Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6572Btlr/Mmmh
Stock Number:
044696-MU
Citation ID:
RRID:MMRRC_044696-MU
Other Names:
R6572 (G1)
Major Collection:

Strain Information

Inpp5d
Name: inositol polyphosphate-5-phosphatase D
Synonyms: SHIP, Src homology 2 domain-containing inositol-5-phosphatase, s-SHIP, SHIP-1, SHIP1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16331
HGNC: HGNC:6079
Homologene: 4046
Psenen
Name: presenilin enhancer gamma secretase subunit
Synonyms: 1700023M09Rik, Pen2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66340
Homologene: 11952
Trpc2
Name: transient receptor potential cation channel, subfamily C, member 2
Synonyms: TRPC2b, TRPC2a, mTrp2, trp2, Trrp2, 3010009O07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22064
Homologene: 135989
Btbd17
Name: BTB domain containing 17
Synonyms: 1500005I02Rik, Tango10a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72014
Homologene: 46324
Kmt2e
Name: lysine (K)-specific methyltransferase 2E
Synonyms: 1810033J14Rik, D230038D11Rik, 9530077A04Rik, Mll5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69188
Homologene: 18822
Spidr
Name: scaffolding protein involved in DNA repair
Synonyms: 2310008H04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224008
VEGA: 16
Homologene: 51693
Smyd1
Name: SET and MYND domain containing 1
Synonyms: Bop, 4632404M21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12180
Homologene: 7645
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 74,495,782 bp
  • C to T, chromosome 1 at 87,695,396 bp
  • A to G, chromosome 1 at 89,144,921 bp
  • A to T, chromosome 1 at 156,824,050 bp
  • A to G, chromosome 2 at 29,173,694 bp
  • A to G, chromosome 2 at 52,278,847 bp
  • T to C, chromosome 2 at 181,212,657 bp
  • G to T, chromosome 3 at 137,626,350 bp
  • A to G, chromosome 3 at 155,181,675 bp
  • G to T, chromosome 4 at 133,574,880 bp
  • A to T, chromosome 4 at 135,447,253 bp
  • C to T, chromosome 4 at 143,895,373 bp
  • A to G, chromosome 4 at 143,949,692 bp
  • A to T, chromosome 5 at 23,497,581 bp
  • T to A, chromosome 5 at 89,861,609 bp
  • C to T, chromosome 5 at 123,180,676 bp
  • T to C, chromosome 5 at 138,457,051 bp
  • A to G, chromosome 5 at 144,286,302 bp
  • A to G, chromosome 6 at 71,225,412 bp
  • G to T, chromosome 6 at 90,309,606 bp
  • T to G, chromosome 6 at 126,897,238 bp
  • T to C, chromosome 6 at 127,608,752 bp
  • G to A, chromosome 7 at 5,544,600 bp
  • T to C, chromosome 7 at 19,196,614 bp
  • T to C, chromosome 7 at 30,527,210 bp
  • T to C, chromosome 7 at 30,562,348 bp
  • T to A, chromosome 7 at 33,738,477 bp
  • T to A, chromosome 7 at 43,979,735 bp
  • CG to CGACGGCGGTG, chromosome 7 at 97,579,908 bp
  • T to A, chromosome 7 at 102,090,006 bp
  • T to A, chromosome 7 at 103,999,184 bp
  • T to A, chromosome 7 at 105,758,806 bp
  • A to T, chromosome 8 at 85,670,404 bp
  • A to G, chromosome 9 at 102,066,898 bp
  • A to G, chromosome 9 at 106,989,475 bp
  • A to G, chromosome 10 at 26,846,416 bp
  • G to A, chromosome 10 at 34,583,967 bp
  • C to T, chromosome 10 at 50,690,247 bp
  • T to A, chromosome 10 at 75,815,120 bp
  • C to T, chromosome 10 at 80,311,779 bp
  • T to A, chromosome 10 at 88,213,706 bp
  • A to T, chromosome 11 at 46,237,881 bp
  • A to G, chromosome 11 at 73,906,803 bp
  • A to G, chromosome 11 at 78,339,364 bp
  • A to T, chromosome 11 at 114,792,220 bp
  • A to G, chromosome 12 at 75,633,385 bp
  • A to G, chromosome 12 at 91,538,360 bp
  • G to A, chromosome 14 at 51,455,993 bp
  • C to T, chromosome 15 at 37,425,717 bp
  • T to A, chromosome 15 at 66,609,547 bp
  • A to G, chromosome 15 at 73,126,977 bp
  • CCCCTGCATGAGGCAGGTCCC to CCCC, chromosome 15 at 76,597,455 bp
  • T to A, chromosome 16 at 15,912,516 bp
  • A to C, chromosome 16 at 90,787,414 bp
  • T to A, chromosome 16 at 97,745,905 bp
  • G to T, chromosome 17 at 28,297,119 bp
  • T to A, chromosome 18 at 10,522,131 bp
  • T to C, chromosome 18 at 34,438,771 bp
  • T to C, chromosome 19 at 6,254,665 bp
  • A to G, chromosome 19 at 9,007,976 bp
  • A to T, chromosome 19 at 23,984,718 bp
  • A to T, chromosome 19 at 26,679,173 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6572 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044696-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.