Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6182Btlr/Mmmh
Stock Number:
044324-MU
Citation ID:
RRID:MMRRC_044324-MU
Other Names:
R6182 (G1)
Major Collection:

Strain Information

Gsc2
Name: goosecoid homebox 2
Synonyms: 4930568H22Rik, Gscl
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 195333
HGNC: HGNC:4613
Homologene: 3884
Frem2
Name: Fras1 related extracellular matrix protein 2
Synonyms: 8430406N05Rik, 6030440P17Rik, my, ne, b2b1562Clo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242022
Homologene: 18454
Epb41l2
Name: erythrocyte membrane protein band 4.1 like 2
Synonyms: NBL2, 4.1G, D10Ertd398e, Epb4.1l2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13822
VEGA: 10
HGNC: HGNC:3379
Homologene: 37478
Mtmr14
Name: myotubularin related protein 14
Synonyms: 1110061O04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 97287
Homologene: 11203
Fus
Name: fused in sarcoma
Synonyms: translocated in liposarcoma, Tls, hnRNP P2, pigpen, D930039C12Rik, D430004D17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233908
HGNC: HGNC:4010
Homologene: 134091
Wdr48
Name: WD repeat domain 48
Synonyms: 8430408H12Rik, Uaf1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67561
VEGA: 9
Homologene: 10830
Snrnp70
Name: small nuclear ribonucleoprotein 70 (U1)
Synonyms: Rnulp70, U1-70, 2700022N21Rik, 3200002N22Rik, Srnp70, Snrp70
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20637
Homologene: 20672
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to G, chromosome 1 at 6,844,118 bp
  • G to A, chromosome 1 at 163,066,043 bp
  • T to C, chromosome 1 at 176,044,854 bp
  • A to T, chromosome 1 at 192,191,053 bp
  • T to G, chromosome 2 at 130,025,301 bp
  • T to A, chromosome 3 at 53,647,969 bp
  • C to T, chromosome 3 at 72,904,293 bp
  • T to C, chromosome 3 at 84,815,771 bp
  • T to C, chromosome 3 at 87,745,794 bp
  • T to C, chromosome 4 at 12,051,402 bp
  • T to A, chromosome 4 at 64,008,796 bp
  • G to C, chromosome 4 at 96,536,086 bp
  • T to C, chromosome 4 at 117,000,279 bp
  • C to T, chromosome 5 at 92,227,066 bp
  • T to C, chromosome 5 at 138,278,414 bp
  • C to A, chromosome 5 at 148,904,597 bp
  • A to G, chromosome 6 at 50,198,226 bp
  • A to G, chromosome 6 at 66,637,328 bp
  • A to G, chromosome 6 at 83,645,302 bp
  • A to G, chromosome 6 at 113,269,508 bp
  • T to C, chromosome 7 at 11,006,782 bp
  • T to A, chromosome 7 at 41,650,516 bp
  • G to A, chromosome 7 at 45,377,073 bp
  • TGCCGCCGCCGCCGCCGCCGCCGC to TGCCGCCGCCGCCGCCGCCGC, chromosome 7 at 45,628,455 bp
  • C to A, chromosome 7 at 75,586,280 bp
  • A to T, chromosome 7 at 80,260,233 bp
  • T to C, chromosome 7 at 86,811,749 bp
  • G to A, chromosome 7 at 97,579,910 bp
  • A to G, chromosome 7 at 127,977,293 bp
  • T to A, chromosome 7 at 141,528,502 bp
  • T to G, chromosome 8 at 93,256,496 bp
  • G to A, chromosome 8 at 105,947,899 bp
  • A to G, chromosome 9 at 21,990,402 bp
  • A to T, chromosome 9 at 35,608,290 bp
  • G to A, chromosome 9 at 40,207,342 bp
  • T to C, chromosome 9 at 90,192,436 bp
  • G to T, chromosome 9 at 119,924,766 bp
  • G to A, chromosome 10 at 25,507,817 bp
  • A to T, chromosome 10 at 60,765,236 bp
  • A to G, chromosome 10 at 62,664,942 bp
  • T to C, chromosome 10 at 88,429,480 bp
  • A to G, chromosome 10 at 115,390,859 bp
  • T to A, chromosome 10 at 121,606,258 bp
  • T to C, chromosome 10 at 123,038,659 bp
  • T to C, chromosome 11 at 8,865,555 bp
  • G to T, chromosome 11 at 34,229,476 bp
  • T to A, chromosome 11 at 51,268,182 bp
  • C to T, chromosome 12 at 71,959,887 bp
  • C to A, chromosome 12 at 104,149,431 bp
  • T to C, chromosome 13 at 33,334,422 bp
  • C to T, chromosome 13 at 51,144,338 bp
  • T to C, chromosome 13 at 64,367,972 bp
  • A to C, chromosome 14 at 28,317,253 bp
  • A to G, chromosome 16 at 17,147,079 bp
  • A to G, chromosome 16 at 17,913,619 bp
  • A to T, chromosome 16 at 18,280,308 bp
  • A to G, chromosome 16 at 58,797,292 bp
  • A to G, chromosome 17 at 20,030,245 bp
  • T to A, chromosome 17 at 37,405,992 bp
  • A to G, chromosome 17 at 46,439,642 bp
  • A to G, chromosome 17 at 57,876,395 bp
  • G to T, chromosome 18 at 24,600,956 bp
  • A to G, chromosome 18 at 59,179,342 bp
  • C to G, chromosome 19 at 39,061,162 bp
  • T to C, chromosome 19 at 40,047,561 bp
  • T to A, chromosome 19 at 56,361,698 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6182 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044324-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.