Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6850Btlr/Mmmh
Stock Number:
044954-MU
Citation ID:
RRID:MMRRC_044954-MU
Other Names:
R6850 (G1)
Major Collection:

Strain Information

Dnmt3a
Name: DNA methyltransferase 3A
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13435
HGNC: HGNC:2978
Homologene: 7294
Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Cpne3
Name: copine III
Synonyms: PRO1071, CPN3, 5730450C07Rik, 5430428M23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70568
HGNC: HGNC:2316
Homologene: 20839
Prrc2c
Name: proline-rich coiled-coil 2C
Synonyms: 9630039I18Rik, 1810043M20Rik, Bat2d, Bat2l2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226562
Homologene: 41015
Sorbs1
Name: sorbin and SH3 domain containing 1
Synonyms: c-Cbl-associated protein, CAP, Sh3d5, 9530001P15Rik, 2310065E01Rik, Ponsin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20411
VEGA: 19
Homologene: 83252
Tdrd3
Name: tudor domain containing 3
Synonyms: 4732418C03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219249
Homologene: 12771
Tank
Name: TRAF family member-associated Nf-kappa B activator
Synonyms: I-TRAF, E430026L09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21353
Homologene: 3081
Zfp35
Name: zinc finger protein 35
Synonyms: Zfp-35
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 22694
Homologene: 133081
Mcf2l
Name: mcf.2 transforming sequence-like
Synonyms: Dbs, C130040G20Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17207
Homologene: 11804
Prune2
Name: prune homolog 2
Synonyms: 6330414G02Rik, A330102H22Rik, A230083H22Rik, Olfaxin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 353211
VEGA: 19
Homologene: 18939
Car9
Name: carbonic anhydrase 9
Synonyms: CAIX, MN/CA9
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230099
HGNC: HGNC:1383
Homologene: 20325
Tars1
Name: threonyl-tRNA synthetase 1
Synonyms: ThrRS, D15Wsu59e, Tars
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110960
VEGA: 15
Homologene: 11852
Wdr75
Name: WD repeat domain 75
Synonyms: 1300003A18Rik, 2410118I19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73674
Homologene: 32771
Gar1
Name: GAR1 ribonucleoprotein
Synonyms: GAR1, C430047J18Rik, Nola1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68147
Dusp4
Name: dual specificity phosphatase 4
Synonyms: E130306H24Rik, 2700078F24Rik, MKP2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319520
HGNC: HGNC:3070
Homologene: 1065
Mphosph9
Name: M-phase phosphoprotein 9
Synonyms: 4930548D04Rik, MPP-9, MPP9, B930097C17Rik, 9630025B04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269702
HGNC: HGNC:7215
Homologene: 11256
Kctd12
Name: potassium channel tetramerisation domain containing 12
Synonyms: Pfet1, Pfetin
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239217
Homologene: 16316
Ptgs2
Name: prostaglandin-endoperoxide synthase 2
Synonyms: Cox-2, cyclooxygenase 2, Pghs2, COX2, prostaglandin G/H synthase, PHS-2, cyclooxygenase-2, PGHS-2, Tis10
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19225
HGNC: HGNC:9605
Homologene: 31000
Atp8b1
Name: ATPase, class I, type 8B, member 1
Synonyms: FIC1, Ic
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 54670
VEGA: 18
HGNC: HGNC:3706
Homologene: 21151
Dnhd1
Name: dynein heavy chain domain 1
Synonyms: 8030491N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77505
Homologene: 131117
Sohlh2
Name: spermatogenesis and oogenesis specific basic helix-loop-helix 2
Synonyms: 4933406N12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74434
Homologene: 9864
Tecta
Name: tectorin alpha
Synonyms: [a]-tectorin, Tctna
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21683
Homologene: 3955
Trim45
Name: tripartite motif-containing 45
Synonyms: 4921530N01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229644
Homologene: 11865
Scn5a
Name: sodium channel, voltage-gated, type V, alpha
Synonyms: Nav1.5c, Nav1.5, mH1, SkM2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20271
Homologene: 22738
D430041D05Rik
Name: RIKEN cDNA D430041D05 gene
Synonyms: G2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241589
Homologene: 115928
Cacna1s
Name: calcium channel, voltage-dependent, L type, alpha 1S subunit
Synonyms: Cchl1a3, fmd, mdg, sj, muscle dysgenesis, Cav1.1, DHPR alpha1s
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12292
HGNC: HGNC:1397
Homologene: 37257
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Ermp1
Name: endoplasmic reticulum metallopeptidase 1
Synonyms: D19Ertd410e, D19Wsu12e, b2b2633Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226090
Homologene: 121891
Eif2b1
Name: eukaryotic translation initiation factor 2B, subunit alpha
Synonyms: EIF2BA, EIF2B, 26kDa, D5Ertd406e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 209354
HGNC: HGNC:3257
Homologene: 1080
Adgb
Name: androglobin
Synonyms: 9130014G24Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215772
Homologene: 100289
Rab11fip2
Name: RAB11 family interacting protein 2 (class I)
Synonyms: Rab11-FIP2, nRip11, 4930470G04Rik, A830046J09Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 74998
Homologene: 8937
Spata31h1
Name: SPATA31 subfamily H member 1
Synonyms: 4932415D10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 102635990
VEGA: 10
Homologene: 82476
Lrtm1
Name: leucine-rich repeats and transmembrane domains 1
Synonyms: A930016D02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 319476
VEGA: 14
Homologene: 49635
Trpv3
Name: transient receptor potential cation channel, subfamily V, member 3
Synonyms: 1110036I10Rik, VRL3, Nh
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 246788
Homologene: 17040
Or4c102
Name: olfactory receptor family 4 subfamily C member 102
Synonyms: GA_x6K02T2Q125-50079044-50079964, MOR237-2, Olfr1189
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258768
Homologene: 81569
Ranbp3l
Name: RAN binding protein 3-like
Synonyms: C130037N17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223332
VEGA: 15
Homologene: 35407
Pdhx
Name: pyruvate dehydrogenase complex, component X
Synonyms: Pdx1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27402
Homologene: 55757
Cyp2c65
Name: cytochrome P450, family 2, subfamily c, polypeptide 65
Synonyms: 2210009K14Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 72303
HGNC: HGNC:2622
Homologene: 133566
H2-T10
Name: histocompatibility 2, T region locus 10
Synonyms: H-2T10
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15024
Asz1
Name: ankyrin repeat, SAM and basic leucine zipper domain containing 1
Synonyms: ORF3, 4933400N19Rik, Gasz
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74068
HGNC: HGNC:1350
Homologene: 11374
Tas2r144
Name: taste receptor, type 2, member 144
Synonyms: mt2r33, Tas2r44
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387515
Homologene: 47977
Kcna3
Name: potassium voltage-gated channel, shaker-related subfamily, member 3
Synonyms: Kv1.3, Kca1-3, Mk-3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16491
HGNC: HGNC:6221
Homologene: 128570
Alpk1
Name: alpha-kinase 1
Synonyms: 8430410J10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71481
Homologene: 11849
Prima1
Name: proline rich membrane anchor 1
Synonyms: B230212M13Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 170952
Homologene: 15783
Art5
Name: ADP-ribosyltransferase 5
Synonyms: Yac-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11875
Homologene: 7231
Itga7
Name: integrin alpha 7
Synonyms: [a]7, alpha7
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16404
VEGA: 10
HGNC: HGNC:6143
Homologene: 37592
Pdilt
Name: protein disulfide isomerase-like, testis expressed
Synonyms: PDILT, 1700007B13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71830
Homologene: 18382
Mtres1
Name: mitochondrial transcription rescue factor 1
Synonyms: 1700021F05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67851
Homologene: 41137
Or8g18
Name: olfactory receptor family 8 subfamily G member 18
Synonyms: MOR171-41P, GA_x6K02T2PVTD-32935684-32934749, K4, MOR171-32P, MOR171-32P, Olfr144, Olfr1537-ps1, Olfr1537
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 257959
VEGA: 9
Homologene: 110610
Tmie
Name: transmembrane inner ear
Synonyms: Mm.87012, 5131400L21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20776
Homologene: 17155
Agr2
Name: anterior gradient 2
Synonyms: mAG-2, Gob-4, XAG-2, HAG-2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 23795
HGNC: HGNC:328
Homologene: 4674
Wdr97
Name: WD repeat domain 97
Synonyms: Gm35339
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 102638882
Homologene: 131539
Iqcn
Name: IQ motif containing N
Synonyms: Gm16486
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 637079
Homologene: 141171
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 45,814,598 bp
  • G to A, chromosome 1 at 136,092,694 bp
  • A to T, chromosome 1 at 150,105,540 bp
  • TTGCTGCTGCTGCTGCTGCTGCTGCTGC to TTGCTGCTGCTGCTGCTGCTGCTGC, chromosome 1 at 162,709,061 bp
  • A to G, chromosome 2 at 61,650,002 bp
  • T to A, chromosome 2 at 88,592,306 bp
  • T to C, chromosome 2 at 103,041,100 bp
  • T to C, chromosome 2 at 104,201,259 bp
  • T to C, chromosome 3 at 27,138,885 bp
  • A to T, chromosome 3 at 55,192,286 bp
  • T to A, chromosome 3 at 100,923,225 bp
  • A to T, chromosome 3 at 107,037,159 bp
  • A to G, chromosome 3 at 127,729,363 bp
  • T to C, chromosome 3 at 129,829,389 bp
  • A to T, chromosome 4 at 19,535,231 bp
  • A to G, chromosome 4 at 43,507,321 bp
  • A to G, chromosome 5 at 124,260,956 bp
  • T to C, chromosome 5 at 124,579,006 bp
  • G to A, chromosome 6 at 18,108,943 bp
  • T to A, chromosome 6 at 42,215,923 bp
  • A to G, chromosome 7 at 102,098,095 bp
  • G to T, chromosome 7 at 105,719,930 bp
  • A to T, chromosome 7 at 119,486,959 bp
  • T to C, chromosome 8 at 13,009,476 bp
  • A to T, chromosome 8 at 34,816,497 bp
  • A to T, chromosome 8 at 70,710,776 bp
  • T to C, chromosome 9 at 39,237,975 bp
  • T to A, chromosome 9 at 42,343,838 bp
  • A to G, chromosome 9 at 67,258,535 bp
  • A to G, chromosome 9 at 110,866,912 bp
  • A to T, chromosome 9 at 119,501,749 bp
  • T to C, chromosome 10 at 10,394,574 bp
  • ACTGCACCACCT to ACT, chromosome 10 at 43,532,725 bp
  • A to C, chromosome 10 at 82,293,054 bp
  • A to T, chromosome 10 at 128,945,516 bp
  • C to T, chromosome 11 at 59,002,129 bp
  • C to T, chromosome 11 at 59,068,124 bp
  • G to A, chromosome 11 at 73,291,693 bp
  • A to G, chromosome 12 at 3,897,600 bp
  • A to G, chromosome 12 at 35,995,559 bp
  • C to T, chromosome 12 at 103,197,335 bp
  • T to C, chromosome 14 at 29,027,450 bp
  • T to C, chromosome 14 at 87,458,079 bp
  • C to T, chromosome 14 at 102,981,978 bp
  • C to A, chromosome 15 at 9,058,727 bp
  • T to A, chromosome 15 at 11,392,799 bp
  • A to G, chromosome 15 at 76,357,796 bp
  • A to G, chromosome 17 at 36,119,260 bp
  • G to A, chromosome 18 at 24,002,782 bp
  • A to C, chromosome 18 at 64,556,852 bp
  • C to A, chromosome 19 at 17,122,188 bp
  • A to G, chromosome 19 at 29,616,641 bp
  • T to A, chromosome 19 at 39,069,091 bp
  • G to C, chromosome 19 at 40,376,800 bp
  • A to T, chromosome 19 at 59,937,009 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6850 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044954-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.