Strain Name:
C57BL/6J-MtgxR6736Btlr/Mmmh
Stock Number:
044854-MU
Citation ID:
RRID:MMRRC_044854-MU
Other Names:
R6736 (G1)
Major Collection:

Strain Information

Utrn
Name: utrophin
Synonyms: G-utrophin, DRP, Dmdl
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Zfp143
Name: zinc finger protein 143
Synonyms: D7Ertd805e, pHZ-1, Zfp80-rs1, Staf, KRAB14, Zfp79
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20841
Homologene: 56444
Igf2bp1
Name: insulin-like growth factor 2 mRNA binding protein 1
Synonyms: IMP-1, D11Moh40e, CRD-BP, Crdbp, IMP1, D030026A21Rik, D11Moh45, Zbp1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 140486
Homologene: 4772
Dspp
Name: dentin sialophosphoprotein
Synonyms: Dpp, Dsp, Dmp3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 666279
HGNC: HGNC:3054
Sema7a
Name: sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A
Synonyms: CDw108, 2900057C09Rik, Semal, Semaphorin K1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20361
VEGA: 9
Homologene: 2678
Ubap2
Name: ubiquitin-associated protein 2
Synonyms: 1190005K07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68926
Homologene: 73649
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: b2b1625.2Clo, Gp330, Megalin, D230004K18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Gart
Name: phosphoribosylglycinamide formyltransferase
Synonyms: Prgs, Gaps
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 14450
HGNC: HGNC:4163
Homologene: 637
Rgs12
Name: regulator of G-protein signaling 12
Synonyms: 1200016K18Rik, 4632412M04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71729
HGNC: HGNC:9994
Homologene: 2195
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, Phr1, C130061D10Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105689
Homologene: 9005
Myh10
Name: myosin, heavy polypeptide 10, non-muscle
Synonyms: Myhn2, Fltn, Fltn, NMHC II-B, 5730504C04Rik, nonmuscle myosin heavy chain IIB, 9330167F11Rik, myosin IIB, nonmuscle myosin heavy chain II-B, Myhn-2, SMemb, Myosin IIB, NMHC-B
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77579
HGNC: HGNC:7568
Homologene: 55941
Lmnb1
Name: lamin B1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16906
HGNC: HGNC:6637
Homologene: 55912
Erbin
Name: Erbb2 interacting protein
Synonyms: Erbb2ip, Erbin, 1700028E05Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 59079
Homologene: 41282
Safb
Name: scaffold attachment factor B
Synonyms: 5330423C17Rik, SAFB1, 3110021E02Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224903
Homologene: 2229
Taf1d
Name: TATA-box binding protein associated factor, RNA polymerase I, D
Synonyms: Josd3, TAFI41, 4930553M18Rik, TAF(I)41
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75316
VEGA: 9
Homologene: 11472
Larp1
Name: La ribonucleoprotein 1, translational regulator
Synonyms: Larp, 1810024J12Rik, 3110040D16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 73158
Homologene: 9089
Brwd1
Name: bromodomain and WD repeat domain containing 1
Synonyms: Wdr9, 5330419I02Rik, D530019K20Rik, repro5, G1-403-16
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 93871
Homologene: 23130
Smg1
Name: SMG1 nonsense mediated mRNA decay associated PI3K related kinase
Synonyms: 5430435M13Rik, C130002K18Rik, SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans), 2610207I05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233789
Homologene: 56697
Dek
Name: DEK proto-oncogene
Synonyms: DEK proto-oncogene (DNA binding), 1810019E15Rik, D13H6S231E
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110052
HGNC: HGNC:2768
Homologene: 2593
Mafa
Name: MAF bZIP transcription factor A
Synonyms: RIPE3b1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 378435
VEGA: 15
Homologene: 65867
Lamp5
Name: lysosomal-associated membrane protein family, member 5
Synonyms: 6330527O06Rik, BAD-LAMP, 3110035N03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76161
Homologene: 8173
Apobec1
Name: apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11810
HGNC: HGNC:604
Homologene: 1243
Acaca
Name: acetyl-Coenzyme A carboxylase alpha
Synonyms: Acc1, acetyl-CoA carboxylase, Acac, LOC327983, A530025K05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 107476
HGNC: HGNC:84
Homologene: 31015
Rsbn1l
Name: round spermatid basic protein 1-like
Synonyms: C330002G24Rik, 8430412F05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 242860
Homologene: 19435
Sptb
Name: spectrin beta, erythrocytic
Synonyms: LOC383567, brain erythroid spectrin (235E), spectrin R, D330027P03Rik, Spnb-1, Spnb1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20741
Homologene: 295
Adamtsl1
Name: ADAMTS-like 1
Synonyms: 6720426B09Rik, 5930437A14Rik, punctin-1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 77739
Homologene: 64642
Mfsd2a
Name: MFSD2 lysolipid transporter A, lysophospholipid
Synonyms: 1700018O18Rik, Mfsd2, major facilitator superfamily domain containing 2A
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76574
Homologene: 19229
Cdhr5
Name: cadherin-related family member 5
Synonyms: Mucdhl, Mupcdh, 1810074H01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72040
HGNC: HGNC:7521
Homologene: 69345
Notch1
Name: notch 1
Synonyms: Tan1, 9930111A19Rik, lin-12, Mis6, Motch A, N1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18128
HGNC: HGNC:7881
Homologene: 32049
Nipsnap2
Name: nipsnap homolog 2
Synonyms: Gbas, Nipsnap2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14467
HGNC: HGNC:4179
Homologene: 1137
Cul4a
Name: cullin 4A
Synonyms: 2810470J21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 99375
HGNC: HGNC:2554
Homologene: 81724
Sugp1
Name: SURP and G patch domain containing 1
Synonyms: Sf4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 70616
Homologene: 12360
Dcaf6
Name: DDB1 and CUL4 associated factor 6
Synonyms: NRIP, Iqwd1, PC326, 1200006M05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74106
Homologene: 10199
Zfp599
Name: zinc finger protein 599
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235048
Homologene: 138456
Kalrn
Name: kalirin, RhoGEF kinase
Synonyms: LOC224126, E530005C20Rik, 2210407G14Rik, Hapip
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 545156
HGNC: HGNC:4814
Homologene: 57160
Zfp870
Name: zinc finger protein 870
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240066
VEGA: 17
Homologene: 48189
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269700
Homologene: 28297
Csmd1
Name: CUB and Sushi multiple domains 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94109
Homologene: 69536
Stag3
Name: STAG3 cohesin complex component
Synonyms: stromalin 3, SA-2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 50878
Homologene: 40844
Cfap46
Name: cilia and flagella associated protein 46
Synonyms: Ttc40, 9330101J02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 212124
Mboat4
Name: membrane bound O-acyltransferase domain containing 4
Synonyms: GOAT, LOC234155
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234155
Homologene: 19272
Abca13
Name: ATP-binding cassette, sub-family A member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268379
Homologene: 27991
Itpr2
Name: inositol 1,4,5-triphosphate receptor 2
Synonyms: Ip3r2, Itpr5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16439
HGNC: HGNC:6181
Homologene: 37593
Tapbp
Name: TAP binding protein
Synonyms: tapasin, TPN, D17Wsu91e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21356
Homologene: 2401
Pkhd1l1
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: fibrocystin L, PKHDL1, D86 mRNA
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 192190
Homologene: 16332
Sntg1
Name: syntrophin, gamma 1
Synonyms: SYN4, G1SYN
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71096
Homologene: 56834
Agl
Name: amylo-1,6-glucosidase, 4-alpha-glucanotransferase
Synonyms: 9430004C13Rik, 1110061O17Rik, 9630046L06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77559
HGNC: HGNC:321
Homologene: 536
Fhod1
Name: formin homology 2 domain containing 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234686
Homologene: 136406
1700010I14Rik
Name: RIKEN cDNA 1700010I14 gene
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66931
Homologene: 49841
Astn1
Name: astrotactin 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11899
HGNC: HGNC:773
Homologene: 7233
Hcn3
Name: hyperpolarization-activated, cyclic nucleotide-gated K+ 3
Synonyms: Hac3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 15168
Homologene: 22453
Aadacl4
Name: arylacetamide deacetylase like 4
Synonyms: Gm13177
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 435815
Homologene: 82530
Egflam
Name: EGF-like, fibronectin type III and laminin G domains
Synonyms: nectican, pikachurin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 268780
Homologene: 65044
Eya2
Name: EYA transcriptional coactivator and phosphatase 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14049
HGNC: HGNC:3520
Homologene: 40711
Lrriq1
Name: leucine-rich repeats and IQ motif containing 1
Synonyms: 4930503E15Rik, LOC380658, Gm1557
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74978
Homologene: 46007
BC034090
Name: cDNA sequence BC034090
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 207792
Homologene: 19490
Odad2
Name: outer dynein arm docking complex subunit 2
Synonyms: Armc4, 4930463I21Rik, b2b643Clo, b2b227.1Clo
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 74934
VEGA: 18
Homologene: 9992
Mei4
Name: meiotic double-stranded break formation protein 4
Synonyms: 4930486G11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75033
Homologene: 87251
Krt18
Name: keratin 18
Synonyms: Endo B, K18, CK18, Krt1-18
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16668
VEGA: 15
HGNC: HGNC:6430
Homologene: 55448
Erich6
Name: glutamate rich 6
Synonyms: 4932431H17Rik, Fam194a
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 545527
Homologene: 65043
Rp1l1
Name: retinitis pigmentosa 1 homolog like 1
Synonyms: Rp1hl1, Dcdc4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 271209
VEGA: 14
Homologene: 105870
Gm16432
Name: predicted gene 16432
Type: Gene
Species: Mouse
Chromosome: 1
Or1e1c
Name: olfactory receptor family 1 subfamily E member 1C
Synonyms: Olfr376, GA_x6K02T2P1NL-3535075-3536028, MOR135-12
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258924
Homologene: 133579
Pcnx2
Name: pecanex homolog 2
Synonyms: Pcnxl2, E330039K12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270109
HGNC: HGNC:8736
Homologene: 8987
Or8g30
Name: olfactory receptor family 8 subfamily G member 30
Synonyms: MOR171-45, MOR171-51, Olfr948, GA_x6K02T2PVTD-33016899-33015934
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 257912
VEGA: 9
HGNC: HGNC:8484
Homologene: 79377
Kctd21
Name: potassium channel tetramerisation domain containing 21
Synonyms: EG622320
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 622320
Homologene: 54754
Atp8a1
Name: ATPase phospholipid transporting 8A1
Synonyms: Atp3a2, B230107D19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11980
Homologene: 48402
Zfp777
Name: zinc finger protein 777
Synonyms: 2500002G23Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72306
Homologene: 56721
Six5
Name: sine oculis-related homeobox 5
Synonyms: Dmahp, TrexBF, MDMAHP
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20475
Homologene: 72248
Grk5
Name: G protein-coupled receptor kinase 5
Synonyms: Gprk5
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14773
VEGA: 19
HGNC: HGNC:4544
Homologene: 3879
Vmn2r117
Name: vomeronasal 2, receptor 117
Synonyms: EG619788, V2Rp6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 619788
Homologene: 86604
Lrrc34
Name: leucine rich repeat containing 34
Synonyms: Spata34, 1700007J06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71827
Homologene: 27419
Gm10300
Name: predicted gene 10300
Type: Gene
Species: Mouse
Chromosome: 4
Usp16
Name: ubiquitin specific peptidase 16
Synonyms: 1200004E02Rik, 2810483I07Rik, 6330514E22Rik, UBP-M
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74112
Homologene: 38183
Bfsp2
Name: beaded filament structural protein 2, phakinin
Synonyms: CP49
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 107993
HGNC: HGNC:1041
Homologene: 20791
Exo5
Name: exonuclease 5
Synonyms: Dem1, 3110037I16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 73172
Homologene: 41497
Piwil4
Name: piwi-like RNA-mediated gene silencing 4
Synonyms: Miwi2, MIWI2, 9230101H05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 330890
Homologene: 45122
Ptpn7
Name: protein tyrosine phosphatase, non-receptor type 7
Synonyms: LC-PTP, BPTP-4, C920001D21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320139
HGNC: HGNC:9659
Homologene: 15411
Msl2
Name: MSL complex subunit 2
Synonyms: Rnf184, Msl2l1, E130103E02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 77853
Homologene: 10021
Acsl6
Name: acyl-CoA synthetase long-chain family member 6
Synonyms: Lacsl, Facl6, A330035H04Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216739
Homologene: 100939
Gnas
Name: GNAS complex locus
Synonyms: Galphas, Gnas1, Gs-alpha, P1, P3, XLalphas, Gnasxl, neuroendocrine-specific Golgi protein p55 isoform 1, Nesp, Gs alpha, P2, Nespl, G alpha s, Oedsml, Nesp55, SCG6, Gsa
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14683
HGNC: HGNC:4392
Homologene: 55534
Vmn1r191
Name: vomeronasal 1 receptor 191
Synonyms: V1rh15
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 632534
Homologene: 110880
Or4q3
Name: olfactory receptor family 4 subfamily Q member 3
Synonyms: Olfr735, MOR243-1, GA_x6K02T2PMLR-6042130-6041183
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 257909
Homologene: 71977
Or8c17
Name: olfactory receptor family 8 subfamily C member 17
Synonyms: Olfr895, MOR170-1, GA_x6K02T2PVTD-31962461-31963411
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258875
Homologene: 74253
Cutal
Name: cutA divalent cation tolerance homolog-like
Synonyms: D730039F16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77996
Homologene: 66286
Or5an10
Name: olfactory receptor family 5 subfamily AN member 10
Synonyms: Olfr1436, MOR214-2, GA_x6K02T2RE5P-2634596-2633658
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258682
Homologene: 83129
Or12j4
Name: olfactory receptor family 12 subfamily J member 4
Synonyms: MOR252-3P, GA_x6K02T2PBJ9-42615403-42616365, Olfr533
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258056
Homologene: 128384
Hddc3
Name: HD domain containing 3
Synonyms: 1110033O09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68695
Homologene: 12279
Bahd1
Name: bromo adjacent homology domain containing 1
Synonyms: LOC228536
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228536
Homologene: 8976
Ubash3a
Name: ubiquitin associated and SH3 domain containing, A
Synonyms: TULA, Sts-2, 5830413C03Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328795
Homologene: 56833
Oxct1
Name: 3-oxoacid CoA transferase 1
Synonyms: 2610008O03Rik, Scot-s
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67041
HGNC: HGNC:8527
Homologene: 377
G6pc3
Name: glucose 6 phosphatase, catalytic, 3
Synonyms: 0710001K01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68401
Homologene: 16304
Krtap2-21
Name: keratin associated protein 2-21
Synonyms: Gm11937
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 100041488
Homologene: 41961
Ccdc24
Name: coiled-coil domain containing 24
Synonyms: LOC381546
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381546
Acox3
Name: acyl-Coenzyme A oxidase 3, pristanoyl
Synonyms: PCOX, pristanoyl-CoA oxidase, EST-s59
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80911
HGNC: HGNC:121
Homologene: 37792
Psmc2
Name: proteasome (prosome, macropain) 26S subunit, ATPase 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19181
HGNC: HGNC:9548
Homologene: 2096
Serpina16
Name: serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 16
Synonyms: Gm46, LOC194604
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 194604
Homologene: 52303
Or5d20-ps1
Name: olfactory receptor family 5 subfamily D member 20, pseudogene 1
Synonyms: Olfr1165-ps, GA_x6K02T2Q125-49593880-49592930, MOR174-7
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258642
Slc6a16
Name: solute carrier family 6, member 16
Synonyms: LOC381884
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381884
Homologene: 49366
Igkv4-70
Name: immunoglobulin kappa chain variable 4-70
Synonyms: LOC385120, Gm1502
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 385120
Zfp1002
Name: zinc finger protein 1002
Synonyms: Gm21994
Type: Gene
Species: Mouse
Chromosome: 2
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 8,445,050 bp
  • C to T, chromosome 1 at 135,139,236 bp
  • A to T, chromosome 1 at 155,241,930 bp
  • T to C, chromosome 1 at 158,511,148 bp
  • A to C, chromosome 1 at 165,399,785 bp
  • T to A, chromosome 1 at 178,017,712 bp
  • T to C, chromosome 2 at 26,460,286 bp
  • A to G, chromosome 2 at 34,888,137 bp
  • T to A, chromosome 2 at 69,448,211 bp
  • C to A, chromosome 2 at 88,101,603 bp
  • T to G, chromosome 2 at 118,915,975 bp
  • C to G, chromosome 2 at 136,059,563 bp
  • T to A, chromosome 2 at 150,255,278 bp
  • C to A, chromosome 2 at 165,716,037 bp
  • T to C, chromosome 2 at 174,334,251 bp
  • T to C, chromosome 3 at 30,624,859 bp
  • A to T, chromosome 3 at 58,625,054 bp
  • A to G, chromosome 3 at 89,152,674 bp
  • A to G, chromosome 3 at 116,781,680 bp
  • GCCCGCTTGCCCCGCT to GCCCGCTTGCCCCGCTTGCCCCGCT, chromosome 4 at 41,227,210 bp
  • CT to CTTGCCCCGGT, chromosome 4 at 41,227,224 bp
  • T to A, chromosome 4 at 86,342,247 bp
  • T to A, chromosome 4 at 117,870,535 bp
  • C to A, chromosome 4 at 120,921,756 bp
  • T to C, chromosome 4 at 122,951,261 bp
  • T to C, chromosome 4 at 132,074,935 bp
  • T to G, chromosome 4 at 144,623,339 bp
  • A to T, chromosome 5 at 20,908,224 bp
  • T to A, chromosome 5 at 21,800,576 bp
  • A to G, chromosome 5 at 35,023,092 bp
  • T to A, chromosome 5 at 35,588,854 bp
  • G to T, chromosome 5 at 67,667,617 bp
  • C to A, chromosome 5 at 104,178,175 bp
  • T to C, chromosome 5 at 121,277,725 bp
  • T to C, chromosome 5 at 129,745,288 bp
  • T to A, chromosome 5 at 138,301,499 bp
  • T to G, chromosome 6 at 48,024,856 bp
  • T to A, chromosome 6 at 69,267,928 bp
  • A to T, chromosome 6 at 122,581,675 bp
  • T to A, chromosome 6 at 146,325,170 bp
  • G to A, chromosome 7 at 19,094,991 bp
  • C to T, chromosome 7 at 45,259,028 bp
  • G to A, chromosome 7 at 80,343,196 bp
  • C to T, chromosome 7 at 97,348,084 bp
  • T to C, chromosome 7 at 110,091,814 bp
  • A to G, chromosome 7 at 118,157,166 bp
  • A to G, chromosome 7 at 139,619,971 bp
  • T to C, chromosome 7 at 140,466,887 bp
  • G to T, chromosome 7 at 140,466,921 bp
  • G to T, chromosome 7 at 141,272,531 bp
  • T to G, chromosome 8 at 13,136,219 bp
  • T to A, chromosome 8 at 16,002,626 bp
  • T to C, chromosome 8 at 34,124,521 bp
  • A to G, chromosome 8 at 70,059,303 bp
  • G to A, chromosome 8 at 105,337,890 bp
  • G to T, chromosome 8 at 125,752,317 bp
  • A to G, chromosome 9 at 14,715,823 bp
  • T to C, chromosome 9 at 15,307,823 bp
  • A to G, chromosome 9 at 22,249,844 bp
  • T to A, chromosome 9 at 38,268,570 bp
  • A to G, chromosome 9 at 39,318,793 bp
  • G to A, chromosome 9 at 57,960,571 bp
  • A to T, chromosome 9 at 82,025,624 bp
  • A to G, chromosome 9 at 101,101,002 bp
  • G to T, chromosome 9 at 103,480,204 bp
  • A to G, chromosome 10 at 12,621,303 bp
  • T to C, chromosome 10 at 103,181,889 bp
  • A to T, chromosome 11 at 9,465,058 bp
  • A to C, chromosome 11 at 54,325,166 bp
  • G to A, chromosome 11 at 58,042,647 bp
  • A to G, chromosome 11 at 68,745,339 bp
  • G to T, chromosome 11 at 73,375,576 bp
  • G to A, chromosome 11 at 84,238,838 bp
  • A to T, chromosome 11 at 95,973,122 bp
  • A to G, chromosome 11 at 99,610,074 bp
  • A to G, chromosome 11 at 102,193,670 bp
  • T to C, chromosome 12 at 76,613,180 bp
  • T to A, chromosome 12 at 103,668,932 bp
  • G to T, chromosome 13 at 22,179,550 bp
  • C to T, chromosome 13 at 47,099,390 bp
  • A to T, chromosome 13 at 103,834,766 bp
  • A to T, chromosome 14 at 50,345,448 bp
  • G to T, chromosome 14 at 64,029,724 bp
  • C to A, chromosome 14 at 103,191,567 bp
  • T to A, chromosome 15 at 4,092,417 bp
  • T to C, chromosome 15 at 7,219,725 bp
  • T to C, chromosome 15 at 44,557,940 bp
  • C to A, chromosome 15 at 75,747,780 bp
  • T to A, chromosome 15 at 102,030,769 bp
  • A to G, chromosome 16 at 34,217,923 bp
  • T to G, chromosome 16 at 87,470,397 bp
  • T to C, chromosome 16 at 91,636,107 bp
  • A to T, chromosome 16 at 96,068,572 bp
  • T to C, chromosome 17 at 8,992,268 bp
  • A to T, chromosome 17 at 23,478,308 bp
  • A to G, chromosome 17 at 31,231,415 bp
  • T to A, chromosome 17 at 32,883,596 bp
  • T to C, chromosome 17 at 33,919,957 bp
  • C to A, chromosome 17 at 56,606,023 bp
  • C to A, chromosome 18 at 7,223,586 bp
  • A to G, chromosome 18 at 56,728,469 bp
  • G to A, chromosome 19 at 12,298,572 bp
  • G to T, chromosome 19 at 60,890,626 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6736 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044854-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.