Strain Name:
C57BL/6J-MtgxR6189Btlr
Stock Number:
044329-MU
Citation ID:
RRID:MMRRC_044329-MU
Other Names:
R6189 (G1)
Major Collection:

Strain Information

Pitx2
Name: paired-like homeodomain transcription factor 2
Synonyms: Otlx2, Brx1b, Brx1a, Brx1, solurshin, Ptx2, Munc30, Pitx2c, Pitx2b, Pitx2a, Rieg
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 18741
HGNC: HGNC:9005
Homologene: 55454
Cntnap2
Name: contactin associated protein-like 2
Synonyms: 5430425M22Rik, Caspr2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 66797
Homologene: 69159
Pofut2
Name: protein O-fucosyltransferase 2
Synonyms: FUT13, 2310011G23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 80294
VEGA: 10
Homologene: 12724
Cacna1h
Name: calcium channel, voltage-dependent, T type, alpha 1H subunit
Synonyms: Cav3.2, alpha13.2, T-type Cav3.2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 58226
HGNC: HGNC:1395
Homologene: 56913
Erbb4
Name: erb-b2 receptor tyrosine kinase 4
Synonyms: ErbB4, Her4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13869
HGNC: HGNC:3432
Homologene: 21084
Dnmbp
Name: dynamin binding protein
Synonyms: 2410003M15Rik, Tuba, 2410003L07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 71972
Homologene: 9061
Igf1r
Name: insulin-like growth factor I receptor
Synonyms: CD221, IGF-1R, line 186, hyft, A330103N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16001
HGNC: HGNC:5465
Homologene: 30997
Hunk
Name: hormonally upregulated Neu-associated kinase
Synonyms: Mak-v, Bstk1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 26559
VEGA: 16
Homologene: 8742
Dmxl1
Name: Dmx-like 1
Synonyms: C630007L23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 240283
HGNC: HGNC:2937
Homologene: 21136
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233532
Homologene: 41142
Trip4
Name: thyroid hormone receptor interactor 4
Synonyms: ASC-1, 4930558E03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 56404
Homologene: 9426
Mgrn1
Name: mahogunin, ring finger 1
Synonyms: nc, 2610042J20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 17237
VEGA: 16
Homologene: 41020
Zfp318
Name: zinc finger protein 318
Synonyms: TZF, 2610034E08Rik, D530032D06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 57908
Homologene: 22808
Ripk1
Name: receptor (TNFRSF)-interacting serine-threonine kinase 1
Synonyms: Rinp, Rip1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 19766
Homologene: 2820
Setd1a
Name: SET domain containing 1A
Synonyms: KMT2F
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233904
Homologene: 52251
Cyp1a1
Name: cytochrome P450, family 1, subfamily a, polypeptide 1
Synonyms: cytochrome P450 subfamily I, polypeptide 1, P450-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 13076
VEGA: 9
HGNC: HGNC:2595
Homologene: 68062
Eml2
Name: echinoderm microtubule associated protein like 2
Synonyms: 1600029N02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 72205
Homologene: 8125
Magi3
Name: membrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms: 4732496O19Rik, 6530407C02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 99470
Homologene: 26431
Lnpep
Name: leucyl/cystinyl aminopeptidase
Synonyms: gp160, vp165, IRAP, 4732490P18Rik, 2010309L07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 240028
VEGA: 17
HGNC: HGNC:6656
Homologene: 21148
Slc38a6
Name: solute carrier family 38, member 6
Synonyms: EG625098
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 625098
Homologene: 27550
Robo4
Name: roundabout guidance receptor 4
Synonyms: 1200012D01Rik, Magic roundabout
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 74144
Homologene: 10397
Zic5
Name: zinc finger protein of the cerebellum 5
Synonyms: odd-paired related, Opr, 1700049L20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 65100
Homologene: 11301
Akap2
Name: A kinase (PRKA) anchor protein 2
Synonyms: B230340M18Rik, AKAP-KL
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Pmch
Name: pro-melanin-concentrating hormone
Synonyms: MCH, melanin-concentrating hormone, A230109K23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 110312
Homologene: 37653
Dnajc13
Name: DnaJ heat shock protein family (Hsp40) member C13
Synonyms: Rme8, LOC382100, D030002L11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235567
Homologene: 13574
Nutm2
Name: NUT family member 2
Synonyms: LOC328250, Gm806
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 328250
Homologene: 128615
Epha5
Name: Eph receptor A5
Synonyms: Cek7, bsk, Els1, Rek7, Hek7, Ehk1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 13839
HGNC: HGNC:3389
Homologene: 55824
Itgam
Name: integrin alpha M
Synonyms: complement component receptor 3 alpha, CD11B (p170), Mac-1 alpha, Mac-1, complement receptor type 3, CR3, CD11b/CD18, Mac-1a, F730045J24Rik, Ly-40, Cd11b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16409
HGNC: HGNC:6149
Homologene: 526
Ptprq
Name: protein tyrosine phosphatase receptor type Q
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237523
HGNC: HGNC:9679
Homologene: 83557
Cenatac
Name: centrosomal AT-AC splicing factor
Synonyms: D630044F24Rik, Ccdc84
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 382073
VEGA: 9
Homologene: 13886
Pcdhb10
Name: protocadherin beta 10
Synonyms: Pcdhb5D, PcdhbJ
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93881
HGNC: HGNC:8690
Homologene: 88834
Nav3
Name: neuron navigator 3
Synonyms: Pomfil1p, POMFIL1, 4732483H20Rik, unc53H3, steerin 3, 9630020C08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 260315
Homologene: 56688
Unc80
Name: unc-80, NALCN activator
Synonyms: C230061B10Rik, C030018G13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329178
Homologene: 122243
Serpinb9h
Name: serine (or cysteine) peptidase inhibitor, clade B, member 9h
Synonyms: Gm11397
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 544923
HGNC: HGNC:8955
Homologene: 69093
Dclre1b
Name: DNA cross-link repair 1B
Synonyms: mSNM1B, Apollo, SNMIB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 140917
Homologene: 32553
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 380698
Homologene: 70869
Lrp4
Name: low density lipoprotein receptor-related protein 4
Synonyms: 6430526J12Rik, Megf7, mdig
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228357
HGNC: HGNC:6696
Homologene: 17964
Actn2
Name: actinin alpha 2
Synonyms: 1110008F24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 11472
HGNC: HGNC:164
Homologene: 31016
Umodl1
Name: uromodulin-like 1
Synonyms: D17Ertd488e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 52020
VEGA: 17
Homologene: 45466
Or8u10
Name: olfactory receptor family 8 subfamily U member 10
Synonyms: GA_x6K02T2Q125-47560740-47559775, MOR256-34P, MOR171-52, Olfr1037
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 259151
Homologene: 66572
Ccdc97
Name: coiled-coil domain containing 97
Synonyms: 2810446P04Rik, 1200014H14Rik, D7Ertd462e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 52132
Homologene: 32701
Abca8a
Name: ATP-binding cassette, sub-family A (ABC1), member 8a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217258
HGNC: HGNC:38
Homologene: 131160
Flg2
Name: filaggrin family member 2
Synonyms: EG229574
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229574
Homologene: 134146
Micalcl
Name: MICAL C-terminal like
Synonyms: 4921517J23Rik, Ebitein1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 100504195
Homologene: 13149
Gpr87
Name: G protein-coupled receptor 87
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 84111
HGNC: HGNC:4538
Homologene: 13021
Vmn2r94
Name: vomeronasal 2, receptor 94
Synonyms: EG665227
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 665227
Homologene: 129751
Lao1
Name: L-amino acid oxidase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 100470
Homologene: 44223
Mymk
Name: myomaker, myoblast fusion factor
Synonyms: 1110002H13Rik, Tmem8c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 66139
Homologene: 11925
Ntn5
Name: netrin 5
Synonyms: LOC243967
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 243967
Homologene: 17106
Rimbp2
Name: RIMS binding protein 2
Synonyms: A930033C01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231760
Homologene: 14672
A530064D06Rik
Name: RIKEN cDNA A530064D06 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 328830
VEGA: 17
Homologene: 136361
Zfp872
Name: zinc finger protein 872
Synonyms: 9530015I07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 619310
Susd5
Name: sushi domain containing 5
Synonyms: LOC382111
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 382111
VEGA: 9
Homologene: 19526
Ube2q2
Name: ubiquitin-conjugating enzyme E2Q family member 2
Synonyms: 3010021M21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 109161
Homologene: 45455
Aldh1l2
Name: aldehyde dehydrogenase 1 family, member L2
Synonyms: D330038I09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216188
Homologene: 51942
Hrh1
Name: histamine receptor H1
Synonyms: Bphs, Hir
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 15465
HGNC: HGNC:5182
Homologene: 668
Vmn1r70
Name: vomeronasal 1 receptor 70
Synonyms: V1rl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 171262
Homologene: 74361
Cnot6l
Name: CCR4-NOT transcription complex, subunit 6-like
Synonyms: 4932442K20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231464
Homologene: 100830
Dok5
Name: docking protein 5
Synonyms: 2700055C10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 76829
Homologene: 10195
Wee2
Name: WEE1 homolog 2 (S. pombe)
Synonyms: LOC381759, Wee1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 381759
Homologene: 52392
Rusc1
Name: RUN and SH3 domain containing 1
Synonyms: 2210403N08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 72296
Homologene: 75028
Tuba4a
Name: tubulin, alpha 4A
Synonyms: M[a]4, Tuba4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 22145
Homologene: 68496
Rassf5
Name: Ras association (RalGDS/AF-6) domain family member 5
Synonyms: 1300019G20Rik, Nore1B, Nore1A, Rapl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 54354
Homologene: 10296
Prr36
Name: proline rich 36
Synonyms: BC068157
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 73072
Homologene: 136398
Adam3
Name: a disintegrin and metallopeptidase domain 3 (cyritestin)
Synonyms: Taz83, tMDC, Cyrn1, ADAM3, Taz83
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 11497
HGNC: HGNC:209
Homologene: 69052
Il34
Name: interleukin 34
Synonyms: 2010004A03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 76527
Homologene: 12648
Fbxo40
Name: F-box protein 40
Synonyms: 9830003A13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 207215
Homologene: 9459
Ift57
Name: intraflagellar transport 57
Synonyms: MHS4R2, HIPPI, 4833420A15Rik, Esrrbl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 73916
Homologene: 32383
Itga7
Name: integrin alpha 7
Synonyms: [a]7, alpha7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 16404
VEGA: 10
HGNC: HGNC:6143
Homologene: 37592
C4bp
Name: complement component 4 binding protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12269
HGNC: HGNC:1325
Gm10471
Name: predicted gene 10471
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100039045
Homologene: 69402
Cxcl10
Name: chemokine (C-X-C motif) ligand 10
Synonyms: CRG-2, IP-10, Ifi10, Scyb10, gIP-10, C7, INP10, mob-1, IP10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 15945
Homologene: 1203
Nupl2
Name: nucleoporin like 2
Synonyms: CG1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231042
Homologene: 40573
Mecr
Name: mitochondrial trans-2-enoyl-CoA reductase
Synonyms: Nrbf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 26922
Homologene: 5362
Retnla
Name: resistin like alpha
Synonyms: RELMa, 1810019L16Rik, Fizz1, Xcp2, HIMF, Fizz-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 57262
VEGA: 16
Homologene: 23232
Igkv14-130
Name: immunoglobulin kappa variable 14-130
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 628072
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 66,677,471 bp
  • T to A, chromosome 1 at 68,043,916 bp
  • T to A, chromosome 1 at 75,216,874 bp
  • T to C, chromosome 1 at 130,636,819 bp
  • G to A, chromosome 1 at 131,244,979 bp
  • C to T, chromosome 2 at 27,067,365 bp
  • A to T, chromosome 2 at 86,084,913 bp
  • T to C, chromosome 2 at 91,475,234 bp
  • T to A, chromosome 2 at 170,800,851 bp
  • T to A, chromosome 3 at 59,179,229 bp
  • A to T, chromosome 3 at 89,089,012 bp
  • T to A, chromosome 3 at 93,220,074 bp
  • A to G, chromosome 3 at 103,803,533 bp
  • G to T, chromosome 3 at 104,050,865 bp
  • T to C, chromosome 3 at 129,218,469 bp
  • A to G, chromosome 4 at 57,855,928 bp
  • A to G, chromosome 4 at 88,603,011 bp
  • T to A, chromosome 4 at 118,967,880 bp
  • A to T, chromosome 4 at 131,865,254 bp
  • G to T, chromosome 5 at 24,175,454 bp
  • A to G, chromosome 5 at 26,085,693 bp
  • A to T, chromosome 5 at 84,237,540 bp
  • A to T, chromosome 5 at 92,348,113 bp
  • G to A, chromosome 5 at 96,098,277 bp
  • A to G, chromosome 5 at 128,803,897 bp
  • C to T, chromosome 6 at 40,449,683 bp
  • T to A, chromosome 6 at 47,271,298 bp
  • T to C, chromosome 6 at 67,791,448 bp
  • T to A, chromosome 6 at 114,479,998 bp
  • T to A, chromosome 7 at 10,633,671 bp
  • G to A, chromosome 7 at 19,201,163 bp
  • T to A, chromosome 7 at 25,716,098 bp
  • A to T, chromosome 7 at 45,693,220 bp
  • T to A, chromosome 7 at 68,207,336 bp
  • GGCG to GGCGACGGCTGCG, chromosome 7 at 97,579,906 bp
  • A to C, chromosome 7 at 112,412,880 bp
  • T to C, chromosome 7 at 127,778,283 bp
  • A to G, chromosome 7 at 128,112,504 bp
  • C to A, chromosome 8 at 4,214,177 bp
  • A to C, chromosome 8 at 24,711,336 bp
  • C to T, chromosome 8 at 110,742,718 bp
  • A to T, chromosome 9 at 22,197,131 bp
  • G to A, chromosome 9 at 37,403,533 bp
  • G to A, chromosome 9 at 44,410,321 bp
  • T to A, chromosome 9 at 55,162,983 bp
  • T to C, chromosome 9 at 57,700,683 bp
  • G to A, chromosome 9 at 65,879,152 bp
  • G to C, chromosome 9 at 104,213,886 bp
  • A to T, chromosome 9 at 114,095,658 bp
  • C to T, chromosome 10 at 74,342,651 bp
  • T to A, chromosome 10 at 77,268,586 bp
  • A to G, chromosome 10 at 83,508,013 bp
  • G to T, chromosome 10 at 88,091,386 bp
  • C to A, chromosome 10 at 107,517,887 bp
  • T to C, chromosome 10 at 109,720,019 bp
  • T to C, chromosome 10 at 128,950,403 bp
  • T to C, chromosome 11 at 59,069,934 bp
  • T to C, chromosome 11 at 110,030,884 bp
  • A to T, chromosome 12 at 73,310,196 bp
  • C to T, chromosome 13 at 12,276,440 bp
  • A to T, chromosome 13 at 33,404,444 bp
  • A to G, chromosome 13 at 34,032,501 bp
  • T to A, chromosome 13 at 50,469,738 bp
  • T to G, chromosome 14 at 122,464,974 bp
  • T to C, chromosome 16 at 4,910,810 bp
  • A to G, chromosome 16 at 36,966,164 bp
  • A to G, chromosome 16 at 48,842,895 bp
  • G to A, chromosome 16 at 49,763,813 bp
  • G to A, chromosome 16 at 90,487,881 bp
  • A to T, chromosome 17 at 17,566,739 bp
  • A to T, chromosome 17 at 18,257,734 bp
  • A to G, chromosome 17 at 25,397,844 bp
  • A to G, chromosome 17 at 30,996,282 bp
  • TGAAGAAGAAGAAGAAGAAGAAGAAGAAG to TGAAGAAGAAGAAGAAGAAGAAG, chromosome 17 at 46,412,514 bp
  • A to G, chromosome 17 at 48,167,054 bp
  • T to A, chromosome 18 at 37,412,403 bp
  • C to T, chromosome 18 at 49,893,335 bp
  • T to C, chromosome 19 at 43,890,309 bp
  • T to A, chromosome 19 at 43,901,511 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6189 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044329-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.