Strain Name:
C57BL/6J-MtgxR6175Btlr/Mmmh
Stock Number:
044317-MU
Citation ID:
RRID:MMRRC_044317-MU
Other Names:
R6175 (G1)
Major Collection:

Strain Information

Tln2
Name: talin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Nr2f2
Name: nuclear receptor subfamily 2, group F, member 2
Synonyms: COUP-TFII, ARP-1, Tcfcoup2, Aporp1, COUP-TF2, 9430015G03Rik, EAR3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11819
HGNC: HGNC:7976
Homologene: 7628
Htr2a
Name: 5-hydroxytryptamine (serotonin) receptor 2A
Synonyms: 5-HT2A receptor, Htr-2, Htr2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 15558
VEGA: 14
HGNC: HGNC:5293
Homologene: 68073
Lefty1
Name: left right determination factor 1
Synonyms: lefty-1, Stra3, Lefty, Ebaf
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13590
Homologene: 49231
Wwp2
Name: WW domain containing E3 ubiquitin protein ligase 2
Synonyms: 1300010O06Rik, AIP2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 66894
Homologene: 48490
Mta3
Name: metastasis associated 3
Synonyms: 1110002J22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 116871
Homologene: 14282
Ppp1r9a
Name: protein phosphatase 1, regulatory subunit 9A
Synonyms: 4930518N04Rik, neurabin-I, A230094E16Rik, 2810430P21Rik, Neurabin I, NRB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243725
Homologene: 14247
Foxp1
Name: forkhead box P1
Synonyms: 4932443N09Rik, 3110052D19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 108655
HGNC: HGNC:3823
Homologene: 13092
Srsf11
Name: serine and arginine-rich splicing factor 11
Synonyms: 0610009J05Rik, 2610019N13Rik, Sfrs11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 69207
Homologene: 36164
Tex21
Name: testis expressed gene 21
Synonyms: tsec-2, 4931412D23Rik, 4931406F04Rik, 4931421K24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 80384
VEGA: 12
Homologene: 10510
Kif20a
Name: kinesin family member 20A
Synonyms: Rabkinesin-6, Rab6kifl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 19348
VEGA: 18
HGNC: HGNC:9787
Homologene: 38093
St13
Name: suppression of tumorigenicity 13
Synonyms: PRO0786, HSPABP1, SNC6, p48, Hsp70 interacting protein, 3110002K08Rik, 1110007I03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 70356
Homologene: 2921
Ralgapb
Name: Ral GTPase activating protein, beta subunit (non-catalytic)
Synonyms: B230339M05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228850
Homologene: 10666
Sec24a
Name: Sec24 related gene family, member A (S. cerevisiae)
Synonyms: 9430090N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 77371
Homologene: 70131
Arap2
Name: ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2
Synonyms: Centd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 212285
Homologene: 9064
Pex14
Name: peroxisomal biogenesis factor 14
Synonyms: Pex14p
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 56273
HGNC: HGNC:8856
Homologene: 37936
Ank3
Name: ankyrin 3, epithelial
Synonyms: Ank-3, Ankyrin-3, AnkG, 2900054D09Rik, Ankyrin-G
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 11735
HGNC: HGNC:494
Homologene: 56908
Smc5
Name: structural maintenance of chromosomes 5
Synonyms: Smc5l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 226026
VEGA: 19
Homologene: 41009
Snap91
Name: synaptosomal-associated protein 91
Synonyms: F1-20, 91kDa, AP180
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 20616
Homologene: 8429
Dnah7a
Name: dynein, axonemal, heavy chain 7A
Synonyms: LOC381341, Dnahc7, Dnahc7a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 627872
Homologene: 41287
Slc10a4
Name: solute carrier family 10 (sodium/bile acid cotransporter family), member 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231290
Homologene: 15495
Pank2
Name: pantothenate kinase 2
Synonyms: 4933409I19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 74450
Homologene: 65126
Oxt
Name: oxytocin
Synonyms: Oxy
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18429
HGNC: HGNC:8528
Homologene: 55494
Muc2
Name: mucin 2
Synonyms: 2010015E03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 17831
HGNC: HGNC:7512
Homologene: 136755
Hjurp
Name: Holliday junction recognition protein
Synonyms: C330011F01Rik, A730008H23Rik, 6430706D22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 381280
Homologene: 10184
Adam30
Name: a disintegrin and metallopeptidase domain 30
Synonyms: 4933424D07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 71078
HGNC: HGNC:208
Homologene: 11038
AU021092
Name: expressed sequence AU021092
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 239691
Homologene: 17587
Esam
Name: endothelial cell-specific adhesion molecule
Synonyms: W117m, 2310008D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 69524
Homologene: 12316
Hspg2
Name: perlecan (heparan sulfate proteoglycan 2)
Synonyms: per, Pcn, Plc, perlecan
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 15530
HGNC: HGNC:5273
Homologene: 68473
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Kif22
Name: kinesin family member 22
Synonyms: Kif22a, Kid
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 110033
HGNC: HGNC:6391
Homologene: 32011
Fbxw4
Name: F-box and WD-40 domain protein 4
Synonyms: dactylin, Fbw4, dactylyn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 30838
Homologene: 32197
Ppie
Name: peptidylprolyl isomerase E (cyclophilin E)
Synonyms: 2010010D16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 56031
HGNC: HGNC:9258
Homologene: 38142
Slc38a9
Name: solute carrier family 38, member 9
Synonyms: 9430067K09Rik, 6720411P22Rik, 9130023D20Rik, 4833412L08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 268706
VEGA: 13
Homologene: 18139
2610008E11Rik
Name: RIKEN cDNA 2610008E11 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 72128
Homologene: 86705
Brd9
Name: bromodomain containing 9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 105246
VEGA: 13
Homologene: 82462
Eml5
Name: echinoderm microtubule associated protein like 5
Synonyms: C130068M19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 319670
VEGA: 12
Homologene: 26807
Lcorl
Name: ligand dependent nuclear receptor corepressor-like
Synonyms: Mlr1, A830039H10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 209707
Homologene: 82325
Zfp268
Name: zinc finger protein 268
Synonyms: Gm13212
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 433801
Homologene: 133076
Lct
Name: lactase
Synonyms: LOC226413, Lphl, LPH
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226413
HGNC: HGNC:6530
Homologene: 124204
Hoxa13
Name: homeobox A13
Synonyms: Hox-1.10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 15398
HGNC: HGNC:5102
Homologene: 73882
Pmpcb
Name: peptidase (mitochondrial processing) beta
Synonyms: MPPP52, MPP11, 3110004O18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 73078
HGNC: HGNC:9119
Homologene: 3160
Clcn1
Name: chloride channel, voltage-sensitive 1
Synonyms: SMCC1, Clc-1, Clc1, NMF355, nmf355
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 12723
HGNC: HGNC:2019
Homologene: 63
Bbs1
Name: Bardet-Biedl syndrome 1 (human)
Synonyms: D19Ertd609e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 52028
VEGA: 19
HGNC: HGNC:966
Homologene: 11641
Kif27
Name: kinesin family member 27
Synonyms: 4930517I18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 75050
VEGA: 13
Homologene: 69235
Myh13
Name: myosin, heavy polypeptide 13, skeletal muscle
Synonyms: extraocular myosin, EO Myosin, MyHC-eo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 544791
HGNC: HGNC:7571
Homologene: 55780
Stk10
Name: serine/threonine kinase 10
Synonyms: Lok, Gek1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20868
Homologene: 38122
Fbxw18
Name: F-box and WD-40 domain protein 18
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 546161
Homologene: 110776
Wdr24
Name: WD repeat domain 24
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 268933
Homologene: 6870
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 110789
Homologene: 19815
Nlrp9c
Name: NLR family, pyrin domain containing 9C
Synonyms: Nalp-zeta, Nalp9c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 330490
Homologene: 116072
Ceacam12
Name: CEA cell adhesion molecule 12
Synonyms: Ceacam12-C3, Ceacam12-C1, 1600031J20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 67315
Homologene: 137375
Pear1
Name: platelet endothelial aggregation receptor 1
Synonyms: 3110045G13Rik, Jedi-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 73182
Homologene: 12492
Unc79
Name: unc-79 homolog
Synonyms: 9030205A07Rik, Mlca3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217843
Homologene: 41397
Ros1
Name: Ros1 proto-oncogene
Synonyms: Ros-1, c-ros
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 19886
Homologene: 2207
Spink14
Name: serine peptidase inhibitor, Kazal type 14
Synonyms: Gm5505
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 433178
Homologene: 37400
Adgb
Name: androglobin
Synonyms: 9130014G24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 215772
Homologene: 100289
Adam5
Name: a disintegrin and metallopeptidase domain 5
Synonyms: tMDCII
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 11499
HGNC: HGNC:212
Homologene: 49138
Greb1
Name: gene regulated by estrogen in breast cancer protein
Synonyms: 5730583K22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 268527
Homologene: 8780
Zyg11a
Name: zyg-11 family member A, cell cycle regulator
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230590
Homologene: 66294
Sacs
Name: sacsin
Synonyms: E130115J16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 50720
Or1j21
Name: olfactory receptor family 1 subfamily J member 21
Synonyms: ID3, MOR136-6, GA_x6K02T2NLDC-33487752-33488690, Olfr50
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18350
Homologene: 74212
Itih1
Name: inter-alpha trypsin inhibitor, heavy chain 1
Synonyms: inter-alpha (globulin) inhibitor, H1 polypeptide, Intin1, Itih-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 16424
HGNC: HGNC:6166
Homologene: 1667
Atg2a
Name: autophagy related 2A
Synonyms: 1810013C15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 329015
Homologene: 86985
Slc30a10
Name: solute carrier family 30, member 10
Synonyms: E130106K10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226781
VEGA: 1
Homologene: 100946
Map3k19
Name: mitogen-activated protein kinase kinase kinase 19
Synonyms: Ysk4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 22625
Homologene: 19318
Kctd1
Name: potassium channel tetramerisation domain containing 1
Synonyms: 4933402K10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 106931
VEGA: 18
Homologene: 65999
Meiosin
Name: meiosis initiator
Synonyms: Bhmg1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 243866
Homologene: 131804
A530064D06Rik
Name: RIKEN cDNA A530064D06 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 328830
VEGA: 17
Homologene: 136361
Fbxl6
Name: F-box and leucine-rich repeat protein 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 30840
VEGA: 15
Homologene: 8130
Sned1
Name: sushi, nidogen and EGF-like domains 1
Synonyms: Snep, 6720455I24Rik, D430044C15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 208777
Homologene: 14708
Ano2
Name: anoctamin 2
Synonyms: Tmem16b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243634
HGNC: HGNC:1183
Homologene: 23221
Cyp2c40
Name: cytochrome P450, family 2, subfamily c, polypeptide 40
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 13099
Homologene: 74936
Fndc1
Name: fibronectin type III domain containing 1
Synonyms: 1110027O12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 68655
Nck2
Name: non-catalytic region of tyrosine kinase adaptor protein 2
Synonyms: NCKbeta, Grb4, 4833426I10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 17974
HGNC: HGNC:7665
Homologene: 20794
Ehd2
Name: EH-domain containing 2
Synonyms: C130052H20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259300
HGNC: HGNC:3243
Homologene: 22825
Zfp111
Name: zinc finger protein 111
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 56707
Homologene: 128597
Or9g19
Name: olfactory receptor family 9 subfamily G member 19
Synonyms: GA_x6K02T2Q125-47248551-47249468, MOR213-2, Olfr1013
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258757
Homologene: 74096
Calr4
Name: calreticulin 4
Synonyms: 4933403L16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 108802
Homologene: 86813
Trhr2
Name: thyrotropin releasing hormone receptor 2
Synonyms: TRH-R2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 170732
Homologene: 44052
Cdh22
Name: cadherin 22
Synonyms: PB-cadherin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 104010
Homologene: 23148
Efna3
Name: ephrin A3
Synonyms: Epl3, LERK-3, EFL-2, Ehk1-L
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 13638
HGNC: HGNC:3223
Homologene: 3635
Nipal1
Name: NIPA-like domain containing 1
Synonyms: 3830408G10Rik, Npal1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 70701
Homologene: 28165
Or1j16
Name: olfactory receptor family 1 subfamily J member 16
Synonyms: GA_x6K02T2NLDC-33334179-33335114, MOR136-7, Olfr345
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258947
Homologene: 45069
Slc7a9
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 9
Synonyms: CSNU3, bo, +AT, bo, + amino acid transporter
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 30962
Homologene: 56668
Ccdc82
Name: coiled-coil domain containing 82
Synonyms: 2310043N13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 66396
VEGA: 9
Homologene: 11678
Tafa1
Name: TAFA chemokine like family member 1
Synonyms: Tafa-1, C630007B19Rik, Fam19a1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 320265
Homologene: 45655
Iglv1
Name: immunoglobulin lambda variable 1
Synonyms: 1810027O01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 16142
Lnp1
Name: leukemia NUP98 fusion partner 1
Synonyms: Gm19797
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 100503609
Homologene: 67109
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 43,533,569 bp
  • G to A, chromosome 1 at 53,433,022 bp
  • GT to GTT, chromosome 1 at 88,266,524 bp
  • A to G, chromosome 1 at 93,275,474 bp
  • A to T, chromosome 1 at 127,822,832 bp
  • A to G, chromosome 1 at 128,327,714 bp
  • T to C, chromosome 1 at 180,935,149 bp
  • T to C, chromosome 1 at 185,455,311 bp
  • A to G, chromosome 2 at 36,640,051 bp
  • A to T, chromosome 2 at 36,793,968 bp
  • A to T, chromosome 2 at 85,770,308 bp
  • G to T, chromosome 2 at 130,576,243 bp
  • T to A, chromosome 2 at 131,280,261 bp
  • T to C, chromosome 2 at 158,446,155 bp
  • G to T, chromosome 2 at 165,146,630 bp
  • A to G, chromosome 3 at 87,752,133 bp
  • GAGCAGCAGCAGCAGCAGCAGC to GAGCAGCAGCAGCAGCAGC, chromosome 3 at 89,322,798 bp
  • A to T, chromosome 3 at 98,162,950 bp
  • C to T, chromosome 3 at 158,023,344 bp
  • A to G, chromosome 4 at 108,189,681 bp
  • A to G, chromosome 4 at 109,244,245 bp
  • T to C, chromosome 4 at 123,137,569 bp
  • A to G, chromosome 4 at 137,569,518 bp
  • A to T, chromosome 4 at 145,624,241 bp
  • T to C, chromosome 4 at 148,961,699 bp
  • A to G, chromosome 5 at 21,757,033 bp
  • G to A, chromosome 5 at 45,776,490 bp
  • A to G, chromosome 5 at 62,714,731 bp
  • A to G, chromosome 5 at 72,663,555 bp
  • A to T, chromosome 5 at 73,012,250 bp
  • A to T, chromosome 6 at 4,905,639 bp
  • A to G, chromosome 6 at 42,314,162 bp
  • G to T, chromosome 6 at 52,259,928 bp
  • A to G, chromosome 6 at 96,115,740 bp
  • G to A, chromosome 6 at 98,966,076 bp
  • A to T, chromosome 6 at 125,992,955 bp
  • G to A, chromosome 7 at 15,963,464 bp
  • G to A, chromosome 7 at 18,067,387 bp
  • C to A, chromosome 7 at 19,100,889 bp
  • G to A, chromosome 7 at 24,198,129 bp
  • T to C, chromosome 7 at 26,378,001 bp
  • A to T, chromosome 7 at 35,465,852 bp
  • A to G, chromosome 7 at 70,358,198 bp
  • T to A, chromosome 7 at 127,031,056 bp
  • G to T, chromosome 7 at 141,696,632 bp
  • A to T, chromosome 8 at 24,786,151 bp
  • T to A, chromosome 8 at 107,483,407 bp
  • C to A, chromosome 8 at 122,357,379 bp
  • A to G, chromosome 9 at 13,272,479 bp
  • A to G, chromosome 9 at 37,528,248 bp
  • T to A, chromosome 9 at 67,224,081 bp
  • T to C, chromosome 9 at 86,825,000 bp
  • T to A, chromosome 9 at 109,676,879 bp
  • A to T, chromosome 10 at 10,398,943 bp
  • T to C, chromosome 10 at 52,101,785 bp
  • T to A, chromosome 10 at 69,927,727 bp
  • T to C, chromosome 10 at 79,066,614 bp
  • A to G, chromosome 11 at 32,603,761 bp
  • G to A, chromosome 11 at 51,731,891 bp
  • A to G, chromosome 11 at 67,354,762 bp
  • A to T, chromosome 12 at 16,674,770 bp
  • C to A, chromosome 12 at 76,198,933 bp
  • A to G, chromosome 12 at 98,794,456 bp
  • A to T, chromosome 12 at 103,183,449 bp
  • A to G, chromosome 13 at 58,311,237 bp
  • A to T, chromosome 13 at 73,960,314 bp
  • C to T, chromosome 13 at 81,386,005 bp
  • T to A, chromosome 13 at 112,703,559 bp
  • A to G, chromosome 14 at 30,931,195 bp
  • C to A, chromosome 14 at 61,212,826 bp
  • C to G, chromosome 14 at 74,645,034 bp
  • A to G, chromosome 15 at 76,538,433 bp
  • A to G, chromosome 15 at 81,399,305 bp
  • G to T, chromosome 16 at 5,220,448 bp
  • C to A, chromosome 16 at 19,085,094 bp
  • A to G, chromosome 16 at 56,917,492 bp
  • T to A, chromosome 17 at 7,772,647 bp
  • T to C, chromosome 17 at 25,826,578 bp
  • G to A, chromosome 17 at 30,748,568 bp
  • T to A, chromosome 17 at 48,152,848 bp
  • A to G, chromosome 17 at 83,791,793 bp
  • G to T, chromosome 18 at 14,969,631 bp
  • T to A, chromosome 18 at 34,628,146 bp
  • G to A, chromosome 18 at 44,031,871 bp
  • A to T, chromosome 19 at 4,890,721 bp
  • A to T, chromosome 19 at 6,241,729 bp
  • C to A, chromosome 19 at 23,214,170 bp
  • T to C, chromosome 19 at 39,812,560 bp
  • A to G, chromosome 19 at 45,636,327 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6175 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044317-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.