Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6213Btlr/Mmmh
Stock Number:
044346-MU
Citation ID:
RRID:MMRRC_044346-MU
Other Names:
R6213 (G1)
Major Collection:

Strain Information

Nrcam
Name: neuronal cell adhesion molecule
Synonyms: Bravo, C030017F07Rik, C130076O07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319504
VEGA: 12
HGNC: HGNC:7994
Homologene: 21041
Cdkn1b
Name: cyclin dependent kinase inhibitor 1B
Synonyms: p27Kip1, p27
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12576
HGNC: HGNC:1785
Homologene: 2999
Tspan14
Name: tetraspanin 14
Synonyms: D14Ertd226e, Tm4sf14
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 52588
VEGA: 14
Homologene: 23717
Ptpn3
Name: protein tyrosine phosphatase, non-receptor type 3
Synonyms: PTPCL, 9530011I20Rik, PTP-H1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 545622
HGNC: HGNC:9655
Homologene: 74451
Phf20l1
Name: PHD finger protein 20-like 1
Synonyms: CGI-72, E130113K22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239510
VEGA: 15
Homologene: 9341
Rrp12
Name: ribosomal RNA processing 12 homolog
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107094
VEGA: 19
Homologene: 22370
Cep290
Name: centrosomal protein 290
Synonyms: Nphp6, b2b1454Clo, b2b1752Clo, Kiaa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216274
VEGA: 10
Homologene: 77213
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 20,523,770 bp
  • A to C, chromosome 1 at 75,131,748 bp
  • A to C, chromosome 1 at 105,589,266 bp
  • T to C, chromosome 1 at 136,625,512 bp
  • G to A, chromosome 2 at 32,776,745 bp
  • G to T, chromosome 2 at 91,260,434 bp
  • C to T, chromosome 2 at 140,661,165 bp
  • T to C, chromosome 2 at 155,277,015 bp
  • T to C, chromosome 3 at 103,040,514 bp
  • A to G, chromosome 4 at 53,017,066 bp
  • G to T, chromosome 4 at 57,265,012 bp
  • G to A, chromosome 4 at 126,323,196 bp
  • G to A, chromosome 5 at 36,602,634 bp
  • A to T, chromosome 5 at 39,614,521 bp
  • A to G, chromosome 5 at 117,106,662 bp
  • C to T, chromosome 5 at 138,125,097 bp
  • A to G, chromosome 6 at 43,153,887 bp
  • A to T, chromosome 6 at 78,427,403 bp
  • A to C, chromosome 6 at 101,377,844 bp
  • T to A, chromosome 6 at 134,921,243 bp
  • T to C, chromosome 7 at 27,808,292 bp
  • A to G, chromosome 7 at 86,585,277 bp
  • T to C, chromosome 7 at 102,534,932 bp
  • T to C, chromosome 7 at 141,751,414 bp
  • A to T, chromosome 7 at 141,862,166 bp
  • A to G, chromosome 7 at 141,867,619 bp
  • A to T, chromosome 7 at 143,799,812 bp
  • G to T, chromosome 8 at 10,370,963 bp
  • G to T, chromosome 8 at 45,241,500 bp
  • A to G, chromosome 8 at 81,997,390 bp
  • G to A, chromosome 8 at 84,915,569 bp
  • G to A, chromosome 8 at 88,314,137 bp
  • AGTGGTGGTGGTGGTGGTGGTGG to AGTGGTGGTGGTGGTGGTGG, chromosome 8 at 89,033,058 bp
  • T to A, chromosome 9 at 44,628,693 bp
  • T to A, chromosome 9 at 59,827,258 bp
  • T to C, chromosome 9 at 103,332,751 bp
  • A to G, chromosome 9 at 121,798,909 bp
  • A to G, chromosome 10 at 100,523,360 bp
  • A to G, chromosome 11 at 58,390,334 bp
  • G to A, chromosome 11 at 72,401,399 bp
  • A to T, chromosome 11 at 97,241,997 bp
  • A to T, chromosome 11 at 115,185,106 bp
  • C to T, chromosome 12 at 44,562,432 bp
  • T to A, chromosome 12 at 86,057,847 bp
  • T to C, chromosome 12 at 86,883,593 bp
  • A to T, chromosome 12 at 113,896,521 bp
  • T to G, chromosome 13 at 23,099,169 bp
  • A to G, chromosome 14 at 40,913,415 bp
  • A to G, chromosome 15 at 8,334,906 bp
  • A to G, chromosome 15 at 47,629,260 bp
  • T to C, chromosome 15 at 66,632,903 bp
  • A to C, chromosome 15 at 77,638,000 bp
  • A to G, chromosome 16 at 20,400,012 bp
  • ATCTTCT to ATCT, chromosome 17 at 23,359,988 bp
  • T to A, chromosome 17 at 27,111,200 bp
  • T to C, chromosome 17 at 35,660,440 bp
  • T to C, chromosome 17 at 37,280,373 bp
  • T to A, chromosome 17 at 42,377,360 bp
  • T to C, chromosome 17 at 84,186,552 bp
  • T to A, chromosome 18 at 49,863,015 bp
  • C to A, chromosome 19 at 41,868,778 bp
  • G to C, chromosome X at 7,823,909 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6213 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044346-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.