Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6255Btlr/Mmmh
Stock Number:
044372-MU
Citation ID:
RRID:MMRRC_044372-MU
Other Names:
R6255 (G1)
Major Collection:

Strain Information

Kitl
Name: kit ligand
Synonyms: SF, stem cell factor, Steel factor, SLF, Mgf, Sl, Gb, grizzle-belly, Steel, SCF, Kitlg, blz
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17311
HGNC: HGNC:6343
Homologene: 692
Pkn2
Name: protein kinase N2
Synonyms: PRK2, 6030436C20Rik, Stk7, Prkcl2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109333
HGNC: HGNC:9406
Homologene: 2054
Ppfibp2
Name: PTPRF interacting protein, binding protein 2 (liprin beta 2)
Synonyms: liprin beta 2, Cclp1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19024
HGNC: HGNC:9250
Homologene: 7486
Ctdp1
Name: CTD phosphatase subunit 1
Synonyms: 4930563P03Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67655
HGNC: HGNC:2498
Homologene: 31254
Rif1
Name: replication timing regulatory factor 1
Synonyms: 5730435J01Rik, 6530403D07Rik, D2Ertd145e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 51869
Homologene: 41231
4833420G17Rik
Name: RIKEN cDNA 4833420G17 gene
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67392
VEGA: 13
Homologene: 18889
Aen
Name: apoptosis enhancing nuclease
Synonyms: 2700083B06Rik, Isg20l1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68048
Homologene: 23382
Smtnl2
Name: smoothelin-like 2
Synonyms: D130058I21Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 276829
Homologene: 82367
Npas4
Name: neuronal PAS domain protein 4
Synonyms: LE-PAS, Nxf, Npas4
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225872
VEGA: 19
Homologene: 15333
Uba6
Name: ubiquitin-like modifier activating enzyme 6
Synonyms: 5730469D23Rik, Ube1l2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231380
Homologene: 10080
Cecr2
Name: CECR2, histone acetyl-lysine reader
Synonyms: 2810409N01Rik, 2610101O16Rik, Gtl4, cat eye syndrome chromosome region, candidate 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330409
HGNC: HGNC:1840
Homologene: 64662
Muc16
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Osbp
Name: oxysterol binding protein
Synonyms: 1110018F06Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 76303
VEGA: 19
HGNC: HGNC:8503
Homologene: 97668
Ifrd2
Name: interferon-related developmental regulator 2
Synonyms: SKMc15, 1810034A24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15983
HGNC: HGNC:5457
Homologene: 21341
Heatr5b
Name: HEAT repeat containing 5B
Synonyms: D330050P16Rik, 2010013B10Rik, A230048G03Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 320473
VEGA: 17
Homologene: 25536
Caprin2
Name: caprin family member 2
Synonyms: Eeg1, C1qdc1, RNG140
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232560
Homologene: 11393
Pcdhb18
Name: protocadherin beta 18
Synonyms: Pcdhb9, PcdhbR
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93889
Homologene: 137649
Ern2
Name: endoplasmic reticulum to nucleus signalling 2
Synonyms: Ire1b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26918
Homologene: 22687
Piezo2
Name: piezo-type mechanosensitive ion channel component 2
Synonyms: 9430028L06Rik, 9030411M15Rik, Fam38b2, Piezo2, Fam38b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 667742
Homologene: 49695
Zfp831
Name: zinc finger protein 831
Synonyms: ENSMUSG00000050600, OTTMUSG00000017459
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 100043757
Homologene: 19013
Zfp990
Name: zinc finger protein 990
Synonyms: Gm13225
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 101056073
Itgb4
Name: integrin beta 4
Synonyms: CD104
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192897
HGNC: HGNC:6158
Homologene: 179
Cdhr3
Name: cadherin-related family member 3
Synonyms: 1110049B09Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68764
VEGA: 12
Homologene: 45146
Efcab7
Name: EF-hand calcium binding domain 7
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230500
Homologene: 19952
Kif1a
Name: kinesin family member 1A
Synonyms: Kns1, ATSV, N-3 kinesin, LOC381283, C630002N23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16560
HGNC: HGNC:888
Homologene: 99729
Trank1
Name: tetratricopeptide repeat and ankyrin repeat containing 1
Synonyms: A230061D21Rik, LOC235639, C030048J01Rik, Lba1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320429
Homologene: 45845
Slc20a1
Name: solute carrier family 20, member 1
Synonyms: Glvr-1, Glvr1, PiT-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20515
Homologene: 38049
Cped1
Name: cadherin-like and PC-esterase domain containing 1
Synonyms: A430107O13Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 214642
Homologene: 57014
Ahnak
Name: AHNAK nucleoprotein
Synonyms: DY6, 2310047C17Rik, 1110004P15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66395
VEGA: 19
HGNC: HGNC:347
Homologene: 67425
Oas3
Name: 2'-5' oligoadenylate synthetase 3
Synonyms: 2'-5' oligoadenylate synthetase-like 10, Oasl10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 246727
HGNC: HGNC:8088
Homologene: 4510
Ror2
Name: receptor tyrosine kinase-like orphan receptor 2
Synonyms: Ntrkr2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 26564
Homologene: 55831
Or6c1b
Name: olfactory receptor family 6 subfamily C member 1B
Synonyms: GA_x6K02T2PULF-11116958-11117896, MOR111-5, Olfr786
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258542
HGNC: HGNC:8355
Homologene: 133582
Plekha4
Name: pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4
Synonyms: PEPP1, 2410005C22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69217
Homologene: 10848
Vwa5b1
Name: von Willebrand factor A domain containing 5B1
Synonyms: 4931403E03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75718
Homologene: 19431
Vmn2r74
Name: vomeronasal 2, receptor 74
Synonyms: EG546980
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 546980
Homologene: 115466
Gde1
Name: glycerophosphodiester phosphodiesterase 1
Synonyms: 1200003M13Rik, MIR16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56209
Homologene: 41149
Cfhr4
Name: complement factor H-related 4
Synonyms: Gm4788
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 214403
HGNC: HGNC:4883
Rsph10b
Name: radial spoke head 10 homolog B (Chlamydomonas)
Synonyms: 4930526H21Rik, Rsph10b2
Type: Gene
Species: Mouse
Chromosome: 5
Homologene: 18321
Lrrc9
Name: leucine rich repeat containing 9
Synonyms: 4930432K16Rik, 4921529O18Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 78257
Homologene: 12692
Ism1
Name: isthmin 1, angiogenesis inhibitor
Synonyms: 5430433G21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 319909
Homologene: 19061
Bpifb9b
Name: BPI fold containing family B, member 9B
Synonyms: OTTMUSG00000015915, 5430413K10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 433492
Homologene: 128535
Aars2
Name: alanyl-tRNA synthetase 2, mitochondrial
Synonyms: Aarsl
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224805
VEGA: 17
Homologene: 56897
Aldh18a1
Name: aldehyde dehydrogenase 18 family, member A1
Synonyms: 2810433K04Rik, Pycs
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 56454
HGNC: HGNC:9722
Homologene: 2142
Cyp2c55
Name: cytochrome P450, family 2, subfamily c, polypeptide 55
Synonyms: 2010318C06Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 72082
HGNC: HGNC:2620
Homologene: 133567
Itgb6
Name: integrin beta 6
Synonyms: 4831415H04Rik, 2210409C20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16420
HGNC: HGNC:6161
Homologene: 685
Fbh1
Name: F-box DNA helicase 1
Synonyms: Fbx18, Fbxo18
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 50755
Homologene: 9272
Cyp4a31
Name: cytochrome P450, family 4, subfamily a, polypeptide 31
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 666168
Homologene: 128044
Tspan10
Name: tetraspanin 10
Synonyms: Ocsp
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 208634
Homologene: 49972
Cherp
Name: calcium homeostasis endoplasmic reticulum protein
Synonyms: 5730408I11Rik, SCAF6, DAN16, D8Wsu96e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 27967
Homologene: 4656
Ehd3
Name: EH-domain containing 3
Synonyms: Ehd2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 57440
HGNC: HGNC:3244
Homologene: 81837
Slc26a9
Name: solute carrier family 26, member 9
Synonyms: anion transporter/exchanger-9, E030002L01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320718
Homologene: 14179
Mup4
Name: major urinary protein 4
Synonyms: Mup-4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17843
Homologene: 74304
Lrat
Name: lecithin-retinol acyltransferase (phosphatidylcholine-retinol-O-acyltransferase)
Synonyms: 1300010A18Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 79235
HGNC: HGNC:6685
Homologene: 3483
Efcab8
Name: EF-hand calcium binding domain 8
Synonyms: EG329541
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 100504221
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 93,019,983 bp
  • A to G, chromosome 1 at 131,763,909 bp
  • A to T, chromosome 1 at 139,753,011 bp
  • A to T, chromosome 2 at 11,748,446 bp
  • A to G, chromosome 2 at 52,085,053 bp
  • A to T, chromosome 2 at 60,605,276 bp
  • T to A, chromosome 2 at 87,489,663 bp
  • A to G, chromosome 2 at 129,208,004 bp
  • AACGGACCCGTTCTTGTGGCTATGCA to AA, chromosome 2 at 139,746,042 bp
  • T to C, chromosome 2 at 153,810,268 bp
  • T to A, chromosome 2 at 154,309,364 bp
  • T to C, chromosome 2 at 174,646,421 bp
  • C to A, chromosome 3 at 82,903,505 bp
  • T to C, chromosome 3 at 142,811,599 bp
  • T to A, chromosome 4 at 59,957,890 bp
  • T to C, chromosome 4 at 99,829,390 bp
  • T to C, chromosome 4 at 115,574,920 bp
  • T to C, chromosome 4 at 138,578,672 bp
  • T to A, chromosome 4 at 145,537,789 bp
  • G to A, chromosome 5 at 86,164,765 bp
  • A to G, chromosome 5 at 120,771,230 bp
  • G to A, chromosome 5 at 143,959,746 bp
  • G to A, chromosome 6 at 22,138,715 bp
  • A to G, chromosome 6 at 120,758,050 bp
  • A to G, chromosome 6 at 148,877,892 bp
  • T to C, chromosome 7 at 45,553,802 bp
  • T to A, chromosome 7 at 78,905,844 bp
  • T to C, chromosome 7 at 85,952,451 bp
  • T to C, chromosome 7 at 107,681,762 bp
  • T to C, chromosome 7 at 118,691,781 bp
  • C to A, chromosome 7 at 122,173,272 bp
  • G to T, chromosome 8 at 72,470,881 bp
  • T to C, chromosome 9 at 18,655,599 bp
  • A to G, chromosome 9 at 107,592,091 bp
  • T to C, chromosome 9 at 110,517,834 bp
  • T to C, chromosome 9 at 111,352,246 bp
  • T to C, chromosome 10 at 100,089,233 bp
  • A to G, chromosome 10 at 129,437,688 bp
  • G to A, chromosome 11 at 72,401,399 bp
  • T to C, chromosome 11 at 115,998,137 bp
  • T to A, chromosome 11 at 120,444,542 bp
  • T to A, chromosome 12 at 33,053,475 bp
  • T to A, chromosome 12 at 72,487,023 bp
  • T to C, chromosome 13 at 53,110,542 bp
  • T to A, chromosome 13 at 119,466,123 bp
  • G to A, chromosome 15 at 89,067,618 bp
  • G to A, chromosome 17 at 45,514,609 bp
  • C to A, chromosome 17 at 73,805,413 bp
  • A to G, chromosome 17 at 78,803,434 bp
  • G to A, chromosome 18 at 37,490,484 bp
  • T to C, chromosome 18 at 63,121,270 bp
  • T to A, chromosome 18 at 80,459,297 bp
  • G to A, chromosome 19 at 4,986,375 bp
  • C to A, chromosome 19 at 9,008,025 bp
  • C to A, chromosome 19 at 11,977,953 bp
  • T to C, chromosome 19 at 39,018,667 bp
  • C to T, chromosome 19 at 40,580,043 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6255 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044372-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.