Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6176Btlr/Mmmh
Stock Number:
044318-MU
Citation ID:
RRID:MMRRC_044318-MU
Other Names:
R6176 (G1)
Major Collection:

Strain Information

Atrn
Name: attractin
Synonyms: Mgca
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11990
HGNC: HGNC:885
Homologene: 22542
Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Slit1
Name: slit guidance ligand 1
Synonyms: Slil1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20562
Homologene: 2302
Suclg1
Name: succinate-CoA ligase, GDP-forming, alpha subunit
Synonyms: Sucla1, 1500000I01Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56451
Homologene: 55785
Ankfy1
Name: ankyrin repeat and FYVE domain containing 1
Synonyms: Ankhzn
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11736
Homologene: 9491
Nusap1
Name: nucleolar and spindle associated protein 1
Synonyms: NuSAP, 2610201A12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 108907
Homologene: 10207
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 139,550,916 bp
  • G to A, chromosome 2 at 87,896,936 bp
  • A to G, chromosome 2 at 119,630,421 bp
  • A to G, chromosome 2 at 130,946,091 bp
  • A to G, chromosome 3 at 67,384,594 bp
  • G to A, chromosome 3 at 122,934,003 bp
  • T to A, chromosome 3 at 126,945,471 bp
  • C to T, chromosome 4 at 44,053,019 bp
  • T to C, chromosome 4 at 63,377,732 bp
  • T to A, chromosome 4 at 96,140,837 bp
  • A to G, chromosome 4 at 98,765,554 bp
  • T to A, chromosome 4 at 118,962,000 bp
  • A to G, chromosome 4 at 129,693,101 bp
  • T to C, chromosome 4 at 138,395,211 bp
  • T to G, chromosome 4 at 139,668,888 bp
  • T to A, chromosome 4 at 145,624,058 bp
  • T to A, chromosome 5 at 21,500,500 bp
  • A to T, chromosome 5 at 43,709,113 bp
  • A to T, chromosome 5 at 76,624,643 bp
  • T to C, chromosome 5 at 109,086,000 bp
  • G to A, chromosome 5 at 111,223,985 bp
  • T to A, chromosome 5 at 130,018,879 bp
  • A to G, chromosome 6 at 17,286,919 bp
  • T to C, chromosome 6 at 73,275,343 bp
  • C to T, chromosome 6 at 91,779,851 bp
  • A to G, chromosome 6 at 120,224,164 bp
  • T to A, chromosome 6 at 124,625,809 bp
  • T to A, chromosome 6 at 141,498,889 bp
  • A to G, chromosome 7 at 12,615,981 bp
  • C to A, chromosome 7 at 24,626,702 bp
  • T to G, chromosome 7 at 45,326,676 bp
  • A to T, chromosome 7 at 139,120,775 bp
  • T to A, chromosome 8 at 124,878,854 bp
  • A to C, chromosome 9 at 38,877,377 bp
  • C to T, chromosome 9 at 69,417,072 bp
  • G to T, chromosome 9 at 95,560,775 bp
  • G to A, chromosome 9 at 106,912,948 bp
  • A to T, chromosome 9 at 108,828,355 bp
  • A to T, chromosome 10 at 81,587,334 bp
  • A to G, chromosome 10 at 91,059,571 bp
  • G to A, chromosome 11 at 72,754,459 bp
  • AGCGGTCGTAGGC to AGC, chromosome 11 at 73,395,654 bp
  • T to C, chromosome 11 at 100,440,148 bp
  • G to A, chromosome 11 at 102,487,524 bp
  • A to T, chromosome 11 at 104,792,557 bp
  • A to G, chromosome 12 at 111,274,156 bp
  • T to A, chromosome 13 at 23,076,358 bp
  • C to A, chromosome 14 at 35,562,547 bp
  • A to G, chromosome 14 at 50,414,390 bp
  • T to C, chromosome 14 at 118,235,628 bp
  • T to C, chromosome 15 at 57,952,796 bp
  • G to T, chromosome 15 at 74,706,340 bp
  • A to G, chromosome 15 at 83,573,806 bp
  • A to G, chromosome 15 at 98,708,552 bp
  • C to T, chromosome 16 at 35,704,797 bp
  • A to G, chromosome 16 at 57,171,789 bp
  • T to A, chromosome 16 at 89,015,400 bp
  • A to G, chromosome 17 at 65,485,872 bp
  • T to A, chromosome 17 at 71,806,633 bp
  • CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT to CCTGCTGCTGCTGCTGCTGCTGCTGCTGCT, chromosome 18 at 35,716,760 bp
  • A to T, chromosome 18 at 36,998,931 bp
  • A to G, chromosome 18 at 37,664,229 bp
  • A to C, chromosome 19 at 8,621,797 bp
  • T to A, chromosome 19 at 10,671,785 bp
  • T to C, chromosome 19 at 41,637,595 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6176 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044318-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.