Strain Name:
C57BL/6J-MtgxR6213Btlr/Mmmh
Stock Number:
044346-MU
Citation ID:
RRID:MMRRC_044346-MU
Other Names:
R6213 (G1)
Major Collection:

Strain Information

Nrcam
Name: neuronal cell adhesion molecule
Synonyms: C030017F07Rik, Bravo, C130076O07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319504
VEGA: 12
HGNC: HGNC:7994
Homologene: 21041
Cdkn1b
Name: cyclin dependent kinase inhibitor 1B
Synonyms: p27Kip1, p27
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12576
HGNC: HGNC:1785
Homologene: 2999
Tspan14
Name: tetraspanin 14
Synonyms: D14Ertd226e, Tm4sf14
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 52588
VEGA: 14
Homologene: 23717
Ptpn3
Name: protein tyrosine phosphatase, non-receptor type 3
Synonyms: PTP-H1, 9530011I20Rik, PTPCL
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 545622
HGNC: HGNC:9655
Homologene: 74451
Phf20l1
Name: PHD finger protein 20-like 1
Synonyms: E130113K22Rik, CGI-72
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239510
VEGA: 15
Homologene: 9341
Rrp12
Name: ribosomal RNA processing 12 homolog
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107094
VEGA: 19
Homologene: 22370
Cep290
Name: centrosomal protein 290
Synonyms: b2b1752Clo, Kiaa, b2b1454Clo, Nphp6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216274
VEGA: 10
Homologene: 77213
Suds3
Name: suppressor of defective silencing 3 homolog (S. cerevisiae)
Synonyms: 2400003N08Rik, 2410008L21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71954
Homologene: 15906
Sall1
Name: spalt like transcription factor 1
Synonyms: Msal-3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 58198
Homologene: 2230
Csde1
Name: cold shock domain containing E1, RNA binding
Synonyms: D3Jfr1, unr
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229663
Homologene: 5179
Dmxl1
Name: Dmx-like 1
Synonyms: C630007L23Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240283
HGNC: HGNC:2937
Homologene: 21136
Npepps
Name: aminopeptidase puromycin sensitive
Synonyms: Psa, MP100
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19155
HGNC: HGNC:7900
Homologene: 36199
Ddx6
Name: DEAD-box helicase 6
Synonyms: DEAD (Asp-Glu-Ala-Asp) box polypeptide 6, rck, HLR2, mRCK/P54, C430015D01Rik, 1110001P04Rik, p54, E230023J21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13209
VEGA: 9
HGNC: HGNC:2747
Homologene: 3238
Topbp1
Name: topoisomerase (DNA) II binding protein 1
Synonyms: 2810429C13Rik, 1110031N14Rik, D430026L04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235559
Homologene: 38262
Smtnl2
Name: smoothelin-like 2
Synonyms: D130058I21Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 276829
Homologene: 82367
Myo9a
Name: myosin IXa
Synonyms: C130068I12Rik, 4732465J09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270163
HGNC: HGNC:7608
Homologene: 21371
Abcc5
Name: ATP-binding cassette, sub-family C member 5
Synonyms: 2900011L11Rik, Abcc5b, Abcc5a, Mrp5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 27416
HGNC: HGNC:56
Homologene: 21164
Zfp281
Name: zinc finger protein 281
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226442
Homologene: 8270
Zfp626
Name: zinc finger protein 626
Synonyms: 4933426I21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71163
D5Ertd579e
Name: DNA segment, Chr 5, ERATO Doi 579, expressed
Synonyms: A930018H20Rik, 9030221A05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320661
Homologene: 19716
Muc2
Name: mucin 2
Synonyms: 2010015E03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17831
HGNC: HGNC:7512
Homologene: 136755
Lypd8
Name: LY6/PLAUR domain containing 8
Synonyms: 2210415F13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70163
Homologene: 52815
Flrt3
Name: fibronectin leucine rich transmembrane protein 3
Synonyms: 5530600M07Rik, C430047I10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71436
HGNC: HGNC:3762
Homologene: 8322
Nipbl
Name: NIPBL cohesin loading factor
Synonyms: 4933421G18Rik, 4921518A06Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71175
VEGA: 15
Homologene: 15850
Map1lc3a
Name: microtubule-associated protein 1 light chain 3 alpha
Synonyms: LC3, LC3a, 1010001H21Rik, 4922501H04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66734
HGNC: HGNC:6838
Homologene: 12021
Itpr3
Name: inositol 1,4,5-triphosphate receptor 3
Synonyms: Itpr-3, tf, Ip3r3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16440
HGNC: HGNC:6182
Homologene: 1675
Tgfb3
Name: transforming growth factor, beta 3
Synonyms: Tgfb-3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 21809
VEGA: 12
Homologene: 2433
Zscan21
Name: zinc finger and SCAN domain containing 21
Synonyms: CTfin51, Zipro1, Zfp-38, RU49, Zfp38
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22697
Homologene: 56530
Myo16
Name: myosin XVI
Synonyms: Nyap3, C230040D10Rik, BM140241
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244281
Homologene: 34710
Pkhd1
Name: polycystic kidney and hepatic disease 1
Synonyms: tigmin, FPC
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241035
HGNC: HGNC:9016
Homologene: 16336
Nipsnap3b
Name: nipsnap homolog 3B
Synonyms: 2700063N13Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66536
Homologene: 75044
Nat9
Name: N-acetyltransferase 9 (GCN5-related, putative)
Synonyms: 1110028N05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66176
Homologene: 9231
Vmn2r115
Name: vomeronasal 2, receptor 115
Synonyms: V2Rp4, EG638102
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 638102
Homologene: 86604
Nadsyn1
Name: NAD synthetase 1
Synonyms: 9130012B15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 78914
Homologene: 6098
Ptchd4
Name: patched domain containing 4
Synonyms: 3110082D06Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627626
VEGA: 17
Homologene: 78322
Csmd3
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239420
Homologene: 65982
Muc5b
Name: mucin 5, subtype B, tracheobronchial
Synonyms: MUC5, 2300002I04Rik, MUC9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74180
HGNC: HGNC:7516
Homologene: 136756
Vars2
Name: valyl-tRNA synthetase 2, mitochondrial
Synonyms: 1190004I24Rik, Vars2l
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68915
Homologene: 57502
Pign
Name: phosphatidylinositol glycan anchor biosynthesis, class N
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 27392
HGNC: HGNC:8967
Homologene: 6330
Inpp4b
Name: inositol polyphosphate-4-phosphatase, type II
Synonyms: E130107I17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234515
HGNC: HGNC:6075
Homologene: 20832
Pdzrn3
Name: PDZ domain containing RING finger 3
Synonyms: 1110020C07Rik, Semcap3, LNX3, semaphorin cytoplasmic domain-associated protein 3A
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 55983
Homologene: 10328
Ccdc13
Name: coiled-coil domain containing 13
Synonyms: 2900041A11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 100502861
Homologene: 87213
Vmn1r216
Name: vomeronasal 1 receptor 216
Synonyms: V1ri10
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171279
Homologene: 110880
Irf2bpl
Name: interferon regulatory factor 2 binding protein-like
Synonyms: 6430527G18Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238330
VEGA: 12
Homologene: 11555
F11
Name: coagulation factor XI
Synonyms: 1600027G01Rik, FXI, Cf11, plasma thromboplastin antecedent
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 109821
HGNC: HGNC:3529
Homologene: 86654
Mast1
Name: microtubule associated serine/threonine kinase 1
Synonyms: SAST170, SAST, 9430008B02Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56527
Homologene: 10543
Adcy7
Name: adenylate cyclase 7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11513
HGNC: HGNC:238
Homologene: 866
Kcnd1
Name: potassium voltage-gated channel, Shal-related family, member 1
Synonyms: Shal, 1110037K09Rik, Kv4.1, Kca2-1, mShal1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 16506
HGNC: HGNC:6237
Homologene: 21035
Slc23a3
Name: solute carrier family 23 (nucleobase transporters), member 3
Synonyms: Yspl1, SVCT3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22626
Homologene: 65865
Or2a14
Name: olfactory receptor family 2 subfamily A member 14
Synonyms: GA_x6K02T08UK8-1-481, GA_x6K02T2P3E9-4404793-4403861, Olfr237, Olfr237-ps1, MOR261-4, Olfr438
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258648
Homologene: 88438
Or1o4
Name: olfactory receptor family 1 subfamily O member 4
Synonyms: MOR156-1, GA_x6K02T2PSCP-1720261-1719344, Olfr99
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258508
Homologene: 74030
Reg1
Name: regenerating islet-derived 1
Synonyms: pancreatic stone protein
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19692
Homologene: 68282
Tekt2
Name: tektin 2
Synonyms: tektin-t
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 24084
Homologene: 8043
Hs3st1
Name: heparan sulfate (glucosamine) 3-O-sulfotransferase 1
Synonyms: D5Wsu110e, 3-OST
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15476
HGNC: HGNC:5194
Homologene: 3751
Pacsin3
Name: protein kinase C and casein kinase substrate in neurons 3
Synonyms: 4921507A02Rik, 6330413E15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 80708
HGNC: HGNC:8572
Homologene: 41117
Zfp36l2
Name: zinc finger protein 36, C3H type-like 2
Synonyms: Tis11d, Brf2, ERF2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12193
HGNC: HGNC:1108
Homologene: 5027
Or52b4
Name: olfactory receptor family 52 subfamily B member 4
Synonyms: GA_x6K02T2PBJ9-5256044-5256988, MOR31-4, Olfr547
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259083
Homologene: 17493
Or14c41
Name: olfactory receptor family 14 subfamily C member 41
Synonyms: GA_x6K02T2NHDJ-9539243-9538314, Olfr295, MOR220-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258850
Homologene: 115526
Apol11b
Name: apolipoprotein L 11b
Synonyms: A330102K04Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 328563
Homologene: 129975
Ptrh1
Name: peptidyl-tRNA hydrolase 1 homolog
Synonyms: 2210013M04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329384
Homologene: 6135
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 20,523,770 bp
  • A to C, chromosome 1 at 75,131,748 bp
  • A to C, chromosome 1 at 105,589,266 bp
  • T to C, chromosome 1 at 136,625,512 bp
  • G to A, chromosome 2 at 32,776,745 bp
  • G to T, chromosome 2 at 91,260,434 bp
  • C to T, chromosome 2 at 140,661,165 bp
  • T to C, chromosome 2 at 155,277,015 bp
  • T to C, chromosome 3 at 103,040,514 bp
  • A to G, chromosome 4 at 53,017,066 bp
  • G to T, chromosome 4 at 57,265,012 bp
  • G to A, chromosome 4 at 126,323,196 bp
  • G to A, chromosome 5 at 36,602,634 bp
  • A to T, chromosome 5 at 39,614,521 bp
  • A to G, chromosome 5 at 117,106,662 bp
  • C to T, chromosome 5 at 138,125,097 bp
  • A to G, chromosome 6 at 43,153,887 bp
  • A to T, chromosome 6 at 78,427,403 bp
  • A to C, chromosome 6 at 101,377,844 bp
  • T to A, chromosome 6 at 134,921,243 bp
  • T to C, chromosome 7 at 27,808,292 bp
  • A to G, chromosome 7 at 86,585,277 bp
  • T to C, chromosome 7 at 102,534,932 bp
  • T to C, chromosome 7 at 141,751,414 bp
  • A to T, chromosome 7 at 141,862,166 bp
  • A to G, chromosome 7 at 141,867,619 bp
  • A to T, chromosome 7 at 143,799,812 bp
  • G to T, chromosome 8 at 10,370,963 bp
  • G to T, chromosome 8 at 45,241,500 bp
  • A to G, chromosome 8 at 81,997,390 bp
  • G to A, chromosome 8 at 84,915,569 bp
  • G to A, chromosome 8 at 88,314,137 bp
  • AGTGGTGGTGGTGGTGGTGGTGG to AGTGGTGGTGGTGGTGGTGG, chromosome 8 at 89,033,058 bp
  • T to A, chromosome 9 at 44,628,693 bp
  • T to A, chromosome 9 at 59,827,258 bp
  • T to C, chromosome 9 at 103,332,751 bp
  • A to G, chromosome 9 at 121,798,909 bp
  • A to G, chromosome 10 at 100,523,360 bp
  • A to G, chromosome 11 at 58,390,334 bp
  • G to A, chromosome 11 at 72,401,399 bp
  • A to T, chromosome 11 at 97,241,997 bp
  • A to T, chromosome 11 at 115,185,106 bp
  • C to T, chromosome 12 at 44,562,432 bp
  • T to A, chromosome 12 at 86,057,847 bp
  • T to C, chromosome 12 at 86,883,593 bp
  • A to T, chromosome 12 at 113,896,521 bp
  • T to G, chromosome 13 at 23,099,169 bp
  • A to G, chromosome 14 at 40,913,415 bp
  • A to G, chromosome 15 at 8,334,906 bp
  • A to G, chromosome 15 at 47,629,260 bp
  • T to C, chromosome 15 at 66,632,903 bp
  • A to C, chromosome 15 at 77,638,000 bp
  • A to G, chromosome 16 at 20,400,012 bp
  • ATCTTCT to ATCT, chromosome 17 at 23,359,988 bp
  • T to A, chromosome 17 at 27,111,200 bp
  • T to C, chromosome 17 at 35,660,440 bp
  • T to C, chromosome 17 at 37,280,373 bp
  • T to A, chromosome 17 at 42,377,360 bp
  • T to C, chromosome 17 at 84,186,552 bp
  • T to A, chromosome 18 at 49,863,015 bp
  • C to A, chromosome 19 at 41,868,778 bp
  • G to C, chromosome X at 7,823,909 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6213 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044346-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.