Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6683Btlr/Mmmh
Stock Number:
044802-MU
Citation ID:
RRID:MMRRC_044802-MU
Other Names:
R6683 (G1)
Major Collection:

Strain Information

Tjp2
Name: tight junction protein 2
Synonyms: ZO-2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21873
VEGA: 19
Homologene: 3541
Zfp42
Name: zinc finger protein 42
Synonyms: Zfp-42, Rex-1, Rex1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22702
Homologene: 7601
Ncoa7
Name: nuclear receptor coactivator 7
Synonyms: 9030406N13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 211329
VEGA: 10
Homologene: 65245
Rlf
Name: rearranged L-myc fusion sequence
Synonyms: 9230110M18Rik, MommeD8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 109263
Homologene: 8243
Nploc4
Name: NPL4 homolog, ubiquitin recognition factor
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217365
Homologene: 5403
Znhit1
Name: zinc finger, HIT domain containing 1
Synonyms: 2700001K05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70103
Homologene: 4630
Aamp
Name: angio-associated migratory protein
Synonyms: Aamp-rs
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227290
HGNC: HGNC:18
Homologene: 846
Muc2
Name: mucin 2
Synonyms: 2010015E03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17831
HGNC: HGNC:7512
Homologene: 136755
Acat2
Name: acetyl-Coenzyme A acetyltransferase 2
Synonyms: Tcp-1x, Tcp1-rs1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 110460
HGNC: HGNC:94
Homologene: 55855
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Rapgef4
Name: Rap guanine nucleotide exchange factor (GEF) 4
Synonyms: 1300003D15Rik, Epac2, cAMP-GEFII, 5730402K07Rik, 6330581N18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56508
Homologene: 4451
Plcb1
Name: phospholipase C, beta 1
Synonyms: 3110043I21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18795
Homologene: 22876
Pth1r
Name: parathyroid hormone 1 receptor
Synonyms: PPR, PTH-related peptide receptor, PTH1R, PTH/PTHrP receptor, Pthr1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19228
HGNC: HGNC:9608
Homologene: 267
Map3k13
Name: mitogen-activated protein kinase kinase kinase 13
Synonyms: C130026N12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 71751
VEGA: 16
HGNC: HGNC:6852
Homologene: 37958
BC028528
Name: cDNA sequence BC028528
Synonyms: L259
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229600
Homologene: 49773
Adgrg6
Name: adhesion G protein-coupled receptor G6
Synonyms: LOC215798, 1190004A11Rik, DREG, Gpr126
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215798
Homologene: 10724
Krt8
Name: keratin 8
Synonyms: K8, EndoA, cytokeratin-8, cytokeratin8, cytokeratin 8, Krt-2.8, Card2, Krt2-8, TROMA-1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16691
VEGA: 15
HGNC: HGNC:6446
Homologene: 55643
Parp14
Name: poly (ADP-ribose) polymerase family, member 14
Synonyms: 1600029O10Rik, collaborator of Stat6, CoaSt6
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 547253
Homologene: 19697
Or5b21
Name: olfactory receptor family 5 subfamily B member 21
Synonyms: GA_x6K02T2RE5P-3191201-3192160, MOR202-4, Olfr1444
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258697
Homologene: 64906
St8sia4
Name: ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
Synonyms: ST8SiaIV, PST, PST-1, Siat8d
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20452
Homologene: 4147
Dhcr7
Name: 7-dehydrocholesterol reductase
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13360
HGNC: HGNC:2860
Homologene: 1042
Nlrp4f
Name: NLR family, pyrin domain containing 4F
Synonyms: Nalp-kappa, C330026N02Rik, Nalp4f
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 97895
VEGA: 13
Homologene: 87252
Nck2
Name: non-catalytic region of tyrosine kinase adaptor protein 2
Synonyms: NCKbeta, Grb4, 4833426I10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17974
HGNC: HGNC:7665
Homologene: 20794
Rnf217
Name: ring finger protein 217
Synonyms: Ibrdc1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 268291
Homologene: 66368
Ppil6
Name: peptidylprolyl isomerase (cyclophilin)-like 6
Synonyms: 2900084F20Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73075
VEGA: 10
Homologene: 52155
Or52e8
Name: olfactory receptor family 52 subfamily E member 8
Synonyms: GA_x6K02T2PBJ9-7604826-7603885, MOR32-12, Olfr671
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 257910
Homologene: 133595
Serpina3a
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3A
Synonyms: 4933406L18Rik, antitrypsin, alpha-1 antiproteinase,
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74069
HGNC: HGNC:16
Creb3l4
Name: cAMP responsive element binding protein 3-like 4
Synonyms: 5330432F22Rik, ATCE1, 1700012K17Rik, mJAL, JAL, Tisp40beta, Tisp40alpha, Tisp40
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 78284
Homologene: 12693
Fam187a
Name: family with sequence similarity 187, member A
Synonyms: 4933439F11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66784
Homologene: 128440
Vmn2r42
Name: vomeronasal 2, receptor 42
Synonyms: V2r4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22310
Homologene: 113703
Or51g2
Name: olfactory receptor family 51 subfamily G member 2
Synonyms: GA_x6K02T2PBJ9-5685322-5684384, MOR7-2, Olfr577
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259113
Homologene: 64962
Ly6d
Name: lymphocyte antigen 6 family member D
Synonyms: Ly-61, Thb, Ly61
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17068
Homologene: 2742
Lkaaear1
Name: LKAAEAR motif containing 1 (IKAAEAR murine motif)
Synonyms: LOC277496, 4930526D03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 277496
Homologene: 52380
Trdc
Name: T cell receptor delta, constant region
Synonyms: Tcrd-C
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100123473
Or1e1d-ps1
Name: olfactory receptor family 1 subfamily E member 1D, pseudogene 1
Synonyms: GA_x6K02T2P1NL-4083149-4084087, MOR135-19, Olfr396-ps1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258208
Hdgfl3
Name: HDGF like 3
Synonyms: HRP-3, 2700022B06Rik, Hdgfrp3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 29877
Homologene: 32196
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 43,569,178 bp
  • T to C, chromosome 1 at 74,282,445 bp
  • T to C, chromosome 1 at 95,653,699 bp
  • A to T, chromosome 2 at 72,054,779 bp
  • A to G, chromosome 2 at 76,710,660 bp
  • A to T, chromosome 2 at 134,786,593 bp
  • TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG to TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG, chromosome 2 at 181,697,561 bp
  • T to A, chromosome 3 at 90,237,805 bp
  • T to C, chromosome 3 at 95,888,227 bp
  • A to G, chromosome 4 at 121,147,926 bp
  • A to T, chromosome 5 at 136,982,633 bp
  • T to A, chromosome 7 at 8,184,225 bp
  • G to A, chromosome 7 at 81,900,353 bp
  • C to T, chromosome 7 at 102,973,713 bp
  • C to T, chromosome 7 at 104,975,968 bp
  • G to A, chromosome 7 at 141,751,477 bp
  • T to C, chromosome 7 at 143,843,311 bp
  • G to A, chromosome 8 at 43,296,056 bp
  • T to C, chromosome 9 at 15,008,011 bp
  • C to T, chromosome 9 at 110,727,251 bp
  • A to G, chromosome 10 at 14,456,167 bp
  • T to C, chromosome 10 at 30,771,721 bp
  • A to G, chromosome 10 at 31,534,826 bp
  • A to G, chromosome 10 at 41,498,431 bp
  • A to G, chromosome 10 at 81,609,301 bp
  • A to G, chromosome 11 at 73,928,113 bp
  • T to C, chromosome 11 at 102,886,189 bp
  • A to G, chromosome 11 at 120,383,330 bp
  • T to C, chromosome 12 at 104,119,637 bp
  • G to A, chromosome 13 at 65,199,195 bp
  • T to C, chromosome 14 at 54,144,235 bp
  • A to T, chromosome 15 at 74,762,450 bp
  • T to C, chromosome 15 at 101,998,004 bp
  • T to C, chromosome 16 at 21,892,312 bp
  • T to C, chromosome 16 at 35,834,677 bp
  • G to A, chromosome 17 at 12,943,927 bp
  • A to G, chromosome 19 at 12,862,650 bp
  • A to G, chromosome 19 at 24,120,843 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6683 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044802-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.