Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6189Btlr/Mmmh
Stock Number:
044329-MU
Citation ID:
RRID:MMRRC_044329-MU
Other Names:
R6189 (G1)
Major Collection:

Strain Information

Pitx2
Name: paired-like homeodomain transcription factor 2
Synonyms: Otlx2, Brx1b, Brx1a, Brx1, solurshin, Ptx2, Munc30, Pitx2c, Pitx2b, Pitx2a, Rieg
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18741
HGNC: HGNC:9005
Homologene: 55454
Cntnap2
Name: contactin associated protein-like 2
Synonyms: 5430425M22Rik, Caspr2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66797
Homologene: 69159
Pofut2
Name: protein O-fucosyltransferase 2
Synonyms: FUT13, 2310011G23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 80294
VEGA: 10
Homologene: 12724
Cacna1h
Name: calcium channel, voltage-dependent, T type, alpha 1H subunit
Synonyms: alpha13.2, Cav3.2, T-type Cav3.2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 58226
HGNC: HGNC:1395
Homologene: 56913
Erbb4
Name: erb-b2 receptor tyrosine kinase 4
Synonyms: ErbB4, Her4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13869
HGNC: HGNC:3432
Homologene: 21084
Dnmbp
Name: dynamin binding protein
Synonyms: 2410003M15Rik, Tuba, 2410003L07Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 71972
Homologene: 9061
Igf1r
Name: insulin-like growth factor I receptor
Synonyms: CD221, IGF-1R, line 186, hyft, A330103N21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16001
HGNC: HGNC:5465
Homologene: 30997
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 66,677,471 bp
  • T to A, chromosome 1 at 68,043,916 bp
  • T to A, chromosome 1 at 75,216,874 bp
  • T to C, chromosome 1 at 130,636,819 bp
  • G to A, chromosome 1 at 131,244,979 bp
  • C to T, chromosome 2 at 27,067,365 bp
  • A to T, chromosome 2 at 86,084,913 bp
  • T to C, chromosome 2 at 91,475,234 bp
  • T to A, chromosome 2 at 170,800,851 bp
  • T to A, chromosome 3 at 59,179,229 bp
  • A to T, chromosome 3 at 89,089,012 bp
  • T to A, chromosome 3 at 93,220,074 bp
  • A to G, chromosome 3 at 103,803,533 bp
  • G to T, chromosome 3 at 104,050,865 bp
  • T to C, chromosome 3 at 129,218,469 bp
  • A to G, chromosome 4 at 57,855,928 bp
  • A to G, chromosome 4 at 88,603,011 bp
  • T to A, chromosome 4 at 118,967,880 bp
  • A to T, chromosome 4 at 131,865,254 bp
  • G to T, chromosome 5 at 24,175,454 bp
  • A to G, chromosome 5 at 26,085,693 bp
  • A to T, chromosome 5 at 84,237,540 bp
  • A to T, chromosome 5 at 92,348,113 bp
  • G to A, chromosome 5 at 96,098,277 bp
  • A to G, chromosome 5 at 128,803,897 bp
  • C to T, chromosome 6 at 40,449,683 bp
  • T to A, chromosome 6 at 47,271,298 bp
  • T to C, chromosome 6 at 67,791,448 bp
  • T to A, chromosome 6 at 114,479,998 bp
  • T to A, chromosome 7 at 10,633,671 bp
  • G to A, chromosome 7 at 19,201,163 bp
  • T to A, chromosome 7 at 25,716,098 bp
  • A to T, chromosome 7 at 45,693,220 bp
  • T to A, chromosome 7 at 68,207,336 bp
  • GGCG to GGCGACGGCTGCG, chromosome 7 at 97,579,906 bp
  • A to C, chromosome 7 at 112,412,880 bp
  • T to C, chromosome 7 at 127,778,283 bp
  • A to G, chromosome 7 at 128,112,504 bp
  • C to A, chromosome 8 at 4,214,177 bp
  • A to C, chromosome 8 at 24,711,336 bp
  • C to T, chromosome 8 at 110,742,718 bp
  • A to T, chromosome 9 at 22,197,131 bp
  • G to A, chromosome 9 at 37,403,533 bp
  • G to A, chromosome 9 at 44,410,321 bp
  • T to A, chromosome 9 at 55,162,983 bp
  • T to C, chromosome 9 at 57,700,683 bp
  • G to A, chromosome 9 at 65,879,152 bp
  • G to C, chromosome 9 at 104,213,886 bp
  • A to T, chromosome 9 at 114,095,658 bp
  • C to T, chromosome 10 at 74,342,651 bp
  • T to A, chromosome 10 at 77,268,586 bp
  • A to G, chromosome 10 at 83,508,013 bp
  • G to T, chromosome 10 at 88,091,386 bp
  • C to A, chromosome 10 at 107,517,887 bp
  • T to C, chromosome 10 at 109,720,019 bp
  • T to C, chromosome 10 at 128,950,403 bp
  • T to C, chromosome 11 at 59,069,934 bp
  • T to C, chromosome 11 at 110,030,884 bp
  • A to T, chromosome 12 at 73,310,196 bp
  • C to T, chromosome 13 at 12,276,440 bp
  • A to T, chromosome 13 at 33,404,444 bp
  • A to G, chromosome 13 at 34,032,501 bp
  • T to A, chromosome 13 at 50,469,738 bp
  • T to G, chromosome 14 at 122,464,974 bp
  • T to C, chromosome 16 at 4,910,810 bp
  • A to G, chromosome 16 at 36,966,164 bp
  • A to G, chromosome 16 at 48,842,895 bp
  • G to A, chromosome 16 at 49,763,813 bp
  • G to A, chromosome 16 at 90,487,881 bp
  • A to T, chromosome 17 at 17,566,739 bp
  • A to T, chromosome 17 at 18,257,734 bp
  • A to G, chromosome 17 at 25,397,844 bp
  • A to G, chromosome 17 at 30,996,282 bp
  • TGAAGAAGAAGAAGAAGAAGAAGAAGAAG to TGAAGAAGAAGAAGAAGAAGAAG, chromosome 17 at 46,412,514 bp
  • A to G, chromosome 17 at 48,167,054 bp
  • T to A, chromosome 18 at 37,412,403 bp
  • C to T, chromosome 18 at 49,893,335 bp
  • T to C, chromosome 19 at 43,890,309 bp
  • T to A, chromosome 19 at 43,901,511 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6189 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044329-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.