Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6255Btlr/Mmmh
Stock Number:
044372-MU
Citation ID:
RRID:MMRRC_044372-MU
Other Names:
R6255 (G1)
Major Collection:

Strain Information

Kitl
Name: kit ligand
Synonyms: SF, stem cell factor, Steel factor, SLF, Mgf, Sl, Gb, grizzle-belly, Steel, SCF, Kitlg, blz
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17311
HGNC: HGNC:6343
Homologene: 692
Pkn2
Name: protein kinase N2
Synonyms: PRK2, 6030436C20Rik, Stk7, Prkcl2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109333
HGNC: HGNC:9406
Homologene: 2054
Ppfibp2
Name: PTPRF interacting protein, binding protein 2 (liprin beta 2)
Synonyms: liprin beta 2, Cclp1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19024
HGNC: HGNC:9250
Homologene: 7486
Ctdp1
Name: CTD phosphatase subunit 1
Synonyms: 4930563P03Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67655
HGNC: HGNC:2498
Homologene: 31254
Rif1
Name: replication timing regulatory factor 1
Synonyms: 5730435J01Rik, 6530403D07Rik, D2Ertd145e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 51869
Homologene: 41231
4833420G17Rik
Name: RIKEN cDNA 4833420G17 gene
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67392
VEGA: 13
Homologene: 18889
Aen
Name: apoptosis enhancing nuclease
Synonyms: 2700083B06Rik, Isg20l1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68048
Homologene: 23382
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 93,019,983 bp
  • A to G, chromosome 1 at 131,763,909 bp
  • A to T, chromosome 1 at 139,753,011 bp
  • A to T, chromosome 2 at 11,748,446 bp
  • A to G, chromosome 2 at 52,085,053 bp
  • A to T, chromosome 2 at 60,605,276 bp
  • T to A, chromosome 2 at 87,489,663 bp
  • A to G, chromosome 2 at 129,208,004 bp
  • AACGGACCCGTTCTTGTGGCTATGCA to AA, chromosome 2 at 139,746,042 bp
  • T to C, chromosome 2 at 153,810,268 bp
  • T to A, chromosome 2 at 154,309,364 bp
  • T to C, chromosome 2 at 174,646,421 bp
  • C to A, chromosome 3 at 82,903,505 bp
  • T to C, chromosome 3 at 142,811,599 bp
  • T to A, chromosome 4 at 59,957,890 bp
  • T to C, chromosome 4 at 99,829,390 bp
  • T to C, chromosome 4 at 115,574,920 bp
  • T to C, chromosome 4 at 138,578,672 bp
  • T to A, chromosome 4 at 145,537,789 bp
  • G to A, chromosome 5 at 86,164,765 bp
  • A to G, chromosome 5 at 120,771,230 bp
  • G to A, chromosome 5 at 143,959,746 bp
  • G to A, chromosome 6 at 22,138,715 bp
  • A to G, chromosome 6 at 120,758,050 bp
  • A to G, chromosome 6 at 148,877,892 bp
  • T to C, chromosome 7 at 45,553,802 bp
  • T to A, chromosome 7 at 78,905,844 bp
  • T to C, chromosome 7 at 85,952,451 bp
  • T to C, chromosome 7 at 107,681,762 bp
  • T to C, chromosome 7 at 118,691,781 bp
  • C to A, chromosome 7 at 122,173,272 bp
  • G to T, chromosome 8 at 72,470,881 bp
  • T to C, chromosome 9 at 18,655,599 bp
  • A to G, chromosome 9 at 107,592,091 bp
  • T to C, chromosome 9 at 110,517,834 bp
  • T to C, chromosome 9 at 111,352,246 bp
  • T to C, chromosome 10 at 100,089,233 bp
  • A to G, chromosome 10 at 129,437,688 bp
  • G to A, chromosome 11 at 72,401,399 bp
  • T to C, chromosome 11 at 115,998,137 bp
  • T to A, chromosome 11 at 120,444,542 bp
  • T to A, chromosome 12 at 33,053,475 bp
  • T to A, chromosome 12 at 72,487,023 bp
  • T to C, chromosome 13 at 53,110,542 bp
  • T to A, chromosome 13 at 119,466,123 bp
  • G to A, chromosome 15 at 89,067,618 bp
  • G to A, chromosome 17 at 45,514,609 bp
  • C to A, chromosome 17 at 73,805,413 bp
  • A to G, chromosome 17 at 78,803,434 bp
  • G to A, chromosome 18 at 37,490,484 bp
  • T to C, chromosome 18 at 63,121,270 bp
  • T to A, chromosome 18 at 80,459,297 bp
  • G to A, chromosome 19 at 4,986,375 bp
  • C to A, chromosome 19 at 9,008,025 bp
  • C to A, chromosome 19 at 11,977,953 bp
  • T to C, chromosome 19 at 39,018,667 bp
  • C to T, chromosome 19 at 40,580,043 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6255 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044372-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.