Strain Name:
Stock Number:
Citation ID:
Other Names:
R6255 (G1)
Major Collection:

Gene Information

Name: kit ligand
Synonyms: SF, stem cell factor, Steel factor, SLF, Mgf, Sl, Gb, grizzle-belly, Steel, SCF, blz, Kitlg
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 17311
Homologene: 692
Name: protein kinase N2
Synonyms: PRK2, 6030436C20Rik, Stk7, Prkcl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 109333
Homologene: 2054
Name: PTPRF interacting protein, binding protein 2 (liprin beta 2)
Synonyms: liprin beta 2, Cclp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 19024
Homologene: 7486
Name: CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1
Synonyms: 4930563P03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 67655
Homologene: 31254
Name: replication timing regulatory factor 1
Synonyms: 5730435J01Rik, 6530403D07Rik, D2Ertd145e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 51869
Homologene: 41231
Name: RIKEN cDNA 4833420G17 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 67392
VEGA: 13
Homologene: 18889
Name: apoptosis enhancing nuclease
Synonyms: 2700083B06Rik, Isg20l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 68048
Homologene: 23382
Name: smoothelin-like 2
Synonyms: D130058I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 276829
Homologene: 82367
Name: neuronal PAS domain protein 4
Synonyms: LE-PAS, Nxf, Npas4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 225872
VEGA: 19
Homologene: 15333
Name: ubiquitin-like modifier activating enzyme 6
Synonyms: 5730469D23Rik, Ube1l2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231380
Homologene: 10080
Name: CECR2, histone acetyl-lysine reader
Synonyms: 2810409N01Rik, 2610101O16Rik, Gtl4, cat eye syndrome chromosome region, candidate 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 330409
Homologene: 64662
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 73732
Homologene: 141193
Name: oxysterol binding protein
Synonyms: 1110018F06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 76303
VEGA: 19
Homologene: 97668
Name: interferon-related developmental regulator 2
Synonyms: SKMc15, 1810034A24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 15983
Homologene: 21341
Name: HEAT repeat containing 5B
Synonyms: D330050P16Rik, 2010013B10Rik, A230048G03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 320473
VEGA: 17
Homologene: 25536
Name: caprin family member 2
Synonyms: Eeg1, C1qdc1, RNG140
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232560
Homologene: 11393
Name: protocadherin beta 18
Synonyms: Pcdhb9, PcdhbR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93889
Homologene: 137649
Name: endoplasmic reticulum (ER) to nucleus signalling 2
Synonyms: Ire1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 26918
Homologene: 22687
Name: piezo-type mechanosensitive ion channel component 2
Synonyms: 9430028L06Rik, 9030411M15Rik, Fam38b2, Piezo2, Fam38b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 667742
Homologene: 49695
Name: zinc finger protein 831
Synonyms: ENSMUSG00000050600, OTTMUSG00000017459
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 100043757
Homologene: 19013
Name: zinc finger protein 990
Synonyms: Gm13225
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 101056073
Name: integrin beta 4
Synonyms: CD104
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 192897
Homologene: 179
Name: cadherin-related family member 3
Synonyms: 1110049B09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 68764
VEGA: 12
Homologene: 45146
Name: EF-hand calcium binding domain 7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230500
Homologene: 19952
Name: kinesin family member 1A
Synonyms: Kns1, ATSV, N-3 kinesin, LOC381283, C630002N23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16560
Homologene: 99729
Name: kinesin family member 9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 16578
Homologene: 65620
Name: tetratricopeptide repeat and ankyrin repeat containing 1
Synonyms: A230061D21Rik, LOC235639, C030048J01Rik, Lba1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 320429
Homologene: 45845
Name: solute carrier family 20, member 1
Synonyms: Glvr-1, Glvr1, PiT-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20515
Homologene: 38049
Name: cadherin-like and PC-esterase domain containing 1
Synonyms: A430107O13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 214642
Homologene: 57014
Name: AHNAK nucleoprotein (desmoyokin)
Synonyms: DY6, 2310047C17Rik, 1110004P15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 66395
VEGA: 19
Homologene: 67425
Name: 2'-5' oligoadenylate synthetase 3
Synonyms: 2'-5' oligoadenylate synthetase-like 10, Oasl10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 246727
Homologene: 4510
Name: receptor tyrosine kinase-like orphan receptor 2
Synonyms: Ntrkr2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 26564
Homologene: 55831
Name: olfactory receptor family 6 subfamily C member 1B
Synonyms: GA_x6K02T2PULF-11116958-11117896, MOR111-5, Olfr786
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 258542
Homologene: 133582
Name: pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4
Synonyms: PEPP1, 2410005C22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 69217
Homologene: 10848
Name: von Willebrand factor A domain containing 5B1
Synonyms: 4931403E03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 75718
Homologene: 19431
Name: vomeronasal 2, receptor 74
Synonyms: EG546980
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 546980
Homologene: 115466
Name: glycerophosphodiester phosphodiesterase 1
Synonyms: 1200003M13Rik, MIR16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 56209
Homologene: 41149
Name: complement factor H-related 4
Synonyms: Gm4788
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 214403
Name: radial spoke head 10 homolog B (Chlamydomonas)
Synonyms: 4930526H21Rik, Rsph10b2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Homologene: 18321
Name: leucine rich repeat containing 9
Synonyms: 4930432K16Rik, 4921529O18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 78257
Homologene: 12692
Name: isthmin 1, angiogenesis inhibitor
Synonyms: 5430433G21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 319909
Homologene: 19061
Name: BPI fold containing family B, member 9B
Synonyms: OTTMUSG00000015915, 5430413K10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 433492
Homologene: 128535
Name: alanyl-tRNA synthetase 2, mitochondrial
Synonyms: Aarsl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224805
VEGA: 17
Homologene: 56897
Name: aldehyde dehydrogenase 18 family, member A1
Synonyms: 2810433K04Rik, Pycs
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 56454
Homologene: 2142
Name: cytochrome P450, family 2, subfamily c, polypeptide 55
Synonyms: 2010318C06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 72082
Homologene: 133567
Name: integrin beta 6
Synonyms: 4831415H04Rik, 2210409C20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16420
Homologene: 685
Name: F-box DNA helicase 1
Synonyms: Fbx18, Fbxo18
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 50755
Homologene: 9272
Name: cytochrome P450, family 4, subfamily a, polypeptide 31
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 666168
Homologene: 128044
Name: tetraspanin 10
Synonyms: Ocsp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 208634
Homologene: 49972
Name: calcium homeostasis endoplasmic reticulum protein
Synonyms: 5730408I11Rik, SCAF6, DAN16, D8Wsu96e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 27967
Homologene: 4656
Name: pannexin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 406218
Homologene: 14155
Name: EH-domain containing 3
Synonyms: Ehd2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 57440
Homologene: 81837
Name: solute carrier family 26, member 9
Synonyms: anion transporter/exchanger-9, E030002L01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 320718
Homologene: 14179
Name: major urinary protein 4
Synonyms: Mup-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 17843
Homologene: 74304
Name: lecithin-retinol acyltransferase (phosphatidylcholine-retinol-O-acyltransferase)
Synonyms: 1300010A18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 79235
Homologene: 3483
Name: EF-hand calcium binding domain 8
Synonyms: EG329541
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 100504221
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 93,019,983 bp
  • A to G, chromosome 1 at 131,763,909 bp
  • A to T, chromosome 1 at 139,753,011 bp
  • A to T, chromosome 2 at 11,748,446 bp
  • A to G, chromosome 2 at 52,085,053 bp
  • A to T, chromosome 2 at 60,605,276 bp
  • T to A, chromosome 2 at 87,489,663 bp
  • A to G, chromosome 2 at 129,208,004 bp
  • AACGGACCCGTTCTTGTGGCTATGCA to AA, chromosome 2 at 139,746,042 bp
  • T to C, chromosome 2 at 153,810,268 bp
  • T to A, chromosome 2 at 154,309,364 bp
  • T to C, chromosome 2 at 174,646,421 bp
  • C to A, chromosome 3 at 82,903,505 bp
  • T to C, chromosome 3 at 142,811,599 bp
  • T to A, chromosome 4 at 59,957,890 bp
  • T to C, chromosome 4 at 99,829,390 bp
  • T to C, chromosome 4 at 115,574,920 bp
  • T to C, chromosome 4 at 138,578,672 bp
  • T to A, chromosome 4 at 145,537,789 bp
  • G to A, chromosome 5 at 86,164,765 bp
  • A to G, chromosome 5 at 120,771,230 bp
  • G to A, chromosome 5 at 143,959,746 bp
  • G to A, chromosome 6 at 22,138,715 bp
  • A to G, chromosome 6 at 120,758,050 bp
  • A to G, chromosome 6 at 148,877,892 bp
  • T to C, chromosome 7 at 45,553,802 bp
  • T to A, chromosome 7 at 78,905,844 bp
  • T to C, chromosome 7 at 85,952,451 bp
  • T to C, chromosome 7 at 107,681,762 bp
  • T to C, chromosome 7 at 118,691,781 bp
  • C to A, chromosome 7 at 122,173,272 bp
  • G to T, chromosome 8 at 72,470,881 bp
  • T to C, chromosome 9 at 18,655,599 bp
  • A to G, chromosome 9 at 107,592,091 bp
  • T to C, chromosome 9 at 110,517,834 bp
  • T to C, chromosome 9 at 111,352,246 bp
  • T to C, chromosome 10 at 100,089,233 bp
  • A to G, chromosome 10 at 129,437,688 bp
  • G to A, chromosome 11 at 72,401,399 bp
  • T to C, chromosome 11 at 115,998,137 bp
  • T to A, chromosome 11 at 120,444,542 bp
  • T to A, chromosome 12 at 33,053,475 bp
  • T to A, chromosome 12 at 72,487,023 bp
  • T to C, chromosome 13 at 53,110,542 bp
  • T to A, chromosome 13 at 119,466,123 bp
  • G to A, chromosome 15 at 89,067,618 bp
  • G to A, chromosome 17 at 45,514,609 bp
  • C to A, chromosome 17 at 73,805,413 bp
  • A to G, chromosome 17 at 78,803,434 bp
  • G to A, chromosome 18 at 37,490,484 bp
  • T to C, chromosome 18 at 63,121,270 bp
  • T to A, chromosome 18 at 80,459,297 bp
  • G to A, chromosome 19 at 4,986,375 bp
  • C to A, chromosome 19 at 9,008,025 bp
  • C to A, chromosome 19 at 11,977,953 bp
  • T to C, chromosome 19 at 39,018,667 bp
  • C to T, chromosome 19 at 40,580,043 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6255 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044372-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.