Strain Name:
C57BL/6J-MtgxR6851Btlr/Mmmh
Stock Number:
044955-MU
Citation ID:
RRID:MMRRC_044955-MU
Other Names:
R6851 (G1)
Major Collection:

Strain Information

Galnt10
Name: polypeptide N-acetylgalactosaminyltransferase 10
Synonyms: C330012K04Rik, Galnt9, GalNAc-T10
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171212
Homologene: 14924
Hcn2
Name: hyperpolarization-activated, cyclic nucleotide-gated K+ 2
Synonyms: trls, HAC1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15166
HGNC: HGNC:4846
Homologene: 31022
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, Phr1, C130061D10Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105689
Homologene: 9005
Kif13b
Name: kinesin family member 13B
Synonyms: 5330429L19Rik, GAKIN, N-3 kinesin, C130021D12Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16554
VEGA: 14
Homologene: 9073
Prrc2c
Name: proline-rich coiled-coil 2C
Synonyms: 1810043M20Rik, Bat2d, Bat2l2, 9630039I18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226562
Homologene: 41015
Osbpl8
Name: oxysterol binding protein-like 8
Synonyms: D330025H14Rik, ORP-8
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237542
VEGA: 10
Homologene: 68813
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: enaptin165, SYNE-1, C130039F11Rik, A330049M09Rik, nesprin-1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Lama5
Name: laminin, alpha 5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16776
HGNC: HGNC:6485
Homologene: 4060
Pex5
Name: peroxisomal biogenesis factor 5
Synonyms: PTS1R, ESTM1, Pxr1, peroxisome biogenesis factor 5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19305
HGNC: HGNC:9719
Homologene: 270
Hadh
Name: hydroxyacyl-Coenzyme A dehydrogenase
Synonyms: Schad, Hadhsc
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 15107
HGNC: HGNC:4799
Homologene: 55888
Dgke
Name: diacylglycerol kinase, epsilon
Synonyms: DAGK6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56077
HGNC: HGNC:2852
Homologene: 2705
Wdr75
Name: WD repeat domain 75
Synonyms: 2410118I19Rik, 1300003A18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73674
Homologene: 32771
Tepsin
Name: TEPSIN, adaptor related protein complex 4 accessory protein
Synonyms: 2410002I01Rik, Enthd2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78777
Homologene: 35359
Firrm
Name: FIGNL1 interacting regulator of recombination and mitosis
Synonyms: BC055324, Flip
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381306
Homologene: 10058
Kcnv1
Name: potassium channel, subfamily V, member 1
Synonyms: 2700023A03Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67498
VEGA: 15
Homologene: 22811
Arrdc2
Name: arrestin domain containing 2
Synonyms: 4632416I05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 70807
Homologene: 79540
Ush2a
Name: usherin
Synonyms: LOC381317, MUSH2A, A930011D15Rik, LOC269160, A930037M10Rik, Ushrn, Ush2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Cacna1d
Name: calcium channel, voltage-dependent, L type, alpha 1D subunit
Synonyms: Cav1.3alpha1, Cchl1a2, C79217, Cacnl1a2, D-LTCC, 8430418G19Rik, Cchl1a
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12289
VEGA: 14
HGNC: HGNC:1391
Homologene: 578
Gm11639
Name: predicted gene 11639
Synonyms: Gm11639, Efcab15
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 105242472
Zan
Name: zonadhesin
Synonyms: Zan
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22635
Homologene: 124417
Cacna1s
Name: calcium channel, voltage-dependent, L type, alpha 1S subunit
Synonyms: Cav1.1, mdg, DHPR alpha1s, muscle dysgenesis, sj, fmd, Cchl1a3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12292
HGNC: HGNC:1397
Homologene: 37257
Tsbp1
Name: testis expressed basic protein 1
Synonyms: BC051142
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 407788
Homologene: 128168
Slc13a4
Name: solute carrier family 13 (sodium/sulfate symporters), member 4
Synonyms: SUT-1, 9630060C05Rik, SUT1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243755
Homologene: 69125
Mprip
Name: myosin phosphatase Rho interacting protein
Synonyms: p116 Rho interacting protein, Gm34094, RIP3, Rhoip3, p116Rip
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 26936
Homologene: 9034
Or9m1b
Name: olfactory receptor family 9 subfamily M member 1B
Synonyms: Olfr1160, GA_x6K02T2Q125-49498697-49497765, MOR173-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258643
Homologene: 74192
Cracr2a
Name: calcium release activated channel regulator 2A
Synonyms: Efcab4b, LOC381812, LOC243645
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381812
Homologene: 41883
Or1j11
Name: olfactory receptor family 1 subfamily E member 1
Synonyms: Olfr339, MOR136-3, GA_x6K02T2NLDC-33116096-33117025
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258951
Homologene: 133615
Or8h9
Name: olfactory receptor family 8 subfamily H member 9
Synonyms: GA_x6K02T2Q125-48446067-48445129, MOR206-3, Olfr1099
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258764
Homologene: 107003
Irgm2
Name: immunity-related GTPase family M member 2
Synonyms: Gtpi, Iigp2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 54396
Homologene: 78363
Defa35
Name: defensin, alpha, 35
Synonyms: Gm10104, ENSMUSG00000061845, OTTMUSG00000018258
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100041688
Homologene: 113382
Vmn2r96
Name: vomeronasal 2, receptor 96
Synonyms: EG433070
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 433070
Gpr180
Name: G protein-coupled receptor 180
Synonyms: E130016I23Rik, ITR
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 58245
VEGA: 14
Homologene: 32506
Abcc10
Name: ATP-binding cassette, sub-family C member 10
Synonyms: Mrp7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224814
HGNC: HGNC:52
Homologene: 58616
Sele
Name: selectin, endothelial cell
Synonyms: CD62E, E-selectin, Elam
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20339
Homologene: 389
Or8b51
Name: olfactory receptor family 8 subfamily B member 51
Synonyms: GA_x6K02T2PVTD-32360710-32359778, Olfr916, MOR168-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258780
VEGA: 9
Homologene: 74147
Or12e1
Name: olfactory receptor family 12 subfamily E member 1
Synonyms: Olfr1112, MOR264-6, GA_x6K02T2Q125-48676316-48677272
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258655
Homologene: 64901
Klhdc3
Name: kelch domain containing 3
Synonyms: Peas, 1300011D16Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71765
VEGA: 17
Homologene: 14290
Tpp1
Name: tripeptidyl peptidase I
Synonyms: Cln2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12751
HGNC: HGNC:2073
Homologene: 335
Serpina3k
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3K
Synonyms: MMSpi2, alpha-1 antiproteinase, contrapsin, MMCM2, RP54, Spi2, 1300001I07Rik, Spi-2, D12Rp54
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20714
HGNC: HGNC:16
Homologene: 111129
Vmn1r122
Name: vomeronasal 1 receptor 122
Synonyms: Gm5729
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 435951
Homologene: 104166
Spata31d1a
Name: spermatogenesis associated 31 subfamily D, member 1A
Synonyms: 1700013B16Rik, Fam75d1a, Fam75d3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72219
VEGA: 13
Homologene: 122131
Trav3-1
Name: T cell receptor alpha variable 3-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 667441
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 45,823,427 bp
  • G to A, chromosome 1 at 136,092,694 bp
  • TTGCTGCTGCTGCTGCTGCTGCTGCTGC to TTGCTGCTGCTGCTGCTGCTGCTGC, chromosome 1 at 162,709,061 bp
  • G to A, chromosome 1 at 163,964,767 bp
  • G to T, chromosome 1 at 164,053,952 bp
  • T to C, chromosome 1 at 188,533,205 bp
  • T to A, chromosome 2 at 36,421,820 bp
  • T to C, chromosome 2 at 86,959,267 bp
  • T to A, chromosome 2 at 87,192,469 bp
  • T to A, chromosome 2 at 88,005,956 bp
  • G to A, chromosome 2 at 180,191,662 bp
  • A to G, chromosome 3 at 131,271,971 bp
  • G to A, chromosome 5 at 137,396,191 bp
  • A to G, chromosome 6 at 35,301,733 bp
  • A to G, chromosome 6 at 124,403,154 bp
  • A to T, chromosome 6 at 127,608,716 bp
  • A to G, chromosome 7 at 21,133,920 bp
  • A to T, chromosome 7 at 105,749,712 bp
  • T to C, chromosome 8 at 21,065,130 bp
  • T to C, chromosome 8 at 70,838,725 bp
  • A to G, chromosome 9 at 38,658,185 bp
  • G to T, chromosome 10 at 5,262,703 bp
  • T to A, chromosome 10 at 79,729,113 bp
  • T to A, chromosome 10 at 111,270,618 bp
  • G to A, chromosome 11 at 57,765,632 bp
  • T to C, chromosome 11 at 58,219,815 bp
  • T to A, chromosome 11 at 59,759,015 bp
  • T to C, chromosome 11 at 89,052,483 bp
  • G to A, chromosome 11 at 105,005,695 bp
  • G to T, chromosome 11 at 120,096,961 bp
  • A to C, chromosome 12 at 104,345,366 bp
  • A to G, chromosome 13 at 59,703,911 bp
  • T to C, chromosome 14 at 30,042,782 bp
  • T to C, chromosome 14 at 52,580,971 bp
  • G to A, chromosome 14 at 64,773,065 bp
  • A to T, chromosome 14 at 103,260,194 bp
  • T to C, chromosome 14 at 118,153,625 bp
  • T to A, chromosome 15 at 45,109,198 bp
  • A to G, chromosome 17 at 18,582,538 bp
  • A to T, chromosome 17 at 34,460,172 bp
  • A to T, chromosome 17 at 46,312,419 bp
  • A to T, chromosome 17 at 46,678,292 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6851 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044955-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.