Strain Name:
C57BL/6J-MtgxR6176Btlr/Mmmh
Stock Number:
044318-MU
Citation ID:
RRID:MMRRC_044318-MU
Other Names:
R6176 (G1)
Major Collection:

Strain Information

Atrn
Name: attractin
Synonyms: Mgca
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 11990
HGNC: HGNC:885
Homologene: 22542
Ank2
Name: ankyrin 2, brain
Synonyms: Ankyrin-B, ankyrin B, Ank-2, Ankyrin-2, Gm4392
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Slit1
Name: slit guidance ligand 1
Synonyms: Slil1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 20562
Homologene: 2302
Suclg1
Name: succinate-CoA ligase, GDP-forming, alpha subunit
Synonyms: Sucla1, 1500000I01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 56451
Homologene: 55785
Jrk
Name: jerky
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 16469
HGNC: HGNC:6199
Homologene: 2762
Ankfy1
Name: ankyrin repeat and FYVE domain containing 1
Synonyms: Ankhzn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 11736
Homologene: 9491
Nusap1
Name: nucleolar and spindle associated protein 1
Synonyms: NuSAP, 2610201A12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 108907
Homologene: 10207
Gnpat
Name: glyceronephosphate O-acyltransferase
Synonyms: D1Ertd819e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 14712
HGNC: HGNC:4416
Homologene: 40716
Tbc1d23
Name: TBC1 domain family, member 23
Synonyms: D030022P07Rik, 4930451A13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 67581
VEGA: 16
Homologene: 10126
Apaf1
Name: apoptotic peptidase activating factor 1
Synonyms: Apaf1l, 6230400I06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 11783
HGNC: HGNC:576
Homologene: 7626
Usp53
Name: ubiquitin specific peptidase 53
Synonyms: Phxr3, mbo, Sp6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 99526
Homologene: 34521
Cc2d2a
Name: coiled-coil and C2 domain containing 2A
Synonyms: b2b1035Clo, 5730509K17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231214
Homologene: 18159
Cep135
Name: centrosomal protein 135
Synonyms: Cep4, LOC381644
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 381644
Homologene: 45709
Ice2
Name: interactor of little elongation complex ELL subunit 2
Synonyms: B230343B06Rik, Narg2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 93697
Homologene: 11618
Slc49a4
Name: solute carrier family 49 member 4
Synonyms: Dirc2, RCC4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 224132
Homologene: 13137
Trpm4
Name: transient receptor potential cation channel, subfamily M, member 4
Synonyms: LTRPC4, 1110030C19Rik, TRPM4B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 68667
Homologene: 23033
Kank4
Name: KN motif and ankyrin repeat domains 4
Synonyms: Ankrd38
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242553
Homologene: 18244
Zfp268
Name: zinc finger protein 268
Synonyms: Gm13212
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 433801
Homologene: 133076
Gpatch8
Name: G patch domain containing 8
Synonyms: Gpatc8, ENSMUSG00000075516, 5430405G24Rik, Fbm1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237943
Homologene: 46117
Gm11639
Name: predicted gene 11639
Synonyms: Efcab15, Gm11639
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 105242472
Dock3
Name: dedicator of cyto-kinesis 3
Synonyms: Moca, PBP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 208869
HGNC: HGNC:2989
Homologene: 21030
Sox21
Name: SRY (sex determining region Y)-box 21
Synonyms: Sox25
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 223227
Homologene: 5143
Akna
Name: AT-hook transcription factor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 100182
Homologene: 49947
Fbxl13
Name: F-box and leucine-rich repeat protein 13
Synonyms: 4921539K22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 320118
Homologene: 27057
Phldb3
Name: pleckstrin homology like domain, family B, member 3
Synonyms: Gm10102, EG232970
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 232970
Homologene: 109375
Gne
Name: glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
Synonyms: 2310066H07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 50798
Homologene: 3996
Celsr3
Name: cadherin, EGF LAG seven-pass G-type receptor 3
Synonyms: flamingo, Adgrc3, Fmi1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 107934
HGNC: HGNC:3230
Homologene: 1077
Or5w20
Name: olfactory receptor family 5 subfamily W member 20
Synonyms: Olfr1153, MOR177-7, GA_x6K02T2Q125-49395950-49396882
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258633
Homologene: 27230
B4galnt3
Name: beta-1,4-N-acetyl-galactosaminyl transferase 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 330406
Homologene: 18328
Lao1
Name: L-amino acid oxidase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 100470
Homologene: 44223
Ttc28
Name: tetratricopeptide repeat domain 28
Synonyms: TPRBK, 2310015L07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 209683
Homologene: 41023
Vmn1r215
Name: vomeronasal 1 receptor 215
Synonyms: V1ri2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 171253
Homologene: 110880
Vmn2r54
Name: vomeronasal 2, receptor 54
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 666085
Homologene: 104040
Pga5
Name: pepsinogen 5, group I
Synonyms: pepsinogen A5, Pepf, 1110035E17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 58803
VEGA: 19
Homologene: 105932
Tbc1d31
Name: TBC1 domain family, member 31
Synonyms: D330013L20Rik, LOC210544, Wdr67
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 210544
Homologene: 17089
Cyp2j12
Name: cytochrome P450, family 2, subfamily j, polypeptide 12
Synonyms: Cyp2j12-ps, OTTMUSG00000007939
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242546
HGNC: HGNC:2634
Homologene: 133195
Grip2
Name: glutamate receptor interacting protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243547
Homologene: 16327
Amn
Name: amnionless
Synonyms: 5033428N14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 93835
VEGA: 12
Homologene: 12804
Or8d2b
Name: olfactory receptor family 8 subfamily D member 2D
Synonyms: GA_x6K02T2PVTD-32573036-32573962, MOR171-8, Olfr926
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258811
VEGA: 9
HGNC: HGNC:8482
Homologene: 128215
Tmem232
Name: transmembrane protein 232
Synonyms: LOC381107, E130009J12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 381107
VEGA: 17
Homologene: 54378
Tle2
Name: transducin-like enhancer of split 2
Synonyms: Grg2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 21886
Homologene: 20693
Tas1r2
Name: taste receptor, type 1, member 2
Synonyms: TR2, Gpr71, T1r2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 83770
Homologene: 75323
Vmn2r12
Name: vomeronasal 2, receptor 12
Synonyms: Gm6769
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 627569
Homologene: 129606
Pde3a
Name: phosphodiesterase 3A, cGMP inhibited
Synonyms: A930022O17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 54611
HGNC: HGNC:8778
Homologene: 708
Ccdc65
Name: coiled-coil domain containing 65
Synonyms: 4933417K04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 105833
VEGA: 15
Homologene: 13226
Tmem39b
Name: transmembrane protein 39b
Synonyms: 6330509E05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230770
Homologene: 23069
Nt5c3b
Name: 5'-nucleotidase, cytosolic IIIB
Synonyms: C330027I04Rik, 2610037D24Rik, Nt5c3l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 68106
Homologene: 41684
Clip4
Name: CAP-GLY domain containing linker protein family, member 4
Synonyms: 5830409B12Rik, 1700024K14Rik, 4833417L20Rik, Rsnl2, 1700074B05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 78785
VEGA: 17
Homologene: 11662
Stk32c
Name: serine/threonine kinase 32C
Synonyms: Pkek, YANK3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 57740
Homologene: 75157
Grid1
Name: glutamate receptor, ionotropic, delta 1
Synonyms: GluRdelta1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 14803
HGNC: HGNC:4575
Homologene: 69017
Ecscr
Name: endothelial cell surface expressed chemotaxis and apoptosis regulator
Synonyms: 1110006O17Rik, ARIA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 68545
Homologene: 86811
C1s2
Name: complement component 1, s subcomponent 2
Synonyms: Gm5077
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 317677
HGNC: HGNC:1247
Homologene: 1314
Or11g1
Name: olfactory receptor family 11 subfamily G member 1
Synonyms: Olfr738, MOR106-3, GA_x6K02T2PMLR-6110726-6111661
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 258662
Homologene: 74220
Cfhr1
Name: complement factor H-related 1
Synonyms: Cfhl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 50702
Homologene: 55632
Paqr9
Name: progestin and adipoQ receptor family member IX
Synonyms: C730029A08Rik, 1700020G04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 75552
Homologene: 18882
Or1e16
Name: olfactory receptor family 1 subfamily E member 16
Synonyms: Olfr1, MOR135-13, GA_x6K02T2P1NL-3556334-3555390, I54
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 258923
Homologene: 115482
Slc22a6
Name: solute carrier family 22 (organic anion transporter), member 6
Synonyms: Orctl1, Oat1, NKT, mOat1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 18399
VEGA: 19
Homologene: 16813
Gm10229
Name: predicted gene 10229
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 100040201
VEGA: 16
Cav2
Name: caveolin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 12390
HGNC: HGNC:1528
Homologene: 942
Pcdha9
Name: protocadherin alpha 9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 192161
Homologene: 130700
Mlf1
Name: myeloid leukemia factor 1
Synonyms: HLS7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 17349
HGNC: HGNC:7125
Homologene: 7839
Fam43b
Name: family with sequence similarity 43, member B
Synonyms: OTTMUSG00000009974
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 625638
Homologene: 45810
Asl
Name: argininosuccinate lyase
Synonyms: 2510006M18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 109900
HGNC: HGNC:746
Homologene: 32
Pcdhga1
Name: protocadherin gamma subfamily A, 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93709
Homologene: 56824
Tspo
Name: translocator protein
Synonyms: Bzrp, Tspo1, PBR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 12257
HGNC: HGNC:1158
Homologene: 574
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 139,550,916 bp
  • G to A, chromosome 2 at 87,896,936 bp
  • A to G, chromosome 2 at 119,630,421 bp
  • A to G, chromosome 2 at 130,946,091 bp
  • A to G, chromosome 3 at 67,384,594 bp
  • G to A, chromosome 3 at 122,934,003 bp
  • T to A, chromosome 3 at 126,945,471 bp
  • C to T, chromosome 4 at 44,053,019 bp
  • T to C, chromosome 4 at 63,377,732 bp
  • T to A, chromosome 4 at 96,140,837 bp
  • A to G, chromosome 4 at 98,765,554 bp
  • T to A, chromosome 4 at 118,962,000 bp
  • A to G, chromosome 4 at 129,693,101 bp
  • T to C, chromosome 4 at 138,395,211 bp
  • T to G, chromosome 4 at 139,668,888 bp
  • T to A, chromosome 4 at 145,624,058 bp
  • T to A, chromosome 5 at 21,500,500 bp
  • A to T, chromosome 5 at 43,709,113 bp
  • A to T, chromosome 5 at 76,624,643 bp
  • T to C, chromosome 5 at 109,086,000 bp
  • G to A, chromosome 5 at 111,223,985 bp
  • T to A, chromosome 5 at 130,018,879 bp
  • A to G, chromosome 6 at 17,286,919 bp
  • T to C, chromosome 6 at 73,275,343 bp
  • C to T, chromosome 6 at 91,779,851 bp
  • A to G, chromosome 6 at 120,224,164 bp
  • T to A, chromosome 6 at 124,625,809 bp
  • T to A, chromosome 6 at 141,498,889 bp
  • A to G, chromosome 7 at 12,615,981 bp
  • C to A, chromosome 7 at 24,626,702 bp
  • T to G, chromosome 7 at 45,326,676 bp
  • A to T, chromosome 7 at 139,120,775 bp
  • T to A, chromosome 8 at 124,878,854 bp
  • A to C, chromosome 9 at 38,877,377 bp
  • C to T, chromosome 9 at 69,417,072 bp
  • G to T, chromosome 9 at 95,560,775 bp
  • G to A, chromosome 9 at 106,912,948 bp
  • A to T, chromosome 9 at 108,828,355 bp
  • A to T, chromosome 10 at 81,587,334 bp
  • A to G, chromosome 10 at 91,059,571 bp
  • G to A, chromosome 11 at 72,754,459 bp
  • AGCGGTCGTAGGC to AGC, chromosome 11 at 73,395,654 bp
  • T to C, chromosome 11 at 100,440,148 bp
  • G to A, chromosome 11 at 102,487,524 bp
  • A to T, chromosome 11 at 104,792,557 bp
  • A to G, chromosome 12 at 111,274,156 bp
  • T to A, chromosome 13 at 23,076,358 bp
  • C to A, chromosome 14 at 35,562,547 bp
  • A to G, chromosome 14 at 50,414,390 bp
  • T to C, chromosome 14 at 118,235,628 bp
  • T to C, chromosome 15 at 57,952,796 bp
  • G to T, chromosome 15 at 74,706,340 bp
  • A to G, chromosome 15 at 83,573,806 bp
  • A to G, chromosome 15 at 98,708,552 bp
  • C to T, chromosome 16 at 35,704,797 bp
  • A to G, chromosome 16 at 57,171,789 bp
  • T to A, chromosome 16 at 89,015,400 bp
  • A to G, chromosome 17 at 65,485,872 bp
  • T to A, chromosome 17 at 71,806,633 bp
  • CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT to CCTGCTGCTGCTGCTGCTGCTGCTGCTGCT, chromosome 18 at 35,716,760 bp
  • A to T, chromosome 18 at 36,998,931 bp
  • A to G, chromosome 18 at 37,664,229 bp
  • A to C, chromosome 19 at 8,621,797 bp
  • T to A, chromosome 19 at 10,671,785 bp
  • T to C, chromosome 19 at 41,637,595 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6176 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044318-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.