Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6821Btlr/Mmmh
Stock Number:
044933-MU
Citation ID:
RRID:MMRRC_044933-MU
Other Names:
R6821 (G1)
Major Collection:

Strain Information

Epha4
Name: Eph receptor A4
Synonyms: Sek, Sek1, Tyro1, Hek8, Cek8, 2900005C20Rik, rb
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13838
HGNC: HGNC:3388
Homologene: 20933
Itm2b
Name: integral membrane protein 2B
Synonyms: D14Sel6, Bri2, Bricd2b
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16432
VEGA: 14
HGNC: HGNC:6174
Homologene: 7388
Gpr6
Name: G protein-coupled receptor 6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 140741
VEGA: 10
HGNC: HGNC:4515
Homologene: 38026
Draxin
Name: dorsal inhibitory axon guidance protein
Synonyms: Neucrin, 2610109H07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70433
Homologene: 19233
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, C130061D10Rik, Phr1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105689
Homologene: 9005
Arhgap21
Name: Rho GTPase activating protein 21
Synonyms: 5530401C11Rik, ARHGAP10
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71435
Homologene: 10822
Gars1
Name: glycyl-tRNA synthetase 1
Synonyms: Sgrp23, GENA202, Gena201, Gars
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 353172
HGNC: HGNC:4162
Homologene: 1547
Pop1
Name: processing of precursor 1, ribonuclease P/MRP family, (S. cerevisiae)
Synonyms: 4932434G09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67724
Homologene: 41000
Ints9
Name: integrator complex subunit 9
Synonyms: D14Ertd231e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 210925
VEGA: 14
Homologene: 10096
Tanc2
Name: tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Synonyms: 5730590C14Rik, 3526402J09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77097
Homologene: 64680
Nvl
Name: nuclear VCP-like
Synonyms: 1200009I24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67459
HGNC: HGNC:8070
Homologene: 1902
Usp34
Name: ubiquitin specific peptidase 34
Synonyms: A530081C03Rik, Murr2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17847
Homologene: 40978
Atp9b
Name: ATPase, class II, type 9B
Synonyms: IIb
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 50771
VEGA: 18
Homologene: 21915
Rspry1
Name: ring finger and SPRY domain containing 1
Synonyms: 4930470D19Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67610
Homologene: 12164
Rbm26
Name: RNA binding motif protein 26
Synonyms: Pro1777, C230097K14Rik, 1700009P03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 74213
Homologene: 41468
Smc5
Name: structural maintenance of chromosomes 5
Synonyms: Smc5l1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226026
VEGA: 19
Homologene: 41009
C2cd5
Name: C2 calcium-dependent domain containing 5
Synonyms: C030008B15Rik, CDP138, 5730419I09Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74741
Homologene: 8873
Eif3d
Name: eukaryotic translation initiation factor 3, subunit D
Synonyms: mouse translation initiation factor eIF3 p66, eIF3p66, 66/67kDa, Eif3s7
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 55944
VEGA: 15
HGNC: HGNC:3278
Homologene: 2782
Vdac3
Name: voltage-dependent anion channel 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22335
Homologene: 36115
Acsl5
Name: acyl-CoA synthetase long-chain family member 5
Synonyms: 1700030F05Rik, Facl5
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 433256
VEGA: 19
Homologene: 69208
Adamts12
Name: ADAM metallopeptidase with thrombospondin type 1 motif 12
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239337
VEGA: 15
Homologene: 12808
Enpp5
Name: ectonucleotide pyrophosphatase/phosphodiesterase 5
Synonyms: D17Abb1e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 83965
Homologene: 23313
Igsf9
Name: immunoglobulin superfamily, member 9
Synonyms: NRT1, Dasm1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 93842
Homologene: 10815
Mdh2
Name: malate dehydrogenase 2, NAD (mitochondrial)
Synonyms: Mor-1, Mdh-2, Mor1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17448
HGNC: HGNC:6971
Homologene: 55938
Tsc22d4
Name: Tsc22 domain family, member 4
Synonyms: Thg-1pit, 0610009M14Rik, 1700023B23Rik, Tsc22d4, Spacdr
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 78829
Homologene: 11390
Phlpp1
Name: PH domain and leucine rich repeat protein phosphatase 1
Synonyms: Plekhe1, Phlpp
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98432
Homologene: 11015
Rad54b
Name: RAD54 homolog B (S. cerevisiae)
Synonyms: E130016E03Rik, E130016E03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 623474
Homologene: 8240
Ccnt2
Name: cyclin T2
Synonyms: 2900041I18Rik, CycT2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72949
HGNC: HGNC:1600
Homologene: 14043
Sirpa
Name: signal-regulatory protein alpha
Synonyms: SIRP, P84, SHPS-1, Bit, CD172a, Idd13.2, Ptpns1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19261
HGNC: HGNC:9662
Homologene: 7246
Pgm5
Name: phosphoglucomutase 5
Synonyms: 9530034F03Rik, aciculin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226041
HGNC: HGNC:8908
Homologene: 74881
Tgfbi
Name: transforming growth factor, beta induced
Synonyms: bIG-h3, 68kDa, Beta-ig
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21810
VEGA: 13
Homologene: 37294
Pik3r4
Name: phosphoinositide-3-kinase regulatory subunit 4
Synonyms: Vps15, p150
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75669
HGNC: HGNC:8982
Homologene: 24678
Siah2
Name: siah E3 ubiquitin protein ligase 2
Synonyms: Sinh2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20439
Homologene: 21053
Cdhr3
Name: cadherin-related family member 3
Synonyms: 1110049B09Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68764
VEGA: 12
Homologene: 45146
Fam228b
Name: family with sequence similarity 228, member B
Synonyms: A830093I24Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 207921
VEGA: 12
Homologene: 116108
Aox3
Name: aldehyde oxidase 3
Synonyms: AOH1, 1200011D03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71724
Homologene: 90899
Grik5
Name: glutamate receptor, ionotropic, kainate 5 (gamma 2)
Synonyms: KA2, GluRgamma2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14809
HGNC: HGNC:4583
Homologene: 1578
Slc38a7
Name: solute carrier family 38, member 7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234595
Homologene: 41237
Or51ai2
Name: olfactory receptor family 51 subfamily AI member 2
Synonyms: GA_x6K02T2PBJ9-6671256-6672209, MOR2-1, Olfr632
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259123
Homologene: 64963
Speg
Name: SPEG complex locus
Synonyms: BPEG, SPEGbeta, SPEGalpha, D1Bwg1450e, SPEG, Apeg1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11790
Homologene: 55619
Ano9
Name: anoctamin 9
Synonyms: 5430425C04Rik, Tp53i5, Trp53i5, Tmem16j
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71345
Homologene: 67083
Pramel23
Name: PRAME like 23
Synonyms: Gm13089
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 277667
Wt1
Name: WT1 transcription factor
Synonyms: Wt-1, D630046I19Rik, Wilms tumor 1 homolog
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22431
Homologene: 11536
Vmn2r120
Name: vomeronasal 2, receptor 120
Synonyms: EG224916
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224916
Aim2
Name: absent in melanoma 2
Synonyms: LOC383619, Ifi210
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 383619
HGNC: HGNC:357
Homologene: 83226
Ocstamp
Name: osteoclast stimulatory transmembrane protein
Synonyms: 4833422F24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74614
Homologene: 41768
Vmn2r17
Name: vomeronasal 2, receptor 17
Synonyms: EG384221
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384221
Homologene: 104825
Ttl
Name: tubulin tyrosine ligase
Synonyms: 2410003M22Rik, 2700049H19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69737
Homologene: 32678
Hs3st2
Name: heparan sulfate (glucosamine) 3-O-sulfotransferase 2
Synonyms: 6430516N12Rik, A830061E14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 195646
HGNC: HGNC:5195
Homologene: 21220
Atp8b2
Name: ATPase, class I, type 8B, member 2
Synonyms: Id
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 54667
Homologene: 23226
Hecw1
Name: HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
Synonyms: NEDL1, E130207I19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 94253
VEGA: 13
Homologene: 9004
Dtx3l
Name: deltex 3-like, E3 ubiquitin ligase
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 209200
Homologene: 51375
Adamts8
Name: ADAM metallopeptidase with thrombospondin type 1 motif 8
Synonyms: METH2, METH-2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 30806
HGNC: HGNC:224
Homologene: 5108
Pcdhb20
Name: protocadherin beta 20
Synonyms: Pcdhb14, PcdhbT
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93891
HGNC: HGNC:8685
Homologene: 134303
Tlr12
Name: toll-like receptor 12
Synonyms: LOC384059, Tlr11
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 384059
Homologene: 135964
Mtmr11
Name: myotubularin related protein 11
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 194126
Homologene: 82382
Map10
Name: microtubule-associated protein 10
Synonyms: 4933403G14Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74393
Homologene: 10416
Gldn
Name: gliomedin
Synonyms: Crlg2, CRG-L2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235379
Homologene: 14529
Cmtm1
Name: CKLF-like MARVEL transmembrane domain containing 1
Synonyms: CHLFH1a, CKLFH1, Cklfsf1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100504164
Homologene: 134399
Trav14-3
Name: T cell receptor alpha variable 14-3
Synonyms: Gm13933
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 547330
Gm47985
Name: predicted gene, 47985
Type: Gene
Species: Mouse
Chromosome: 1
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 58,150,388 bp
  • A to G, chromosome 1 at 75,417,903 bp
  • T to C, chromosome 1 at 77,382,945 bp
  • T to A, chromosome 1 at 106,386,444 bp
  • T to C, chromosome 1 at 127,803,335 bp
  • A to G, chromosome 1 at 151,183,036 bp
  • T to C, chromosome 1 at 172,484,493 bp
  • C to G, chromosome 1 at 173,463,980 bp
  • G to A, chromosome 1 at 181,126,970 bp
  • A to C, chromosome 2 at 20,848,848 bp
  • T to A, chromosome 2 at 105,172,267 bp
  • G to A, chromosome 2 at 129,068,915 bp
  • C to A, chromosome 2 at 129,630,097 bp
  • A to C, chromosome 2 at 158,204,774 bp
  • A to T, chromosome 2 at 165,397,922 bp
  • T to A, chromosome 3 at 58,691,770 bp
  • A to T, chromosome 3 at 89,948,173 bp
  • A to G, chromosome 3 at 96,170,407 bp
  • A to G, chromosome 4 at 11,612,777 bp
  • T to C, chromosome 4 at 128,616,892 bp
  • A to T, chromosome 4 at 143,699,304 bp
  • G to T, chromosome 4 at 148,115,691 bp
  • T to A, chromosome 5 at 109,429,465 bp
  • T to C, chromosome 5 at 135,789,671 bp
  • T to C, chromosome 5 at 137,762,644 bp
  • A to G, chromosome 6 at 55,079,338 bp
  • A to G, chromosome 6 at 143,017,986 bp
  • C to T, chromosome 7 at 25,046,355 bp
  • A to T, chromosome 7 at 103,937,586 bp
  • G to A, chromosome 7 at 121,092,847 bp
  • A to G, chromosome 7 at 121,500,522 bp
  • A to T, chromosome 7 at 141,107,256 bp
  • T to C, chromosome 8 at 22,580,475 bp
  • C to T, chromosome 8 at 94,635,431 bp
  • A to C, chromosome 8 at 95,844,920 bp
  • TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG to TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG, chromosome 8 at 104,309,702 bp
  • A to G, chromosome 8 at 125,670,399 bp
  • T to A, chromosome 9 at 30,956,626 bp
  • T to C, chromosome 9 at 54,338,770 bp
  • T to A, chromosome 9 at 105,650,606 bp
  • T to C, chromosome 10 at 41,071,008 bp
  • C to T, chromosome 11 at 23,367,491 bp
  • A to G, chromosome 11 at 60,524,475 bp
  • T to G, chromosome 11 at 105,886,490 bp
  • T to C, chromosome 12 at 4,763,083 bp
  • T to A, chromosome 12 at 33,035,045 bp
  • T to A, chromosome 13 at 14,264,134 bp
  • T to C, chromosome 13 at 56,626,137 bp
  • A to G, chromosome 14 at 53,763,472 bp
  • A to G, chromosome 14 at 65,037,458 bp
  • G to A, chromosome 14 at 73,366,467 bp
  • A to T, chromosome 14 at 103,139,409 bp
  • G to A, chromosome 14 at 105,116,964 bp
  • A to C, chromosome 15 at 11,152,048 bp
  • A to G, chromosome 15 at 34,508,639 bp
  • A to G, chromosome 15 at 77,961,655 bp
  • A to T, chromosome 16 at 35,933,060 bp
  • G to A, chromosome 17 at 44,085,264 bp
  • T to C, chromosome 17 at 57,536,659 bp
  • A to G, chromosome 17 at 74,351,962 bp
  • A to T, chromosome 18 at 37,506,122 bp
  • A to T, chromosome 18 at 80,847,248 bp
  • A to G, chromosome 19 at 23,242,787 bp
  • A to T, chromosome 19 at 24,861,647 bp
  • T to C, chromosome 19 at 55,288,836 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6821 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044933-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.