Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6428Btlr/Mmmh
Stock Number:
044421-MU
Citation ID:
RRID:MMRRC_044421-MU
Other Names:
R6428 (G1)
Major Collection:

Strain Information

Prrc2b
Name: proline-rich coiled-coil 2B
Synonyms: 5830434P21Rik, Bat2l
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227723
Homologene: 106649
Setd3
Name: SET domain containing 3
Synonyms: 2610305M23Rik, D12Ertd771e, 2610102I01Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 52690
Homologene: 41748
Hdlbp
Name: high density lipoprotein (HDL) binding protein
Synonyms: D1Ertd101e, 1110005P14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 110611
HGNC: HGNC:4857
Homologene: 38035
Dhx9
Name: DExH-box helicase 9
Synonyms: leukophysin, nuclear DNA helicase II, RNA helicase, Ddx9, NDH II, NDHII, RHA
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13211
HGNC: HGNC:2750
Homologene: 1039
Slc38a10
Name: solute carrier family 38, member 10
Synonyms: 1810073N04Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72055
Homologene: 41556
Ncapd3
Name: non-SMC condensin II complex, subunit D3
Synonyms: 4632407J06Rik, 2810487N22Rik, B130055D15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 78658
VEGA: 9
Homologene: 41021
Zfp318
Name: zinc finger protein 318
Synonyms: TZF, 2610034E08Rik, D530032D06Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 57908
Homologene: 22808
Iws1
Name: IWS1, SUPT6 interacting protein
Synonyms: 1700069O15Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 73473
Homologene: 134421
Lepr
Name: leptin receptor
Synonyms: Obr, leptin receptor gene-related protein, OB-RGRP, LEPROT, obl, obese-like, Modb1, Leprb
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16847
HGNC: HGNC:6554
Homologene: 1731
Hspa13
Name: heat shock protein 70 family, member 13
Synonyms: B230217N24Rik, 60kDa, 1600002I10Rik, Stch
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 110920
Homologene: 5062
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269700
Homologene: 28297
Vmn2r26
Name: vomeronasal 2, receptor 26
Synonyms: V2r1b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56552
Homologene: 135915
Slco1a1
Name: solute carrier organic anion transporter family, member 1a1
Synonyms: Oatp1, Slc21a1, Oatp1a1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28248
Homologene: 137261
Rp1l1
Name: retinitis pigmentosa 1 homolog like 1
Synonyms: Dcdc4, Rp1hl1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 271209
VEGA: 14
Homologene: 105870
Cts6
Name: cathepsin 6
Synonyms: 1600022N02Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 58518
Homologene: 75165
Pasd1
Name: PAS domain containing repressor 1
Synonyms: LOC382221, Gm1141
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 382221
Daam2
Name: dishevelled associated activator of morphogenesis 2
Synonyms: 2310016D11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 76441
VEGA: 17
Homologene: 69186
Klhdc10
Name: kelch domain containing 10
Synonyms: 2410127E18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 76788
Homologene: 15267
Vmn2r106
Name: vomeronasal 2, receptor 106
Synonyms: EG224576
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224576
Homologene: 135824
Glb1l3
Name: galactosidase, beta 1 like 3
Synonyms: 4921509F24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70893
Homologene: 72240
Rasgrf2
Name: RAS protein-specific guanine nucleotide-releasing factor 2
Synonyms: Grf2, 6330417G04Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19418
HGNC: HGNC:9876
Homologene: 2169
Phb2
Name: prohibitin 2
Synonyms: Bap37, Bcap37, REA, repressor of estrogen receptor activity
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12034
Homologene: 5263
Abat
Name: 4-aminobutyrate aminotransferase
Synonyms: 9630038C02Rik, GABA-T
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 268860
HGNC: HGNC:23
Homologene: 542
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 93,431,445 bp
  • C to T, chromosome 1 at 153,456,578 bp
  • A to G, chromosome 2 at 32,226,496 bp
  • C to T, chromosome 4 at 101,780,098 bp
  • A to G, chromosome 5 at 121,350,445 bp
  • T to C, chromosome 6 at 30,439,856 bp
  • A to G, chromosome 6 at 124,026,080 bp
  • A to G, chromosome 6 at 124,715,991 bp
  • A to G, chromosome 6 at 141,925,690 bp
  • T to C, chromosome 9 at 26,859,452 bp
  • A to G, chromosome 9 at 27,052,664 bp
  • T to A, chromosome 11 at 120,105,472 bp
  • T to C, chromosome 12 at 108,113,338 bp
  • T to G, chromosome 13 at 61,196,423 bp
  • T to C, chromosome 13 at 91,987,981 bp
  • T to A, chromosome 14 at 64,032,389 bp
  • C to T, chromosome 16 at 8,602,436 bp
  • A to T, chromosome 16 at 75,757,986 bp
  • C to T, chromosome 17 at 20,268,463 bp
  • C to T, chromosome 17 at 46,399,336 bp
  • C to T, chromosome 17 at 49,469,376 bp
  • A to G, chromosome 18 at 32,086,290 bp
  • CATCTTTACCATCATGTCAAGTATCTTTACCATCATGTCAAGTATCTTTACC to CATCTTTACCATCATGTCAAGTATCTTTACC, chromosome X at 71,939,520 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6428 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044421-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.