Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6792Btlr/Mmmh
Stock Number:
044905-MU
Citation ID:
RRID:MMRRC_044905-MU
Other Names:
R6792 (G1)
Major Collection:

Strain Information

Card11
Name: caspase recruitment domain family, member 11
Synonyms: CARMA1, BIMP3, 2410011D02Rik, 0610008L17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 108723
Homologene: 13024
Slc17a7
Name: solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7
Synonyms: Vglut1, 2900052E22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72961
Homologene: 113454
Kmt2e
Name: lysine (K)-specific methyltransferase 2E
Synonyms: 1810033J14Rik, D230038D11Rik, 9530077A04Rik, Mll5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69188
Homologene: 18822
Stam2
Name: signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
Synonyms: Hbp, 1200004O12Rik, 5730456G07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56324
Homologene: 68490
Tkfc
Name: triokinase, FMN cyclase
Synonyms: Dak
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225913
VEGA: 19
Homologene: 56710
Ppp2r5d
Name: protein phosphatase 2, regulatory subunit B', delta
Synonyms: TEG-271, Tex271, B'delta
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21770
VEGA: 17
HGNC: HGNC:9312
Homologene: 37661
Bltp1
Name: bridge-like lipid transfer protein family member 1
Synonyms: Tweek, FSA, 4932438A13Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229227
Homologene: 52105
Tcea1
Name: transcription elongation factor A (SII) 1
Synonyms: S-II
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21399
Homologene: 55984
Sorl1
Name: sortilin-related receptor, LDLR class A repeats-containing
Synonyms: LR11, mSorLA, 2900010L19Rik, Sorla
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20660
Homologene: 2336
Mapk6
Name: mitogen-activated protein kinase 6
Synonyms: Prkm6, ERK3, Prkm4, Erk3, Mapk63, Mapk4, D130053K17Rik, 2610021I23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 50772
HGNC: HGNC:6879
Homologene: 55683
Tars3
Name: threonyl-tRNA synthetase 3
Synonyms: A530046H20Rik, Tarsl2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 272396
Homologene: 65036
Vit
Name: vitrin
Synonyms: 1700110E08Rik, 1700052E02Rik, 2810429K11Rik, AKH, akhirin
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74199
VEGA: 17
Homologene: 24942
Akap2
Name: A kinase (PRKA) anchor protein 2
Synonyms: B230340M18Rik, AKAP-KL
Type: Gene
Species: Mouse
Chromosome: 4
Pde4a
Name: phosphodiesterase 4A, cAMP specific
Synonyms: dunce, Dpde2, D9Ertd60e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18577
HGNC: HGNC:8780
Homologene: 4520
Pik3ap1
Name: phosphoinositide-3-kinase adaptor protein 1
Synonyms: BCAP, 1810044J04Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 83490
VEGA: 19
Homologene: 12848
Capg
Name: capping actin protein, gelsolin like
Synonyms: mbh1, gCap39
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12332
HGNC: HGNC:1474
Homologene: 37523
Fgfr4
Name: fibroblast growth factor receptor 4
Synonyms: Fgfr-4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14186
HGNC: HGNC:3691
Homologene: 20461
Ginm1
Name: glycoprotein integral membrane 1
Synonyms: BC013529
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215751
Homologene: 16347
Sorcs1
Name: sortilin-related VPS10 domain containing receptor 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 58178
Homologene: 10967
Fat3
Name: FAT atypical cadherin 3
Synonyms: LOC234973, LOC382129, D430038H04Rik, 9430076A06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270120
VEGA: 9
Homologene: 82252
Exph5
Name: exophilin 5
Synonyms: slac2-b, B130009M24Rik, AC079869.22gm5, Slac2b
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320051
Homologene: 9007
Col27a1
Name: collagen, type XXVII, alpha 1
Synonyms: 5730512J02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 373864
Homologene: 69400
Tubgcp6
Name: tubulin, gamma complex component 6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 328580
Homologene: 32477
Dscam
Name: DS cell adhesion molecule
Synonyms: 4932410A21Rik, Down syndrome cell adhesion molecule
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13508
HGNC: HGNC:3039
Homologene: 74393
Plcb2
Name: phospholipase C, beta 2
Synonyms: B230205M18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18796
HGNC: HGNC:9055
Homologene: 20957
Ppargc1b
Name: peroxisome proliferative activated receptor, gamma, coactivator 1 beta
Synonyms: PGC-1beta/ERRL1, 4631412G21Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 170826
Homologene: 15776
A2ml1
Name: alpha-2-macroglobulin like 1
Synonyms: Ovos2, BC048546
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232400
Homologene: 45969
Bcl11b
Name: B cell leukemia/lymphoma 11B
Synonyms: COUP-TF interacting protein 2, CTIP2, B630002E05Rik, Rit1, 9130430L19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 58208
Homologene: 10974
Dgkb
Name: diacylglycerol kinase, beta
Synonyms: DGK-beta, C630029D13Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217480
VEGA: 12
HGNC: HGNC:2850
Homologene: 37875
Myo15b
Name: myosin XVB
Synonyms: LOC217328, LOC380737, E330039G21Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217328
Atp11a
Name: ATPase, class VI, type 11A
Synonyms: Ih, 4930558F19Rik, 9130422H11Rik, LOC100045280
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50770
Homologene: 75050
Rilp
Name: Rab interacting lysosomal protein
Synonyms: LOC333615
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 280408
Homologene: 19596
Slc6a21
Name: solute carrier family 6 member 21
Synonyms: 1700039E15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76713
Homologene: 66347
Traf1
Name: TNF receptor-associated factor 1
Synonyms: 4732496E14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22029
Homologene: 4138
Pilrb2
Name: paired immunoglobin-like type 2 receptor beta 2
Synonyms: EG545812
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 545812
Homologene: 114502
Nup50l
Name: nucleoporin 50 like
Synonyms: 1700123L14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 78482
HGNC: HGNC:8065
Or52a5b
Name: olfactory receptor family 52 subfamily A member 5B
Synonyms: 3'[b]3, MOR22-2, GA_x6K02T2PBJ9-6494485-6493535, Olfr69
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18370
Homologene: 128070
Vmn1r66
Name: vomeronasal 1 receptor 66
Synonyms: V1re11
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 171264
Cryl1
Name: crystallin, lambda 1
Synonyms: 1110025H08Rik, A230106J09Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 68631
VEGA: 14
Homologene: 9322
Tdrd9
Name: tudor domain containing 9
Synonyms: 4930441E05Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74691
Homologene: 14311
Or8k35
Name: olfactory receptor family 8 subfamily K member 35
Synonyms: GA_x6K02T2Q125-48079993-48079157, MOR192-4_p, Olfr1082
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 404473
Homologene: 104285
Aldh2
Name: aldehyde dehydrogenase 2, mitochondrial
Synonyms: Ahd5, Ahd-5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11669
HGNC: HGNC:404
Homologene: 55480
Prr5l
Name: proline rich 5 like
Synonyms: 4833411O04Rik, 2600010E01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72446
Homologene: 11753
Gk2
Name: glycerol kinase 2
Synonyms: Gk-rs2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14626
HGNC: HGNC:4291
Homologene: 133273
Mup9
Name: major urinary protein 9
Synonyms: Gm14076
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100038948
Homologene: 74304
Fkbp14
Name: FK506 binding protein 14
Synonyms: FKBP22
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 231997
Homologene: 23059
Malrd1
Name: MAM and LDL receptor class A domain containing 1
Synonyms: Diet1, Gm13318, Gm13364
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 102635496
Homologene: 136214
Rbmyf5
Name: RNA binding motif protein Y-linked family member 5
Synonyms: Gm21677
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 100862365
Homologene: 136626
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 4,892,045 bp
  • C to T, chromosome 2 at 16,150,756 bp
  • T to C, chromosome 2 at 34,956,275 bp
  • T to C, chromosome 2 at 52,707,981 bp
  • A to T, chromosome 2 at 86,593,939 bp
  • T to G, chromosome 2 at 101,717,424 bp
  • T to C, chromosome 2 at 118,719,441 bp
  • A to G, chromosome 3 at 37,011,566 bp
  • A to G, chromosome 4 at 57,855,880 bp
  • A to G, chromosome 4 at 60,421,355 bp
  • G to T, chromosome 4 at 63,317,503 bp
  • TGCCGCCGCCGCCGCCACCGCCGCCGCCGC to TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC, chromosome 5 at 23,499,476 bp
  • T to A, chromosome 5 at 30,375,634 bp
  • T to C, chromosome 5 at 97,455,729 bp
  • C to T, chromosome 5 at 121,580,649 bp
  • C to A, chromosome 5 at 137,868,590 bp
  • T to A, chromosome 5 at 140,913,309 bp
  • G to T, chromosome 6 at 54,585,852 bp
  • T to A, chromosome 6 at 72,555,554 bp
  • T to C, chromosome 6 at 96,165,115 bp
  • G to A, chromosome 6 at 128,546,329 bp
  • A to T, chromosome 7 at 10,274,485 bp
  • A to G, chromosome 7 at 45,174,875 bp
  • T to A, chromosome 7 at 45,279,885 bp
  • G to T, chromosome 7 at 65,662,303 bp
  • A to G, chromosome 7 at 103,768,139 bp
  • G to A, chromosome 8 at 12,861,939 bp
  • A to T, chromosome 9 at 16,375,644 bp
  • A to G, chromosome 9 at 21,192,590 bp
  • A to T, chromosome 9 at 42,099,263 bp
  • G to A, chromosome 9 at 53,375,317 bp
  • A to T, chromosome 9 at 75,395,548 bp
  • T to C, chromosome 10 at 7,773,983 bp
  • A to T, chromosome 11 at 75,512,775 bp
  • A to G, chromosome 11 at 115,885,097 bp
  • A to T, chromosome 12 at 38,100,425 bp
  • T to C, chromosome 12 at 107,989,734 bp
  • C to T, chromosome 12 at 112,027,113 bp
  • T to G, chromosome 13 at 55,156,898 bp
  • T to C, chromosome 14 at 57,382,767 bp
  • C to T, chromosome 15 at 89,122,877 bp
  • T to C, chromosome 16 at 96,593,255 bp
  • A to G, chromosome 16 at 96,648,237 bp
  • G to A, chromosome 17 at 5,990,290 bp
  • A to G, chromosome 17 at 46,704,856 bp
  • A to T, chromosome 17 at 78,579,399 bp
  • C to A, chromosome 18 at 61,307,676 bp
  • T to C, chromosome 19 at 10,594,524 bp
  • A to T, chromosome 19 at 41,321,626 bp
  • T to C, chromosome 19 at 50,678,168 bp
  • A to G, chromosome Y at 3,298,867 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6792 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044905-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.