Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6792Btlr/Mmmh
Stock Number:
044905-MU
Citation ID:
RRID:MMRRC_044905-MU
Other Names:
R6792 (G1)
Major Collection:

Strain Information

Card11
Name: caspase recruitment domain family, member 11
Synonyms: CARMA1, BIMP3, 2410011D02Rik, 0610008L17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 108723
Homologene: 13024
Slc17a7
Name: solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7
Synonyms: Vglut1, 2900052E22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72961
Homologene: 113454
Kmt2e
Name: lysine (K)-specific methyltransferase 2E
Synonyms: 1810033J14Rik, D230038D11Rik, 9530077A04Rik, Mll5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69188
Homologene: 18822
Stam2
Name: signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
Synonyms: Hbp, 1200004O12Rik, 5730456G07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56324
Homologene: 68490
Tkfc
Name: triokinase, FMN cyclase
Synonyms: Dak
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225913
VEGA: 19
Homologene: 56710
Ppp2r5d
Name: protein phosphatase 2, regulatory subunit B', delta
Synonyms: TEG-271, Tex271, B'delta
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21770
VEGA: 17
HGNC: HGNC:9312
Homologene: 37661
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 4,892,045 bp
  • C to T, chromosome 2 at 16,150,756 bp
  • T to C, chromosome 2 at 34,956,275 bp
  • T to C, chromosome 2 at 52,707,981 bp
  • A to T, chromosome 2 at 86,593,939 bp
  • T to G, chromosome 2 at 101,717,424 bp
  • T to C, chromosome 2 at 118,719,441 bp
  • A to G, chromosome 3 at 37,011,566 bp
  • A to G, chromosome 4 at 57,855,880 bp
  • A to G, chromosome 4 at 60,421,355 bp
  • G to T, chromosome 4 at 63,317,503 bp
  • TGCCGCCGCCGCCGCCACCGCCGCCGCCGC to TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC, chromosome 5 at 23,499,476 bp
  • T to A, chromosome 5 at 30,375,634 bp
  • T to C, chromosome 5 at 97,455,729 bp
  • C to T, chromosome 5 at 121,580,649 bp
  • C to A, chromosome 5 at 137,868,590 bp
  • T to A, chromosome 5 at 140,913,309 bp
  • G to T, chromosome 6 at 54,585,852 bp
  • T to A, chromosome 6 at 72,555,554 bp
  • T to C, chromosome 6 at 96,165,115 bp
  • G to A, chromosome 6 at 128,546,329 bp
  • A to T, chromosome 7 at 10,274,485 bp
  • A to G, chromosome 7 at 45,174,875 bp
  • T to A, chromosome 7 at 45,279,885 bp
  • G to T, chromosome 7 at 65,662,303 bp
  • A to G, chromosome 7 at 103,768,139 bp
  • G to A, chromosome 8 at 12,861,939 bp
  • A to T, chromosome 9 at 16,375,644 bp
  • A to G, chromosome 9 at 21,192,590 bp
  • A to T, chromosome 9 at 42,099,263 bp
  • G to A, chromosome 9 at 53,375,317 bp
  • A to T, chromosome 9 at 75,395,548 bp
  • T to C, chromosome 10 at 7,773,983 bp
  • A to T, chromosome 11 at 75,512,775 bp
  • A to G, chromosome 11 at 115,885,097 bp
  • A to T, chromosome 12 at 38,100,425 bp
  • T to C, chromosome 12 at 107,989,734 bp
  • C to T, chromosome 12 at 112,027,113 bp
  • T to G, chromosome 13 at 55,156,898 bp
  • T to C, chromosome 14 at 57,382,767 bp
  • C to T, chromosome 15 at 89,122,877 bp
  • T to C, chromosome 16 at 96,593,255 bp
  • A to G, chromosome 16 at 96,648,237 bp
  • G to A, chromosome 17 at 5,990,290 bp
  • A to G, chromosome 17 at 46,704,856 bp
  • A to T, chromosome 17 at 78,579,399 bp
  • C to A, chromosome 18 at 61,307,676 bp
  • T to C, chromosome 19 at 10,594,524 bp
  • A to T, chromosome 19 at 41,321,626 bp
  • T to C, chromosome 19 at 50,678,168 bp
  • A to G, chromosome Y at 3,298,867 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6792 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044905-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.