Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6182Btlr/Mmmh
Stock Number:
044324-MU
Citation ID:
RRID:MMRRC_044324-MU
Other Names:
R6182 (G1)
Major Collection:

Strain Information

Gsc2
Name: goosecoid homebox 2
Synonyms: 4930568H22Rik, Gscl
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 195333
HGNC: HGNC:4613
Homologene: 3884
Frem2
Name: Fras1 related extracellular matrix protein 2
Synonyms: 8430406N05Rik, 6030440P17Rik, my, ne, b2b1562Clo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242022
Homologene: 18454
Epb41l2
Name: erythrocyte membrane protein band 4.1 like 2
Synonyms: NBL2, 4.1G, D10Ertd398e, Epb4.1l2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13822
VEGA: 10
HGNC: HGNC:3379
Homologene: 37478
Mtmr14
Name: myotubularin related protein 14
Synonyms: 1110061O04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 97287
Homologene: 11203
Fus
Name: fused in sarcoma
Synonyms: translocated in liposarcoma, Tls, hnRNP P2, pigpen, D930039C12Rik, D430004D17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233908
HGNC: HGNC:4010
Homologene: 134091
Wdr48
Name: WD repeat domain 48
Synonyms: 8430408H12Rik, Uaf1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67561
VEGA: 9
Homologene: 10830
Snrnp70
Name: small nuclear ribonucleoprotein 70 (U1)
Synonyms: Rnulp70, U1-70, 3200002N22Rik, 2700022N21Rik, Srnp70, Snrp70
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20637
Homologene: 20672
Daam1
Name: dishevelled associated activator of morphogenesis 1
Synonyms: 1700066F09Rik, 2310028E21Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 208846
VEGA: 12
Homologene: 36635
Akap13
Name: A kinase anchor protein 13
Synonyms: AKAP-Lbc, PROTO-LBC, PROTO-LB, Ht31, 5730522G15Rik, 1700026G02Rik, 5830460E08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Mon2
Name: MON2 homolog, regulator of endosome to Golgi trafficking
Synonyms: SF21, 2610528O22Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67074
VEGA: 10
Homologene: 44309
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Pals2
Name: protein associated with LIN7 2, MAGUK family member
Synonyms: P55t, Pals2, Mpp6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56524
Homologene: 22976
Unc5b
Name: unc-5 netrin receptor B
Synonyms: 6330415E02Rik, Unc5h2, D10Bwg0792e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 107449
VEGA: 10
Homologene: 32538
Xpot
Name: exportin, tRNA (nuclear export receptor for tRNAs)
Synonyms: EXPORTIN-T, C79645, 1110004L07Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73192
VEGA: 10
Homologene: 38291
Serpina3c
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3C
Synonyms: Kalbp, 1A1, Klkbp, alpha-1 antiproteinase
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16625
HGNC: HGNC:16
Homologene: 111129
Tnc
Name: tenascin C
Synonyms: Hxb, TN-C, TN, C130033P17Rik, tenascin-C, cytotactin, hexabrachion
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21923
HGNC: HGNC:5318
Homologene: 55636
Ctsl
Name: cathepsin L
Synonyms: major excreted protein, MEP, Cat L, 1190035F06Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13039
VEGA: 13
Homologene: 76699
Spin1
Name: spindlin 1
Synonyms: Spin
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20729
VEGA: 13
Homologene: 55983
Erc2
Name: ELKS/RAB6-interacting/CAST family member 2
Synonyms: D14Ertd171e, ELKS2alpha, CAST
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 238988
Homologene: 69188
Slc12a4
Name: solute carrier family 12, member 4
Synonyms: KCC1, K-Cl Co-transporter-1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20498
Homologene: 21056
Hectd3
Name: HECT domain E3 ubiquitin protein ligase 3
Synonyms: 1700064K09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76608
Homologene: 18426
Slc39a6
Name: solute carrier family 39 (metal ion transporter), member 6
Synonyms: Ermelin, Zip6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 106957
Homologene: 8199
Dgcr8
Name: DGCR8, microprocessor complex subunit
Synonyms: N41, D16Wis2, D16H22S788E, Gy1, D16H22S1742E, Vo59c07, DiGeorge syndrome critical region gene 8
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 94223
HGNC: HGNC:2847
Homologene: 11223
Zfc3h1
Name: zinc finger, C3H1-type containing
Synonyms: Psrc2, Ccdc131
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216345
Homologene: 17017
Pkd1l1
Name: polycystic kidney disease 1 like 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171395
Homologene: 51376
Clec4f
Name: C-type lectin domain family 4, member f
Synonyms: kupffer cell receptor, D18063, Clecsf13
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 51811
Homologene: 9630
Dock2
Name: dedicator of cyto-kinesis 2
Synonyms: MBC, CED-5, Hch
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 94176
HGNC: HGNC:2988
Homologene: 37984
Tgm3
Name: transglutaminase 3, E polypeptide
Synonyms: TG E, we
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21818
Homologene: 20690
Chsy3
Name: chondroitin sulfate synthase 3
Synonyms: 4833446K15Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 78923
VEGA: 18
Homologene: 28624
Katnal1
Name: katanin p60 subunit A-like 1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231912
Homologene: 12942
Cntnap5c
Name: contactin associated protein-like 5C
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 620292
VEGA: 17
Homologene: 128806
Sis
Name: sucrase isomaltase
Synonyms: Si-s, sucrase-isomaltase, 2010204N08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69983
Homologene: 37424
Ces1f
Name: carboxylesterase 1F
Synonyms: TGH-2, CesML1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234564
HGNC: HGNC:1863
Homologene: 134311
Or5k1
Name: olfactory receptor family 5 subfamily K member 1
Synonyms: GA_x54KRFPKG5P-54960233-54959268, MOR184-3, Olfr173
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 259002
Homologene: 45084
Fbxw7
Name: F-box and WD-40 domain protein 7
Synonyms: AGO, Fbxo30, SEL-10, Fbxw6, 1110001A17Rik, Cdc4, Fbw7
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 50754
Homologene: 117451
Adamts7
Name: ADAM metallopeptidase with thrombospondin type 1 motif 7
Synonyms: ADAM-TS7
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 108153
HGNC: HGNC:223
Homologene: 22803
Vmn2r77
Name: vomeronasal 2, receptor 77
Synonyms: EG546983
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 546983
Homologene: 115466
Pld5
Name: phospholipase D family member 5
Synonyms: B230365F16Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 319455
Homologene: 16081
St18
Name: suppression of tumorigenicity 18
Synonyms: Nzf3, Myt3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240690
Homologene: 8792
Vmn2r104
Name: vomeronasal 2, receptor 104
Synonyms: V2r7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22313
Homologene: 129751
Pate4
Name: prostate and testis expressed 4
Synonyms: 9530004K16Rik, SVS VII, Svs7, Pate-B
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56872
Homologene: 49624
Cyp2c54
Name: cytochrome P450, family 2, subfamily c, polypeptide 54
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 404195
VEGA: 19
Homologene: 137231
Gnptab
Name: N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
Synonyms: EG432486
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 432486
Homologene: 32576
Cyp2j6
Name: cytochrome P450, family 2, subfamily j, polypeptide 6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13110
HGNC: HGNC:2634
Homologene: 68091
Serpinb9f
Name: serine (or cysteine) peptidase inhibitor, clade B, member 9f
Synonyms: Spi13, NK21, ovalbumin
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20709
HGNC: HGNC:8955
Homologene: 69093
Ppef2
Name: protein phosphatase, EF hand calcium-binding domain 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19023
HGNC: HGNC:9244
Homologene: 55959
Nrap
Name: nebulin-related anchoring protein
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18175
HGNC: HGNC:7988
Homologene: 4499
Odad3
Name: outer dynein arm docking complex subunit 3
Synonyms: Ccdc151, C330001K17Rik, b2b1885Clo
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 77609
VEGA: 9
Homologene: 16533
Zfp202
Name: zinc finger protein 202
Synonyms: C130037E22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 80902
Homologene: 68317
Cyp2c65
Name: cytochrome P450, family 2, subfamily c, polypeptide 65
Synonyms: 2210009K14Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 72303
Homologene: 133566
Zfp788
Name: zinc finger protein 788
Synonyms: 2810426N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67607
Homologene: 137363
Rasip1
Name: Ras interacting protein 1
Synonyms: 2610025P08Rik, Rain
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69903
Homologene: 9847
Kcnh1
Name: potassium voltage-gated channel, subfamily H (eag-related), member 1
Synonyms: ether a go-go, Eag1, Kv10.1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16510
HGNC: HGNC:6250
Homologene: 68242
Tmem67
Name: transmembrane protein 67
Synonyms: 5330408M12Rik, b2b1291.1Clo, b2b1163.1Clo
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329795
Homologene: 71886
Ttll13
Name: tubulin tyrosine ligase-like family, member 13
Synonyms: 1700111A04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269954
Homologene: 136186
Lrrc71
Name: leucine rich repeat containing 71
Synonyms: 4933430H15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74485
Homologene: 83646
Vmn1r34
Name: vomeronasal 1 receptor 34
Synonyms: Gm5991
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 546901
Homologene: 110800
Gpc2
Name: glypican 2 cerebroglycan
Synonyms: 2410016G05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71951
HGNC: HGNC:4450
Homologene: 17657
Gm5093
Name: predicted gene 5093
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328825
VEGA: 17
Chid1
Name: chitinase domain containing 1
Synonyms: 3110023E09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68038
Homologene: 12229
Stox1
Name: storkhead box 1
Synonyms: 4732470K04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216021
Homologene: 17649
Or1o1
Name: olfactory receptor family 1 subfamily O member 1
Synonyms: MOR156-3, GA_x6K02T2PSCP-1867165-1868094, Olfr107
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258504
Homologene: 115498
Ydjc
Name: YdjC homolog (bacterial)
Synonyms: 4930521M19Rik, 1810015A11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 69101
Homologene: 19062
Mroh9
Name: maestro heat-like repeat family member 9
Synonyms: Armc11, 4921528O07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 78258
Homologene: 123521
Zscan4c
Name: zinc finger and SCAN domain containing 4C
Synonyms: LOC245109
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 245109
Homologene: 85986
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to G, chromosome 1 at 6,844,118 bp
  • G to A, chromosome 1 at 163,066,043 bp
  • T to C, chromosome 1 at 176,044,854 bp
  • A to T, chromosome 1 at 192,191,053 bp
  • T to G, chromosome 2 at 130,025,301 bp
  • T to A, chromosome 3 at 53,647,969 bp
  • C to T, chromosome 3 at 72,904,293 bp
  • T to C, chromosome 3 at 84,815,771 bp
  • T to C, chromosome 3 at 87,745,794 bp
  • T to C, chromosome 4 at 12,051,402 bp
  • T to A, chromosome 4 at 64,008,796 bp
  • G to C, chromosome 4 at 96,536,086 bp
  • T to C, chromosome 4 at 117,000,279 bp
  • C to T, chromosome 5 at 92,227,066 bp
  • T to C, chromosome 5 at 138,278,414 bp
  • C to A, chromosome 5 at 148,904,597 bp
  • A to G, chromosome 6 at 50,198,226 bp
  • A to G, chromosome 6 at 66,637,328 bp
  • A to G, chromosome 6 at 83,645,302 bp
  • A to G, chromosome 6 at 113,269,508 bp
  • T to C, chromosome 7 at 11,006,782 bp
  • T to A, chromosome 7 at 41,650,516 bp
  • G to A, chromosome 7 at 45,377,073 bp
  • TGCCGCCGCCGCCGCCGCCGCCGC to TGCCGCCGCCGCCGCCGCCGC, chromosome 7 at 45,628,455 bp
  • C to A, chromosome 7 at 75,586,280 bp
  • A to T, chromosome 7 at 80,260,233 bp
  • T to C, chromosome 7 at 86,811,749 bp
  • G to A, chromosome 7 at 97,579,910 bp
  • A to G, chromosome 7 at 127,977,293 bp
  • T to A, chromosome 7 at 141,528,502 bp
  • T to G, chromosome 8 at 93,256,496 bp
  • G to A, chromosome 8 at 105,947,899 bp
  • A to G, chromosome 9 at 21,990,402 bp
  • A to T, chromosome 9 at 35,608,290 bp
  • G to A, chromosome 9 at 40,207,342 bp
  • T to C, chromosome 9 at 90,192,436 bp
  • G to T, chromosome 9 at 119,924,766 bp
  • G to A, chromosome 10 at 25,507,817 bp
  • A to T, chromosome 10 at 60,765,236 bp
  • A to G, chromosome 10 at 62,664,942 bp
  • T to C, chromosome 10 at 88,429,480 bp
  • A to G, chromosome 10 at 115,390,859 bp
  • T to A, chromosome 10 at 121,606,258 bp
  • T to C, chromosome 10 at 123,038,659 bp
  • T to C, chromosome 11 at 8,865,555 bp
  • G to T, chromosome 11 at 34,229,476 bp
  • T to A, chromosome 11 at 51,268,182 bp
  • C to T, chromosome 12 at 71,959,887 bp
  • C to A, chromosome 12 at 104,149,431 bp
  • T to C, chromosome 13 at 33,334,422 bp
  • C to T, chromosome 13 at 51,144,338 bp
  • T to C, chromosome 13 at 64,367,972 bp
  • A to C, chromosome 14 at 28,317,253 bp
  • A to G, chromosome 16 at 17,147,079 bp
  • A to G, chromosome 16 at 17,913,619 bp
  • A to T, chromosome 16 at 18,280,308 bp
  • A to G, chromosome 16 at 58,797,292 bp
  • A to G, chromosome 17 at 20,030,245 bp
  • T to A, chromosome 17 at 37,405,992 bp
  • A to G, chromosome 17 at 46,439,642 bp
  • A to G, chromosome 17 at 57,876,395 bp
  • G to T, chromosome 18 at 24,600,956 bp
  • A to G, chromosome 18 at 59,179,342 bp
  • C to G, chromosome 19 at 39,061,162 bp
  • T to C, chromosome 19 at 40,047,561 bp
  • T to A, chromosome 19 at 56,361,698 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6182 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044324-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.