Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5396Btlr/Mmmh
Stock Number:
044394-MU
Citation ID:
RRID:MMRRC_044394-MU
Other Names:
R5396 (G1)
Major Collection:

Strain Information

Vps33a
Name: VPS33A CORVET/HOPS core subunit
Synonyms: bf, 3830421M04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77573
Homologene: 11294
Kmt2c
Name: lysine (K)-specific methyltransferase 2C
Synonyms: E330008K23Rik, HALR, Mll3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231051
Homologene: 46480
Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Tert
Name: telomerase reverse transcriptase
Synonyms: TR
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21752
VEGA: 13
Homologene: 31141
Lars1
Name: leucyl-tRNA synthetase 1
Synonyms: 3110009L02Rik, 2310045K21Rik, Lars
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 107045
VEGA: 18
HGNC: HGNC:6512
Homologene: 7083
Kdm5b
Name: lysine demethylase 5B
Synonyms: PLU-1, 2010009J12Rik, Plu1, Rb-Bp2, 2210016I17Rik, D1Ertd202e, Jarid1b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75605
Homologene: 48448
Ahcyl2
Name: S-adenosylhomocysteine hydrolase-like 2
Synonyms: 4631427C17Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74340
Homologene: 69337
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • TTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTG to TTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGCTGGTGCTGTTGGTGCTGCTGGTGCTGCTG, chromosome 1 at 88,503,344 bp
  • G to A, chromosome 1 at 134,622,098 bp
  • A to T, chromosome 2 at 70,126,985 bp
  • A to T, chromosome 2 at 76,814,371 bp
  • G to A, chromosome 2 at 82,990,918 bp
  • A to T, chromosome 2 at 89,002,196 bp
  • A to T, chromosome 2 at 121,473,890 bp
  • T to C, chromosome 2 at 127,186,953 bp
  • A to G, chromosome 2 at 145,928,212 bp
  • T to A, chromosome 2 at 151,587,137 bp
  • A to T, chromosome 2 at 154,564,448 bp
  • G to A, chromosome 2 at 157,228,656 bp
  • G to A, chromosome 2 at 157,817,832 bp
  • T to A, chromosome 2 at 173,771,543 bp
  • G to A, chromosome 2 at 178,033,733 bp
  • A to G, chromosome 3 at 101,018,810 bp
  • G to A, chromosome 3 at 123,117,682 bp
  • A to G, chromosome 3 at 126,953,226 bp
  • A to G, chromosome 3 at 142,734,606 bp
  • A to G, chromosome 3 at 144,847,171 bp
  • A to G, chromosome 3 at 152,384,187 bp
  • A to G, chromosome 4 at 46,135,542 bp
  • T to C, chromosome 4 at 91,260,818 bp
  • T to C, chromosome 4 at 111,799,118 bp
  • G to A, chromosome 4 at 117,123,760 bp
  • G to T, chromosome 4 at 129,619,445 bp
  • GCC to G, chromosome 4 at 153,960,953 bp
  • A to T, chromosome 5 at 25,294,734 bp
  • A to G, chromosome 5 at 35,280,873 bp
  • A to G, chromosome 5 at 65,638,577 bp
  • G to T, chromosome 5 at 89,046,217 bp
  • A to T, chromosome 5 at 105,280,089 bp
  • A to T, chromosome 5 at 106,969,297 bp
  • G to A, chromosome 5 at 114,623,614 bp
  • A to T, chromosome 5 at 123,558,630 bp
  • C to T, chromosome 6 at 29,859,698 bp
  • G to A, chromosome 6 at 34,412,476 bp
  • T to A, chromosome 6 at 112,380,996 bp
  • T to C, chromosome 7 at 28,140,183 bp
  • T to A, chromosome 7 at 47,053,046 bp
  • T to C, chromosome 7 at 81,333,422 bp
  • C to T, chromosome 7 at 101,898,603 bp
  • T to C, chromosome 7 at 104,084,891 bp
  • A to T, chromosome 7 at 105,713,684 bp
  • A to G, chromosome 7 at 121,667,782 bp
  • G to T, chromosome 8 at 34,817,304 bp
  • T to A, chromosome 8 at 111,619,194 bp
  • C to A, chromosome 8 at 123,509,843 bp
  • A to G, chromosome 9 at 41,043,473 bp
  • A to G, chromosome 9 at 96,687,643 bp
  • C to T, chromosome 9 at 108,828,582 bp
  • G to A, chromosome 10 at 7,866,326 bp
  • C to A, chromosome 10 at 83,191,249 bp
  • T to C, chromosome 10 at 89,112,840 bp
  • G to A, chromosome 10 at 99,445,147 bp
  • T to C, chromosome 10 at 127,350,601 bp
  • CGGAGGAGGAGGAGGAGGAGGAGG to CGGAGGAGGAGGAGGAGGAGG, chromosome 11 at 3,977,719 bp
  • C to T, chromosome 11 at 51,048,470 bp
  • T to A, chromosome 11 at 69,794,153 bp
  • AGCGGTCGTAGGC to AGC, chromosome 11 at 73,395,654 bp
  • T to A, chromosome 11 at 78,049,488 bp
  • A to G, chromosome 11 at 82,890,370 bp
  • A to T, chromosome 11 at 83,856,037 bp
  • T to A, chromosome 11 at 100,880,583 bp
  • A to T, chromosome 11 at 101,775,341 bp
  • C to T, chromosome 11 at 118,127,282 bp
  • A to T, chromosome 12 at 8,791,743 bp
  • G to C, chromosome 12 at 81,377,830 bp
  • A to T, chromosome 12 at 101,594,284 bp
  • A to G, chromosome 13 at 54,736,456 bp
  • G to A, chromosome 13 at 73,639,243 bp
  • A to G, chromosome 13 at 103,857,409 bp
  • T to C, chromosome 14 at 28,522,770 bp
  • A to T, chromosome 14 at 63,036,110 bp
  • G to A, chromosome 15 at 35,886,948 bp
  • C to G, chromosome 15 at 55,642,795 bp
  • A to T, chromosome 15 at 76,455,289 bp
  • T to C, chromosome 16 at 21,219,105 bp
  • T to C, chromosome 17 at 45,669,962 bp
  • T to A, chromosome 17 at 53,836,911 bp
  • G to T, chromosome 17 at 56,271,117 bp
  • T to A, chromosome 18 at 36,993,734 bp
  • G to T, chromosome 18 at 37,515,719 bp
  • T to A, chromosome 18 at 42,216,959 bp
  • T to C, chromosome 19 at 9,007,175 bp
  • T to C, chromosome 19 at 28,927,689 bp
  • T to C, chromosome 19 at 46,395,664 bp
  • T to C, chromosome 19 at 60,834,836 bp
  • A to G, chromosome Y at 1,265,965 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5396 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044394-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.