Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6572Btlr/Mmmh
Stock Number:
044696-MU
Citation ID:
RRID:MMRRC_044696-MU
Other Names:
R6572 (G1)
Major Collection:

Strain Information

Inpp5d
Name: inositol polyphosphate-5-phosphatase D
Synonyms: SHIP, Src homology 2 domain-containing inositol-5-phosphatase, s-SHIP, SHIP-1, SHIP1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16331
HGNC: HGNC:6079
Homologene: 4046
Psenen
Name: presenilin enhancer gamma secretase subunit
Synonyms: 1700023M09Rik, Pen2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66340
Homologene: 11952
Trpc2
Name: transient receptor potential cation channel, subfamily C, member 2
Synonyms: TRPC2b, TRPC2a, mTrp2, trp2, Trrp2, 3010009O07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22064
Homologene: 135989
Btbd17
Name: BTB domain containing 17
Synonyms: 1500005I02Rik, Tango10a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72014
Homologene: 46324
Kmt2e
Name: lysine (K)-specific methyltransferase 2E
Synonyms: 1810033J14Rik, D230038D11Rik, 9530077A04Rik, Mll5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69188
Homologene: 18822
Spidr
Name: scaffolding protein involved in DNA repair
Synonyms: 2310008H04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224008
VEGA: 16
Homologene: 51693
Smyd1
Name: SET and MYND domain containing 1
Synonyms: Bop, 4632404M21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12180
Homologene: 7645
Phf20l1
Name: PHD finger protein 20-like 1
Synonyms: CGI-72, E130113K22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239510
VEGA: 15
Homologene: 9341
Setx
Name: senataxin
Synonyms: A930037J23Rik, Als4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269254
HGNC: HGNC:445
Homologene: 41003
Ppard
Name: peroxisome proliferator activator receptor delta
Synonyms: Nr1c2, PPARdelta/beta, Pparb, Peroxisome proliferator-activated receptor beta, NUC1, PPAR-delta, Pparb/d
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19015
HGNC: HGNC:9235
Homologene: 4544
Ascc3
Name: activating signal cointegrator 1 complex subunit 3
Synonyms: ASC1p200, B630009I04Rik, Helic1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 77987
VEGA: 10
Homologene: 4973
Ago2
Name: argonaute RISC catalytic subunit 2
Synonyms: argonaute 2, 1110029L17Rik, 2310051F07Rik, Eif2c2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239528
HGNC: HGNC:3263
Homologene: 81825
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Urb1
Name: URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Synonyms: 5730405K23Rik, 4921511H13Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207932
Homologene: 45941
Tshr
Name: thyroid stimulating hormone receptor
Synonyms: hyt, pet, hypothroid
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 22095
Homologene: 315
Ralgps2
Name: Ral GEF with PH domain and SH3 binding motif 2
Synonyms: 1810020P17Rik, 9130014M22Rik, 4921528G01Rik, 2210408F11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 78255
Homologene: 23421
Washc3
Name: WASH complex subunit 3
Synonyms: 5730495F03Rik, 2900091E11Rik, Ccdc53
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67282
Homologene: 9364
Arhgap33
Name: Rho GTPase activating protein 33
Synonyms: Tcgap, Snx26, NOMA-GAP
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233071
Homologene: 76448
Neto2
Name: neuropilin (NRP) and tolloid (TLL)-like 2
Synonyms: 5530601C23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74513
Homologene: 32387
Zfp157
Name: zinc finger protein 157
Synonyms: A630094N24Rik, 2610020C11Rik, Roma
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72154
Homologene: 57009
Eml2
Name: echinoderm microtubule associated protein like 2
Synonyms: 1600029N02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72205
Homologene: 8125
Nipal3
Name: NIPA-like domain containing 3
Synonyms: 9130020G22Rik, Npal3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74552
Homologene: 10722
Usp37
Name: ubiquitin specific peptidase 37
Synonyms: 4932415L06Rik, C330008N13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 319651
Homologene: 10858
Ddit4l
Name: DNA-damage-inducible transcript 4-like
Synonyms: RTP801L, 1700108M02Rik, 1700037B15Rik, REDD2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 73284
Homologene: 12698
Pkd2l2
Name: polycystic kidney disease 2-like 2
Synonyms: Polycystin - L2, TRPP5
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 53871
VEGA: 18
HGNC: HGNC:9012
Homologene: 22812
Wdr89
Name: WD repeat domain 89
Synonyms: 2600001A11Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 72338
Homologene: 43791
Dchs1
Name: dachsous cadherin related 1
Synonyms: C130033F22Rik, 3110041P15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233651
Homologene: 2771
Cpsf1
Name: cleavage and polyadenylation specific factor 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 94230
VEGA: 15
HGNC: HGNC:2324
Homologene: 40865
Or1e35
Name: olfactory receptor family 1 subfamily E member 35
Synonyms: GA_x6K02T2P1NL-4062605-4061667, MOR135-10, Olfr395
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259007
Gstt4
Name: glutathione S-transferase, theta 4
Synonyms: 4930583C14Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75886
Homologene: 57104
Dock3
Name: dedicator of cyto-kinesis 3
Synonyms: PBP, Moca
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208869
HGNC: HGNC:2989
Homologene: 21030
Adamts3
Name: ADAM metallopeptidase with thrombospondin type 1 motif 3
Synonyms: 6330442E02Rik, 1100001H14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330119
HGNC: HGNC:219
Homologene: 8596
Ahnak
Name: AHNAK nucleoprotein
Synonyms: DY6, 2310047C17Rik, 1110004P15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66395
VEGA: 19
HGNC: HGNC:347
Homologene: 67425
Ripk4
Name: receptor-interacting serine-threonine kinase 4
Synonyms: PKK, DIk, RIP4, ANKK2, Ankrd3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 72388
HGNC: HGNC:496
Homologene: 10772
Baiap2l1
Name: BAI1-associated protein 2-like 1
Synonyms: 1300006M19Rik, IRTKS
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66898
Homologene: 23123
Hpd
Name: 4-hydroxyphenylpyruvic acid dioxygenase
Synonyms: Hppd, Laf, Flp, Fla
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15445
HGNC: HGNC:5147
Homologene: 1620
Pigs
Name: phosphatidylinositol glycan anchor biosynthesis, class S
Synonyms: LOC276846, LOC245087
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 276846
Homologene: 41963
Ephb1
Name: Eph receptor B1
Synonyms: Elk, Hek6, Net, Cek6, Elkh, C130099E04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270190
HGNC: HGNC:3392
Homologene: 20936
Greb1l
Name: growth regulation by estrogen in breast cancer-like
Synonyms: mKIAA4095, AK220484
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 381157
Homologene: 73393
Atg2a
Name: autophagy related 2A
Synonyms: 1810013C15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 329015
Homologene: 86985
Cracr2a
Name: calcium release activated channel regulator 2A
Synonyms: LOC381812, LOC243645, Efcab4b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381812
Homologene: 41883
Vmn2r89
Name: vomeronasal 2, receptor 89
Synonyms: V2r11, V2r10
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 22301
Or51q1c
Name: olfactory receptor family 51 subfamily Q member 1C
Synonyms: GA_x6K02T2PBJ9-6737723-6738670, MOR5-1, Olfr638
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259124
Homologene: 133592
Sh3bp4
Name: SH3-domain binding protein 4
Synonyms: BOG25
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98402
Homologene: 8726
Smarca2
Name: SWI/SNF related BAF chromatin remodeling complex subunit ATPase 2
Synonyms: brm, Snf2l2, 2610209L14Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 67155
Homologene: 2308
Vmn1r60
Name: vomeronasal 1 receptor 60
Synonyms: Gm7184
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 636697
Homologene: 41799
Klk1b9
Name: kallikrein 1-related peptidase b9
Synonyms: mGk-9, Egfbp-3, Egfbp3, Klk9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13648
HGNC: HGNC:6357
Homologene: 68141
Srms
Name: src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites
Synonyms: srm, A230069J08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20811
Homologene: 7957
Apc2
Name: APC regulator of WNT signaling pathway 2
Synonyms: APCL
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 23805
Homologene: 4299
Entrep1
Name: endosomal transmembrane epsin interactor 1
Synonyms: LOC381217, Fam189a2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 381217
VEGA: 19
Homologene: 3540
Frk
Name: fyn-related kinase
Synonyms: BSK/IYK, GTK
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14302
VEGA: 10
HGNC: HGNC:3955
Homologene: 48065
Gpatch3
Name: G patch domain containing 3
Synonyms: D930035B09Rik, Gpatc3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242691
Homologene: 11122
Lrriq3
Name: leucine-rich repeats and IQ motif containing 3
Synonyms: 4930511J15Rik, 4930438B07Rik, 4933403H06Rik, Lrrc44
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74435
Homologene: 23668
Fndc9
Name: fibronectin type III domain containing 9
Synonyms: C030019I05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 320116
Homologene: 37404
Dyrk4
Name: dual-specificity tyrosine phosphorylation regulated kinase 4
Synonyms: Dyrk4b, Dyrk4a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101320
HGNC: HGNC:3095
Homologene: 37858
Arhgap18
Name: Rho GTPase activating protein 18
Synonyms: 4833419J07Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73910
Homologene: 14135
Chst13
Name: carbohydrate sulfotransferase 13
Synonyms: Chst13, 1110067M19Rik, C4ST-3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71797
Homologene: 44360
Scgb2b24
Name: secretoglobin, family 2B, member 24
Synonyms: Scgb2b3, C2b, Abpz, Abpbg24
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233090
Homologene: 83171
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 74,495,782 bp
  • C to T, chromosome 1 at 87,695,396 bp
  • A to G, chromosome 1 at 89,144,921 bp
  • A to T, chromosome 1 at 156,824,050 bp
  • A to G, chromosome 2 at 29,173,694 bp
  • A to G, chromosome 2 at 52,278,847 bp
  • T to C, chromosome 2 at 181,212,657 bp
  • G to T, chromosome 3 at 137,626,350 bp
  • A to G, chromosome 3 at 155,181,675 bp
  • G to T, chromosome 4 at 133,574,880 bp
  • A to T, chromosome 4 at 135,447,253 bp
  • C to T, chromosome 4 at 143,895,373 bp
  • A to G, chromosome 4 at 143,949,692 bp
  • A to T, chromosome 5 at 23,497,581 bp
  • T to A, chromosome 5 at 89,861,609 bp
  • C to T, chromosome 5 at 123,180,676 bp
  • T to C, chromosome 5 at 138,457,051 bp
  • A to G, chromosome 5 at 144,286,302 bp
  • A to G, chromosome 6 at 71,225,412 bp
  • G to T, chromosome 6 at 90,309,606 bp
  • T to G, chromosome 6 at 126,897,238 bp
  • T to C, chromosome 6 at 127,608,752 bp
  • G to A, chromosome 7 at 5,544,600 bp
  • T to C, chromosome 7 at 19,196,614 bp
  • T to C, chromosome 7 at 30,527,210 bp
  • T to C, chromosome 7 at 30,562,348 bp
  • T to A, chromosome 7 at 33,738,477 bp
  • T to A, chromosome 7 at 43,979,735 bp
  • CG to CGACGGCGGTG, chromosome 7 at 97,579,908 bp
  • T to A, chromosome 7 at 102,090,006 bp
  • T to A, chromosome 7 at 103,999,184 bp
  • T to A, chromosome 7 at 105,758,806 bp
  • A to T, chromosome 8 at 85,670,404 bp
  • A to G, chromosome 9 at 102,066,898 bp
  • A to G, chromosome 9 at 106,989,475 bp
  • A to G, chromosome 10 at 26,846,416 bp
  • G to A, chromosome 10 at 34,583,967 bp
  • C to T, chromosome 10 at 50,690,247 bp
  • T to A, chromosome 10 at 75,815,120 bp
  • C to T, chromosome 10 at 80,311,779 bp
  • T to A, chromosome 10 at 88,213,706 bp
  • A to T, chromosome 11 at 46,237,881 bp
  • A to G, chromosome 11 at 73,906,803 bp
  • A to G, chromosome 11 at 78,339,364 bp
  • A to T, chromosome 11 at 114,792,220 bp
  • A to G, chromosome 12 at 75,633,385 bp
  • A to G, chromosome 12 at 91,538,360 bp
  • G to A, chromosome 14 at 51,455,993 bp
  • C to T, chromosome 15 at 37,425,717 bp
  • T to A, chromosome 15 at 66,609,547 bp
  • A to G, chromosome 15 at 73,126,977 bp
  • CCCCTGCATGAGGCAGGTCCC to CCCC, chromosome 15 at 76,597,455 bp
  • T to A, chromosome 16 at 15,912,516 bp
  • A to C, chromosome 16 at 90,787,414 bp
  • T to A, chromosome 16 at 97,745,905 bp
  • G to T, chromosome 17 at 28,297,119 bp
  • T to A, chromosome 18 at 10,522,131 bp
  • T to C, chromosome 18 at 34,438,771 bp
  • T to C, chromosome 19 at 6,254,665 bp
  • A to G, chromosome 19 at 9,007,976 bp
  • A to T, chromosome 19 at 23,984,718 bp
  • A to T, chromosome 19 at 26,679,173 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6572 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044696-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.