Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6744Btlr/Mmmh
Stock Number:
044861-MU
Citation ID:
RRID:MMRRC_044861-MU
Other Names:
R6744 (G1)
Major Collection:

Strain Information

Vcan
Name: versican
Synonyms: PG-M, hdf, heart defect, 5430420N07Rik, Cspg2, DPEAAE
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Col3a1
Name: collagen, type III, alpha 1
Synonyms: Col3a-1, Tsk-2, Tsk2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12825
HGNC: HGNC:2201
Homologene: 55433
Ptprf
Name: protein tyrosine phosphatase receptor type F
Synonyms: LAR, RPTP-LAR
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19268
HGNC: HGNC:9670
Homologene: 20623
Fbxl3
Name: F-box and leucine-rich repeat protein 3
Synonyms: Fbl3a, Fbxl3a, Ovtm, Play68
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 50789
Homologene: 8127
Mtor
Name: mechanistic target of rapamycin kinase
Synonyms: FKBP-rapamycin-associated protein FRAP, 2610315D21Rik, RAPT1, RAFT1, flat, Frap1, mechanistic target of rapamycin (serine/threonine kinase)
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56717
HGNC: HGNC:3942
Homologene: 3637
Kifap3
Name: kinesin-associated protein 3
Synonyms: KAP3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16579
Homologene: 7799
Dock6
Name: dedicator of cytokinesis 6
Synonyms: 2410095B20Rik, 4931431C02Rik, C330023D02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319899
VEGA: 9
Homologene: 83291
Atad5
Name: ATPase family, AAA domain containing 5
Synonyms: LOC237877, C130052G03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237877
Homologene: 32611
Ppp1r12a
Name: protein phosphatase 1, regulatory subunit 12A
Synonyms: 1200015F06Rik, Mypt1, D10Ertd625e, 5730577I22Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17931
VEGA: 10
HGNC: HGNC:7618
Homologene: 1855
Arap2
Name: ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2
Synonyms: Centd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 212285
Homologene: 9064
Cdc73
Name: cell division cycle 73, Paf1/RNA polymerase II complex component
Synonyms: C130030P16Rik, 8430414L16Rik, Hrpt2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 214498
Homologene: 11571
Ahi1
Name: Abelson helper integration site 1
Synonyms: Ahi-1, 1700015F03Rik, D10Bwg0629e, Jouberin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52906
VEGA: 10
Homologene: 9762
Lama5
Name: laminin, alpha 5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16776
HGNC: HGNC:6485
Homologene: 4060
Cxxc4
Name: CXXC finger 4
Synonyms: Idax, C030003J12Rik, 9330210J02Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 319478
Homologene: 11878
Sec31a
Name: SEC31 homolog A, COPII coat complex component
Synonyms: 1810024J13Rik, Sec31l1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69162
Homologene: 42056
Nceh1
Name: neutral cholesterol ester hydrolase 1
Synonyms: CPO-BP, mKIAA1363, B230106I24Rik, Aadacl1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 320024
Homologene: 23251
Tctn1
Name: tectonic family member 1
Synonyms: Tect1, G730031O11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 654470
Homologene: 49770
Qrfprl
Name: pyroglutamylated RFamide peptide receptor like
Synonyms: C130060K24Rik, Gpr103b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243407
Homologene: 135976
C8b
Name: complement component 8, beta polypeptide
Synonyms: 4930439B20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 110382
HGNC: HGNC:1353
Homologene: 48
Piezo2
Name: piezo-type mechanosensitive ion channel component 2
Synonyms: 9430028L06Rik, 9030411M15Rik, Fam38b2, Piezo2, Fam38b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 667742
Homologene: 49695
Dnah6
Name: dynein, axonemal, heavy chain 6
Synonyms: A730004I20Rik, Dnahc6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330355
HGNC: HGNC:2951
Homologene: 15221
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: nesprin-2, syne-2, D12Ertd777e, 6820443O06Rik, Nesp2g, Cpfl8, diminished cone electroretinogram, dice
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319565
Homologene: 56700
Ppp6r2
Name: protein phosphatase 6, regulatory subunit 2
Synonyms: 1110033O10Rik, 8430411H09Rik, B230107H12Rik, Pp6r2, Saps2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71474
VEGA: 15
Homologene: 36455
Mblac1
Name: metallo-beta-lactamase domain containing 1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330216
Homologene: 45596
Nek9
Name: NIMA (never in mitosis gene a)-related expressed kinase 9
Synonyms: C130021H08Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217718
Homologene: 13222
Catsperg2
Name: cation channel sperm associated auxiliary subunit gamma 2
Synonyms: 1700067C01Rik, CATSPERG
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76718
Homologene: 10915
Cdh4
Name: cadherin 4
Synonyms: Rcad, R-cadherin, R-Cadh
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12561
HGNC: HGNC:1763
Homologene: 48044
Crybg2
Name: crystallin beta-gamma domain containing 2
Synonyms: Aim1l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230806
Homologene: 19232
Ctnnb1
Name: catenin beta 1
Synonyms: beta-catenin, Catnb, beta catenin, catenin (cadherin associated protein), beta 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12387
HGNC: HGNC:2514
Homologene: 1434
Or10al3
Name: olfactory receptor family 10 subfamily AL member 3
Synonyms: MOR263-7, GA_x6K02T2PSCP-2159633-2160598, Olfr119
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258095
Homologene: 17195
Rgs17
Name: regulator of G-protein signaling 17
Synonyms: RGSZ2, 6430507P11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 56533
Homologene: 8242
Ctns
Name: cystinosis, nephropathic
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 83429
HGNC: HGNC:2518
Homologene: 3625
Psg20
Name: pregnancy-specific beta-1-glycoprotein 20
Synonyms: cea7, EG434540
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434540
Homologene: 110989
Prodh
Name: proline dehydrogenase
Synonyms: Pro1, Pro-1, Ym24d07
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19125
HGNC: HGNC:9453
Homologene: 40764
Alk
Name: anaplastic lymphoma kinase
Synonyms: Tcrz, CD246
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 11682
VEGA: 17
HGNC: HGNC:427
Homologene: 68387
Slc22a22
Name: solute carrier family 22 (organic cation transporter), member 22
Synonyms: OAT-PG, BC026439
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 210463
Homologene: 18166
Otud4
Name: OTU domain containing 4
Synonyms: 4930431L18Rik, D8Ertd69e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 73945
Homologene: 35370
Tmem214
Name: transmembrane protein 214
Synonyms: 4921530J21Rik, 1110039B18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68796
Homologene: 9801
Vmn1r49
Name: vomeronasal 1, receptor 49
Synonyms: VRi2, V1r5, V1rb2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 24112
Homologene: 113975
Or10a3
Name: olfactory receptor family 10 subfamily A member 3
Synonyms: GA_x6K02T2PBJ9-11211854-11210853, MOR268-5, Olfr518
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258303
Homologene: 133601
Rad18
Name: RAD18 E3 ubiquitin protein ligase
Synonyms: 2810024C04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 58186
Homologene: 48572
Havcr2
Name: hepatitis A virus cellular receptor 2
Synonyms: Tim3, Timd3, TIM-3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171285
Homologene: 129541
Sult2a6
Name: sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 6
Synonyms: Gm6957
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 629219
Homologene: 37741
Or2d4
Name: olfactory receptor family 2 subfamily D member 4
Synonyms: GA_x6K02T2PBJ9-9325348-9324416, MOR260-3, Olfr710
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258594
Homologene: 27218
Gm49333
Name: predicted gene, 49333
Type: Gene
Species: Mouse
Chromosome: 16
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 45,338,622 bp
  • G to A, chromosome 1 at 143,702,149 bp
  • A to G, chromosome 1 at 163,848,670 bp
  • C to A, chromosome 2 at 179,847,387 bp
  • G to A, chromosome 2 at 180,191,662 bp
  • T to A, chromosome 2 at 181,085,306 bp
  • T to C, chromosome 3 at 27,241,789 bp
  • AGGCGGCGGCGGCGGCGGCGGCGGC to AGGCGGCGGCGGCGGCGGCGGCGGCGGC, chromosome 3 at 134,240,130 bp
  • C to T, chromosome 4 at 104,774,346 bp
  • T to C, chromosome 4 at 118,236,365 bp
  • A to G, chromosome 4 at 134,088,896 bp
  • C to T, chromosome 4 at 148,458,655 bp
  • A to G, chromosome 5 at 30,874,028 bp
  • A to G, chromosome 5 at 62,748,938 bp
  • G to T, chromosome 5 at 100,392,499 bp
  • A to T, chromosome 5 at 122,264,146 bp
  • A to G, chromosome 5 at 138,194,420 bp
  • T to C, chromosome 6 at 28,442,397 bp
  • T to A, chromosome 6 at 65,441,340 bp
  • A to G, chromosome 6 at 73,037,549 bp
  • T to A, chromosome 6 at 86,446,064 bp
  • C to T, chromosome 6 at 90,072,202 bp
  • A to T, chromosome 6 at 112,675,784 bp
  • C to T, chromosome 7 at 14,222,545 bp
  • G to A, chromosome 7 at 18,674,580 bp
  • A to G, chromosome 7 at 29,709,819 bp
  • A to G, chromosome 7 at 106,944,534 bp
  • T to C, chromosome 7 at 108,880,830 bp
  • C to A, chromosome 8 at 79,673,778 bp
  • T to C, chromosome 9 at 21,831,474 bp
  • T to A, chromosome 9 at 120,952,959 bp
  • T to C, chromosome 10 at 5,842,567 bp
  • T to A, chromosome 10 at 20,965,567 bp
  • T to A, chromosome 10 at 108,230,534 bp
  • T to G, chromosome 11 at 46,455,060 bp
  • C to T, chromosome 11 at 73,185,285 bp
  • T to A, chromosome 11 at 80,134,032 bp
  • T to A, chromosome 11 at 106,301,404 bp
  • C to T, chromosome 12 at 76,074,447 bp
  • A to G, chromosome 12 at 85,329,929 bp
  • T to C, chromosome 13 at 89,705,182 bp
  • A to T, chromosome 14 at 103,083,294 bp
  • G to T, chromosome 15 at 57,254,272 bp
  • A to G, chromosome 15 at 89,256,661 bp
  • A to G, chromosome 16 at 18,079,200 bp
  • A to T, chromosome 16 at 20,630,366 bp
  • T to A, chromosome 17 at 37,701,445 bp
  • A to T, chromosome 17 at 72,603,082 bp
  • A to T, chromosome 18 at 63,032,889 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6744 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044861-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.