Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6736Btlr/Mmmh
Stock Number:
044854-MU
Citation ID:
RRID:MMRRC_044854-MU
Other Names:
R6736 (G1)
Major Collection:

Strain Information

Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Zfp143
Name: zinc finger protein 143
Synonyms: D7Ertd805e, pHZ-1, KRAB14, Zfp79, Zfp80-rs1, Staf
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20841
Homologene: 56444
Igf2bp1
Name: insulin-like growth factor 2 mRNA binding protein 1
Synonyms: CRD-BP, Crdbp, IMP-1, Zbp1, D030026A21Rik, D11Moh45, D11Moh40e, IMP1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 140486
Homologene: 4772
Dspp
Name: dentin sialophosphoprotein
Synonyms: Dmp3, Dpp, Dsp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 666279
HGNC: HGNC:3054
Sema7a
Name: sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A
Synonyms: Semaphorin K1, CDw108, Semal, 2900057C09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20361
VEGA: 9
Homologene: 2678
Ubap2
Name: ubiquitin-associated protein 2
Synonyms: 1190005K07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68926
Homologene: 73649
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 8,445,050 bp
  • C to T, chromosome 1 at 135,139,236 bp
  • A to T, chromosome 1 at 155,241,930 bp
  • T to C, chromosome 1 at 158,511,148 bp
  • A to C, chromosome 1 at 165,399,785 bp
  • T to A, chromosome 1 at 178,017,712 bp
  • T to C, chromosome 2 at 26,460,286 bp
  • A to G, chromosome 2 at 34,888,137 bp
  • T to A, chromosome 2 at 69,448,211 bp
  • C to A, chromosome 2 at 88,101,603 bp
  • T to G, chromosome 2 at 118,915,975 bp
  • C to G, chromosome 2 at 136,059,563 bp
  • T to A, chromosome 2 at 150,255,278 bp
  • C to A, chromosome 2 at 165,716,037 bp
  • T to C, chromosome 2 at 174,334,251 bp
  • T to C, chromosome 3 at 30,624,859 bp
  • A to T, chromosome 3 at 58,625,054 bp
  • A to G, chromosome 3 at 89,152,674 bp
  • A to G, chromosome 3 at 116,781,680 bp
  • GCCCGCTTGCCCCGCT to GCCCGCTTGCCCCGCTTGCCCCGCT, chromosome 4 at 41,227,210 bp
  • CT to CTTGCCCCGGT, chromosome 4 at 41,227,224 bp
  • T to A, chromosome 4 at 86,342,247 bp
  • T to A, chromosome 4 at 117,870,535 bp
  • C to A, chromosome 4 at 120,921,756 bp
  • T to C, chromosome 4 at 122,951,261 bp
  • T to C, chromosome 4 at 132,074,935 bp
  • T to G, chromosome 4 at 144,623,339 bp
  • A to T, chromosome 5 at 20,908,224 bp
  • T to A, chromosome 5 at 21,800,576 bp
  • A to G, chromosome 5 at 35,023,092 bp
  • T to A, chromosome 5 at 35,588,854 bp
  • G to T, chromosome 5 at 67,667,617 bp
  • C to A, chromosome 5 at 104,178,175 bp
  • T to C, chromosome 5 at 121,277,725 bp
  • T to C, chromosome 5 at 129,745,288 bp
  • T to A, chromosome 5 at 138,301,499 bp
  • T to G, chromosome 6 at 48,024,856 bp
  • T to A, chromosome 6 at 69,267,928 bp
  • A to T, chromosome 6 at 122,581,675 bp
  • T to A, chromosome 6 at 146,325,170 bp
  • G to A, chromosome 7 at 19,094,991 bp
  • C to T, chromosome 7 at 45,259,028 bp
  • G to A, chromosome 7 at 80,343,196 bp
  • C to T, chromosome 7 at 97,348,084 bp
  • T to C, chromosome 7 at 110,091,814 bp
  • A to G, chromosome 7 at 118,157,166 bp
  • A to G, chromosome 7 at 139,619,971 bp
  • T to C, chromosome 7 at 140,466,887 bp
  • G to T, chromosome 7 at 140,466,921 bp
  • G to T, chromosome 7 at 141,272,531 bp
  • T to G, chromosome 8 at 13,136,219 bp
  • T to A, chromosome 8 at 16,002,626 bp
  • T to C, chromosome 8 at 34,124,521 bp
  • A to G, chromosome 8 at 70,059,303 bp
  • G to A, chromosome 8 at 105,337,890 bp
  • G to T, chromosome 8 at 125,752,317 bp
  • A to G, chromosome 9 at 14,715,823 bp
  • T to C, chromosome 9 at 15,307,823 bp
  • A to G, chromosome 9 at 22,249,844 bp
  • T to A, chromosome 9 at 38,268,570 bp
  • A to G, chromosome 9 at 39,318,793 bp
  • G to A, chromosome 9 at 57,960,571 bp
  • A to T, chromosome 9 at 82,025,624 bp
  • A to G, chromosome 9 at 101,101,002 bp
  • G to T, chromosome 9 at 103,480,204 bp
  • A to G, chromosome 10 at 12,621,303 bp
  • T to C, chromosome 10 at 103,181,889 bp
  • A to T, chromosome 11 at 9,465,058 bp
  • A to C, chromosome 11 at 54,325,166 bp
  • G to A, chromosome 11 at 58,042,647 bp
  • A to G, chromosome 11 at 68,745,339 bp
  • G to T, chromosome 11 at 73,375,576 bp
  • G to A, chromosome 11 at 84,238,838 bp
  • A to T, chromosome 11 at 95,973,122 bp
  • A to G, chromosome 11 at 99,610,074 bp
  • A to G, chromosome 11 at 102,193,670 bp
  • T to C, chromosome 12 at 76,613,180 bp
  • T to A, chromosome 12 at 103,668,932 bp
  • G to T, chromosome 13 at 22,179,550 bp
  • C to T, chromosome 13 at 47,099,390 bp
  • A to T, chromosome 13 at 103,834,766 bp
  • A to T, chromosome 14 at 50,345,448 bp
  • G to T, chromosome 14 at 64,029,724 bp
  • C to A, chromosome 14 at 103,191,567 bp
  • T to A, chromosome 15 at 4,092,417 bp
  • T to C, chromosome 15 at 7,219,725 bp
  • T to C, chromosome 15 at 44,557,940 bp
  • C to A, chromosome 15 at 75,747,780 bp
  • T to A, chromosome 15 at 102,030,769 bp
  • A to G, chromosome 16 at 34,217,923 bp
  • T to G, chromosome 16 at 87,470,397 bp
  • T to C, chromosome 16 at 91,636,107 bp
  • A to T, chromosome 16 at 96,068,572 bp
  • T to C, chromosome 17 at 8,992,268 bp
  • A to T, chromosome 17 at 23,478,308 bp
  • A to G, chromosome 17 at 31,231,415 bp
  • T to A, chromosome 17 at 32,883,596 bp
  • T to C, chromosome 17 at 33,919,957 bp
  • C to A, chromosome 17 at 56,606,023 bp
  • C to A, chromosome 18 at 7,223,586 bp
  • A to G, chromosome 18 at 56,728,469 bp
  • G to A, chromosome 19 at 12,298,572 bp
  • G to T, chromosome 19 at 60,890,626 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6736 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044854-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.