Strain Name:
C57BL/6J-MtgxR5396Btlr
Stock Number:
044394-MU
Citation ID:
RRID:MMRRC_044394-MU
Other Names:
R5396 (G1)
Major Collection:

Gene Information

Vps33a
Name: VPS33A CORVET/HOPS core subunit
Synonyms: 3830421M04Rik, bf
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 77573
Homologene: 11294
Kmt2c
Name: lysine (K)-specific methyltransferase 2C
Synonyms: Mll3, E330008K23Rik, HALR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231051
Homologene: 46480
Ank2
Name: ankyrin 2, brain
Synonyms: Ank-2, ankyrin B, Gm4392, Ankyrin-2, Ankyrin-B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Tert
Name: telomerase reverse transcriptase
Synonyms: TR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 21752
VEGA: 13
Homologene: 31141
Lars
Name: leucyl-tRNA synthetase
Synonyms: 2310045K21Rik, 3110009L02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 107045
VEGA: 18
HGNC: HGNC:6512
Homologene: 7083
Kdm5b
Name: lysine (K)-specific demethylase 5B
Synonyms: PLU-1, Plu1, Rb-Bp2, Jarid1b, 2210016I17Rik, D1Ertd202e, 2010009J12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 75605
Homologene: 48448
Ahcyl2
Name: S-adenosylhomocysteine hydrolase-like 2
Synonyms: 4631427C17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 74340
Homologene: 69337
Tmem63b
Name: transmembrane protein 63b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224807
Homologene: 101682
Etv4
Name: ets variant 4
Synonyms: Pea3, Pea-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 18612
HGNC: HGNC:3493
Homologene: 1504
Elavl2
Name: ELAV like RNA binding protein 1
Synonyms: mel-N1, Hub
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 15569
HGNC: HGNC:3313
Homologene: 20930
Ctnnbl1
Name: catenin, beta like 1
Synonyms: 5730471K09Rik, FLJ21108, NYD-SP19, P14L
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 66642
Homologene: 12003
Erbin
Name: Erbb2 interacting protein
Synonyms: Erbb2ip, Erbin, 1700028E05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 59079
Homologene: 41282
Vapb
Name: vesicle-associated membrane protein, associated protein B and C
Synonyms: VAMP-associated protein 33b, D2Abb2e, VAP33b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 56491
Homologene: 36163
Pds5a
Name: PDS5 cohesin associated factor A
Synonyms: E230024D05Rik, 9030416H16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 71521
Homologene: 22877
Bop1
Name: block of proliferation 1
Synonyms: Erb1p
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 12181
VEGA: 15
Homologene: 6612
Actr1a
Name: ARP1 actin-related protein 1A, centractin alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 54130
VEGA: 19
HGNC: HGNC:167
Homologene: 21173
Znrf1
Name: zinc and ring finger 1
Synonyms: Rnf42, nin283, B830022L21Rik, Zrfp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 170737
Homologene: 41858
Fam45a
Name: family with sequence similarity 45, member A
Synonyms: 1810055E12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 67894
Homologene: 10217
Adra2c
Name: adrenergic receptor, alpha 2c
Synonyms: alpha2C, [a]2C, subtype alpha2-C4, alpha2-C4, Adra-2c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 11553
HGNC: HGNC:283
Homologene: 20170
Ticam1
Name: toll-like receptor adaptor molecule 1
Synonyms: TICAM-1, Trif
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 106759
Homologene: 8605
Vps13b
Name: vacuolar protein sorting 13B
Synonyms: 2310042E16Rik, Coh1, 1810042B05Rik, C330002D13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 666173
VEGA: 15
HGNC: HGNC:2183
Homologene: 49516
Trpv4
Name: transient receptor potential cation channel, subfamily V, member 4
Synonyms: VRL-2, 0610033B08Rik, Trp12, OTRPC4, VROAC, VR-OAC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 63873
Homologene: 11003
Cdc7
Name: cell division cycle 7 (S. cerevisiae)
Synonyms: Cdc7, muCdc7, Cdc7l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 12545
HGNC: HGNC:1745
Homologene: 31166
Ddx3y
Name: DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked
Synonyms: D1Pas1-rs1, Dby, 8030469F12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: Y
NCBI: 26900
HGNC: HGNC:2699
Homologene: 55839
Pes1
Name: pescadillo ribosomal biogenesis factor 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 64934
HGNC: HGNC:8848
Homologene: 5984
Crnkl1
Name: crooked neck pre-mRNA splicing factor 1
Synonyms: crn, 5730590A01Rik, 1200013P10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 66877
Homologene: 6462
Usp33
Name: ubiquitin specific peptidase 33
Synonyms: 9830169D19Rik, Vdu1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 170822
Homologene: 8996
Dusp4
Name: dual specificity phosphatase 4
Synonyms: MKP2, E130306H24Rik, 2700078F24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 319520
HGNC: HGNC:3070
Homologene: 1065
Tstd2
Name: thiosulfate sulfurtransferase (rhodanese)-like domain containing 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 272027
Homologene: 16403
Mfap1b
Name: microfibrillar-associated protein 1B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 100034361
HGNC: HGNC:7032
Homologene: 4332
Wnt5a
Name: wingless-type MMTV integration site family, member 5A
Synonyms: Wnt-5a, 8030457G12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 22418
Homologene: 20720
Slc4a4
Name: solute carrier family 4 (anion exchanger), member 4
Synonyms: NBC1, NBC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 54403
Homologene: 55776
E2f1
Name: E2F transcription factor 1
Synonyms: E2F-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 13555
HGNC: HGNC:3113
Homologene: 3828
Dnhd1
Name: dynein heavy chain domain 1
Synonyms: 8030491N06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 77505
Homologene: 131117
Stat5a
Name: signal transducer and activator of transcription 5A
Synonyms: STAT5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20850
Homologene: 20680
Ttn
Name: titin
Synonyms: mdm, 2310036G12Rik, D830007G01Rik, shru, L56, 2310074I15Rik, 2310057K23Rik, connectin, D330041I19Rik, 1100001C23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Ano4
Name: anoctamin 4
Synonyms: Tmem16d, A330096O15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 320091
Homologene: 66599
Dnah17
Name: dynein, axonemal, heavy chain 17
Synonyms: 2810003K23Rik, LOC382552, Dnahcl1, Dnahc17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 69926
HGNC: HGNC:2946
Homologene: 72102
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241516
Homologene: 110349
9530053A07Rik
Name: RIKEN cDNA 9530053A07 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 319482
Homologene: 130055
Ephb3
Name: Eph receptor B3
Synonyms: MDK5, Sek4, Etk2, Cek10, Tyro6, HEK2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 13845
HGNC: HGNC:3394
Homologene: 20938
Mroh8
Name: maestro heat-like repeat family member 8
Synonyms: 4922505G16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 629499
Homologene: 51864
Zc3h12d
Name: zinc finger CCCH type containing 12D
Synonyms: TFL, D730019B10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237256
VEGA: 10
Homologene: 18225
Cdhr2
Name: cadherin-related family member 2
Synonyms: LOC268663, Pcdh24
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 268663
Homologene: 134510
Spata6
Name: spermatogenesis associated 6
Synonyms: KRP, Hash, 1700062C23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 67946
Homologene: 10410
Ssu2
Name: ssu-2 homolog (C. elegans)
Synonyms: D630042P16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243612
Homologene: 136556
Zbtb38
Name: zinc finger and BTB domain containing 38
Synonyms: A930014K01Rik, Zenon homolog, CIBZ
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 245007
Homologene: 19529
Ahnak
Name: AHNAK nucleoprotein (desmoyokin)
Synonyms: 2310047C17Rik, DY6, 1110004P15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 66395
VEGA: 19
HGNC: HGNC:347
Homologene: 67425
Cd101
Name: CD101 antigen
Synonyms: Igsf2, LOC381460
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 630146
HGNC: HGNC:5949
Homologene: 3142
Pde8a
Name: phosphodiesterase 8A
Synonyms: Pde8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18584
HGNC: HGNC:8793
Homologene: 1957
Gm4787
Name: predicted gene 4787
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 214321
Homologene: 86950
Myo3b
Name: myosin IIIB
Synonyms: A430065P19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 329421
Homologene: 51393
Synpo2
Name: synaptopodin 2
Synonyms: Myo, myopodin, 9530006G20Rik, 2310068J10Rik, 1110069I04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 118449
Homologene: 15400
Sdcbp2
Name: syndecan binding protein (syntenin) 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228765
Homologene: 9240
Celsr3
Name: cadherin, EGF LAG seven-pass G-type receptor 3
Synonyms: Adgrc3, flamingo, Fmi1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 107934
HGNC: HGNC:3230
Homologene: 1077
Sntb1
Name: syntrophin, basic 1
Synonyms: beta1-Syntrophin, 59-1 DAP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 20649
Homologene: 9618
Rad51d
Name: RAD51 paralog D
Synonyms: R51H3, Rad51l3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 19364
HGNC: HGNC:9823
Homologene: 2156
Clca3b
Name: chloride channel accessory 3B
Synonyms: Clca4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229927
Homologene: 135610
Olfr1375
Name: olfactory receptor 1375
Synonyms: GA_x6K02T2QP88-4389999-4389056, Olfr1375-ps1, MOR126-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 258509
Gad1-ps
Name: glutamate decarboxylase 1, pseudogene
Synonyms: Gad-1ps
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 382407
VEGA: 10
Flot2
Name: flotillin 2
Synonyms: reggie-2, Esa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 14252
HGNC: HGNC:3758
Homologene: 3293
Dbndd1
Name: dysbindin (dystrobrevin binding protein 1) domain containing 1
Synonyms: 2810427I04Rik, D8Ertd590e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 72185
Homologene: 11433
Usp31
Name: ubiquitin specific peptidase 31
Synonyms: 6330567E21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 76179
Homologene: 44504
Chrnb1
Name: cholinergic receptor, nicotinic, beta polypeptide 1 (muscle)
Synonyms: Achr-2, Acrb, AChR beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 11443
HGNC: HGNC:1961
Homologene: 594
Akr1b7
Name: aldo-keto reductase family 1, member B7
Synonyms: MVDP, Avdp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 11997
Homologene: 122176
1810024B03Rik
Name: RIKEN cDNA 1810024B03 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 329509
Pcdhb21
Name: protocadherin beta 21
Synonyms: Pcdhb18, PcdhbU
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93892
HGNC: HGNC:8682
Homologene: 134302
Ubash3b
Name: ubiquitin associated and SH3 domain containing, B
Synonyms: TULA-2, 2810457I06Rik, Sts-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 72828
Homologene: 13152
Catsperb
Name: cation channel sperm associated auxiliary subunit beta
Synonyms: 4932415G16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 271036
VEGA: 12
Homologene: 81904
Hnf1b
Name: HNF1 homeobox B
Synonyms: LFB3, Hnf1beta, hepatocyte nuclear factor-1 beta, Tcf2, HNF-1Beta, vHNF1, Tcf-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 21410
Homologene: 396
Defb30
Name: defensin beta 30
Synonyms: 4930449O14Rik, 2410125J01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 73670
Homologene: 86862
Sult1c2
Name: sulfotransferase family, cytosolic, 1C, member 2
Synonyms: 1810008N17Rik, ST1C1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 69083
Homologene: 38201
Ccdc28b
Name: coiled coil domain containing 28B
Synonyms: 1810010N17Rik, 1110002E08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 66264
Homologene: 11509
Olfr1
Name: olfactory receptor 1
Synonyms: I54, MOR135-13, GA_x6K02T2P1NL-3556334-3555390
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 258923
Homologene: 115482
Kyat3
Name: kynurenine aminotransferase 3
Synonyms: Ccbl2, Kat3, KATIII
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229905
Homologene: 2994
Inhbe
Name: inhibin beta-E
Synonyms: activin betaE, activin beta-E
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 16326
VEGA: 10
Homologene: 7381
4430402I18Rik
Name: RIKEN cDNA 4430402I18 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 381218
Homologene: 128454
Zfp971
Name: zinc finger protein 971
Synonyms: Etohi1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 626848
Homologene: 134324
Olfr645
Name: olfactory receptor 645
Synonyms: GA_x6K02T2PBJ9-6819097-6818150, MOR13-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258247
Homologene: 66155
Sdc1
Name: syndecan 1
Synonyms: Synd1, CD138, Synd, syn-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 20969
Homologene: 2252
A430005L14Rik
Name: RIKEN cDNA A430005L14 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 97159
Homologene: 18433
Glrp1
Name: glutamine repeat protein 1
Synonyms: GRP-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14659
Chst11
Name: carbohydrate sulfotransferase 11
Synonyms: C4ST, C4ST-1, 1110020P09Rik, chondroitin 4, C4ST1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 58250
Homologene: 56808
Olfr1215
Name: olfactory receptor 1215
Synonyms: MOR233-13, GA_x6K02T2Q125-50482823-50481885
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258451
Homologene: 74071
Btbd19
Name: BTB (POZ) domain containing 19
Synonyms: 9530048O09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 78611
Pcdha8
Name: protocadherin alpha 8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 353235
HGNC: HGNC:8675
Homologene: 129614
Tmem86a
Name: transmembrane protein 86A
Synonyms: 1810054O13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 67893
Homologene: 41679
Anapc15
Name: anaphase promoting complex C subunit 15
Synonyms: 3200002M19Rik, 6330414C15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 75430
Homologene: 87047
Gm43302
Name: predicted gene 43302
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • TTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTG to TTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTG, chromosome 1 at 88,503,344 bp
  • G to A, chromosome 1 at 134,622,098 bp
  • A to T, chromosome 2 at 70,126,985 bp
  • A to T, chromosome 2 at 76,814,371 bp
  • G to A, chromosome 2 at 82,990,918 bp
  • A to T, chromosome 2 at 89,002,196 bp
  • A to T, chromosome 2 at 121,473,890 bp
  • T to C, chromosome 2 at 127,186,953 bp
  • A to G, chromosome 2 at 145,928,212 bp
  • T to A, chromosome 2 at 151,587,137 bp
  • A to T, chromosome 2 at 154,564,448 bp
  • G to A, chromosome 2 at 157,228,656 bp
  • G to A, chromosome 2 at 157,817,832 bp
  • T to A, chromosome 2 at 173,771,543 bp
  • G to A, chromosome 2 at 178,033,733 bp
  • A to G, chromosome 3 at 101,018,810 bp
  • G to A, chromosome 3 at 123,117,682 bp
  • A to G, chromosome 3 at 126,953,226 bp
  • A to G, chromosome 3 at 142,734,606 bp
  • A to G, chromosome 3 at 144,847,171 bp
  • A to G, chromosome 3 at 152,384,187 bp
  • A to G, chromosome 4 at 46,135,542 bp
  • T to C, chromosome 4 at 91,260,818 bp
  • T to C, chromosome 4 at 111,799,118 bp
  • G to A, chromosome 4 at 117,123,760 bp
  • G to T, chromosome 4 at 129,619,445 bp
  • GCC to G, chromosome 4 at 153,960,953 bp
  • A to T, chromosome 5 at 25,294,734 bp
  • A to G, chromosome 5 at 35,280,873 bp
  • A to G, chromosome 5 at 65,638,577 bp
  • G to T, chromosome 5 at 89,046,217 bp
  • A to T, chromosome 5 at 105,280,089 bp
  • A to T, chromosome 5 at 106,969,297 bp
  • G to A, chromosome 5 at 114,623,614 bp
  • A to T, chromosome 5 at 123,558,630 bp
  • C to T, chromosome 6 at 29,859,698 bp
  • G to A, chromosome 6 at 34,412,476 bp
  • T to A, chromosome 6 at 112,380,996 bp
  • T to C, chromosome 7 at 28,140,183 bp
  • T to A, chromosome 7 at 47,053,046 bp
  • T to C, chromosome 7 at 81,333,422 bp
  • C to T, chromosome 7 at 101,898,603 bp
  • T to C, chromosome 7 at 104,084,891 bp
  • A to T, chromosome 7 at 105,713,684 bp
  • A to G, chromosome 7 at 121,667,782 bp
  • G to T, chromosome 8 at 34,817,304 bp
  • T to A, chromosome 8 at 111,619,194 bp
  • C to A, chromosome 8 at 123,509,843 bp
  • A to G, chromosome 9 at 41,043,473 bp
  • A to G, chromosome 9 at 96,687,643 bp
  • C to T, chromosome 9 at 108,828,582 bp
  • G to A, chromosome 10 at 7,866,326 bp
  • C to A, chromosome 10 at 83,191,249 bp
  • T to C, chromosome 10 at 89,112,840 bp
  • G to A, chromosome 10 at 99,445,147 bp
  • T to C, chromosome 10 at 127,350,601 bp
  • CGGAGGAGGAGGAGGAGGAGGAGG to CGGAGGAGGAGGAGGAGGAGG, chromosome 11 at 3,977,719 bp
  • C to T, chromosome 11 at 51,048,470 bp
  • T to A, chromosome 11 at 69,794,153 bp
  • AGCGGTCGTAGGC to AGC, chromosome 11 at 73,395,654 bp
  • T to A, chromosome 11 at 78,049,488 bp
  • A to G, chromosome 11 at 82,890,370 bp
  • A to T, chromosome 11 at 83,856,037 bp
  • T to A, chromosome 11 at 100,880,583 bp
  • A to T, chromosome 11 at 101,775,341 bp
  • C to T, chromosome 11 at 118,127,282 bp
  • A to T, chromosome 12 at 8,791,743 bp
  • G to C, chromosome 12 at 81,377,830 bp
  • A to T, chromosome 12 at 101,594,284 bp
  • A to G, chromosome 13 at 54,736,456 bp
  • G to A, chromosome 13 at 73,639,243 bp
  • A to G, chromosome 13 at 103,857,409 bp
  • T to C, chromosome 14 at 28,522,770 bp
  • A to T, chromosome 14 at 63,036,110 bp
  • G to A, chromosome 15 at 35,886,948 bp
  • C to G, chromosome 15 at 55,642,795 bp
  • A to T, chromosome 15 at 76,455,289 bp
  • T to C, chromosome 16 at 21,219,105 bp
  • T to C, chromosome 17 at 45,669,962 bp
  • T to A, chromosome 17 at 53,836,911 bp
  • G to T, chromosome 17 at 56,271,117 bp
  • T to A, chromosome 18 at 36,993,734 bp
  • G to T, chromosome 18 at 37,515,719 bp
  • T to A, chromosome 18 at 42,216,959 bp
  • T to C, chromosome 19 at 9,007,175 bp
  • T to C, chromosome 19 at 28,927,689 bp
  • T to C, chromosome 19 at 46,395,664 bp
  • T to C, chromosome 19 at 60,834,836 bp
  • A to G, chromosome Y at 1,265,965 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5396 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
044394-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.