Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6850Btlr/Mmmh
Stock Number:
044954-MU
Citation ID:
RRID:MMRRC_044954-MU
Other Names:
R6850 (G1)
Major Collection:

Strain Information

Dnmt3a
Name: DNA methyltransferase 3A
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13435
HGNC: HGNC:2978
Homologene: 7294
Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Cpne3
Name: copine III
Synonyms: PRO1071, CPN3, 5730450C07Rik, 5430428M23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70568
HGNC: HGNC:2316
Homologene: 20839
Prrc2c
Name: proline-rich coiled-coil 2C
Synonyms: 9630039I18Rik, 1810043M20Rik, Bat2d, Bat2l2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226562
Homologene: 41015
Ect2
Name: epithelial cell transforming 2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13605
HGNC: HGNC:3155
Homologene: 7298
Sorbs1
Name: sorbin and SH3 domain containing 1
Synonyms: c-Cbl-associated protein, CAP, Sh3d5, 9530001P15Rik, 2310065E01Rik, Ponsin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20411
VEGA: 19
Homologene: 83252
Tdrd3
Name: tudor domain containing 3
Synonyms: 4732418C03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219249
Homologene: 12771
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 45,814,598 bp
  • G to A, chromosome 1 at 136,092,694 bp
  • A to T, chromosome 1 at 150,105,540 bp
  • TTGCTGCTGCTGCTGCTGCTGCTGCTGC to TTGCTGCTGCTGCTGCTGCTGCTGC, chromosome 1 at 162,709,061 bp
  • A to G, chromosome 2 at 61,650,002 bp
  • T to A, chromosome 2 at 88,592,306 bp
  • T to C, chromosome 2 at 103,041,100 bp
  • T to C, chromosome 2 at 104,201,259 bp
  • T to C, chromosome 3 at 27,138,885 bp
  • A to T, chromosome 3 at 55,192,286 bp
  • T to A, chromosome 3 at 100,923,225 bp
  • A to T, chromosome 3 at 107,037,159 bp
  • A to G, chromosome 3 at 127,729,363 bp
  • T to C, chromosome 3 at 129,829,389 bp
  • A to T, chromosome 4 at 19,535,231 bp
  • A to G, chromosome 4 at 43,507,321 bp
  • A to G, chromosome 5 at 124,260,956 bp
  • T to C, chromosome 5 at 124,579,006 bp
  • G to A, chromosome 6 at 18,108,943 bp
  • T to A, chromosome 6 at 42,215,923 bp
  • A to G, chromosome 7 at 102,098,095 bp
  • G to T, chromosome 7 at 105,719,930 bp
  • A to T, chromosome 7 at 119,486,959 bp
  • T to C, chromosome 8 at 13,009,476 bp
  • A to T, chromosome 8 at 34,816,497 bp
  • A to T, chromosome 8 at 70,710,776 bp
  • T to C, chromosome 9 at 39,237,975 bp
  • T to A, chromosome 9 at 42,343,838 bp
  • A to G, chromosome 9 at 67,258,535 bp
  • A to G, chromosome 9 at 110,866,912 bp
  • A to T, chromosome 9 at 119,501,749 bp
  • T to C, chromosome 10 at 10,394,574 bp
  • ACTGCACCACCT to ACT, chromosome 10 at 43,532,725 bp
  • A to C, chromosome 10 at 82,293,054 bp
  • A to T, chromosome 10 at 128,945,516 bp
  • C to T, chromosome 11 at 59,002,129 bp
  • C to T, chromosome 11 at 59,068,124 bp
  • G to A, chromosome 11 at 73,291,693 bp
  • A to G, chromosome 12 at 3,897,600 bp
  • A to G, chromosome 12 at 35,995,559 bp
  • C to T, chromosome 12 at 103,197,335 bp
  • T to C, chromosome 14 at 29,027,450 bp
  • T to C, chromosome 14 at 87,458,079 bp
  • C to T, chromosome 14 at 102,981,978 bp
  • C to A, chromosome 15 at 9,058,727 bp
  • T to A, chromosome 15 at 11,392,799 bp
  • A to G, chromosome 15 at 76,357,796 bp
  • A to G, chromosome 17 at 36,119,260 bp
  • G to A, chromosome 18 at 24,002,782 bp
  • A to C, chromosome 18 at 64,556,852 bp
  • C to A, chromosome 19 at 17,122,188 bp
  • A to G, chromosome 19 at 29,616,641 bp
  • T to A, chromosome 19 at 39,069,091 bp
  • G to C, chromosome 19 at 40,376,800 bp
  • A to T, chromosome 19 at 59,937,009 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6850 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044954-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.