 bp
  • A to G, chromosome 13 at 58,311,237 bp
  • A to T, chromosome 13 at 73,960,314 bp
  • C to T, chromosome 13 at 81,386,005 bp
  • T to A, chromosome 13 at 112,703,559 bp
  • A to G, chromosome 14 at 30,931,195 bp
  • C to A, chromosome 14 at 61,212,826 bp
  • C to G, chromosome 14 at 74,645,034 bp
  • A to G, chromosome 15 at 76,538,433 bp
  • A to G, chromosome 15 at 81,399,305 bp
  • G to T, chromosome 16 at 5,220,448 bp
  • C to A, chromosome 16 at 19,085,094 bp
  • A to G, chromosome 16 at 56,917,492 bp
  • T to A, chromosome 17 at 7,772,647 bp
  • T to C, chromosome 17 at 25,826,578 bp
  • G to A, chromosome 17 at 30,748,568 bp
  • T to A, chromosome 17 at 48,152,848 bp
  • A to G, chromosome 17 at 83,791,793 bp
  • G to T, chromosome 18 at 14,969,631 bp
  • T to A, chromosome 18 at 34,628,146 bp
  • G to A, chromosome 18 at 44,031,871 bp
  • A to T, chromosome 19 at 4,890,721 bp
  • A to T, chromosome 19 at 6,241,729 bp
  • C to A, chromosome 19 at 23,214,170 bp
  • T to C, chromosome 19 at 39,812,560 bp
  • A to G, chromosome 19 at 45,636,327 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6175 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044317-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.