Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6998Btlr/Mmmh
Stock Number:
045010-MU
Citation ID:
RRID:MMRRC_045010-MU
Other Names:
R6998 (G1)
Major Collection:

Strain Information

Sptbn1
Name: spectrin beta, non-erythrocytic 1
Synonyms: beta fodrin, Spnb-2, spectrin G, brain spectrin, elf3, elf1, 9930031C03Rik, non-erythrocytic, Spnb2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20742
Homologene: 2354
Slc6a6
Name: solute carrier family 6 (neurotransmitter transporter, taurine), member 6
Synonyms: Taut
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21366
Homologene: 2291
Ccdc88c
Name: coiled-coil domain containing 88C
Synonyms: Daple, 0610010D24Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68339
VEGA: 12
Homologene: 18903
Cdk11b
Name: cyclin dependent kinase 11B
Synonyms: CDK11-p110, PITSLRE proteins, CDK11-p46, CDK11-p58, Cdc2l2, Cdc2l1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12537
Homologene: 22416
Luzp1
Name: leucine zipper protein 1
Synonyms: Luzp, 2700072H04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269593
Homologene: 11545
Ahctf1
Name: AT hook containing transcription factor 1
Synonyms: 6230412P20Rik, Elys
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226747
Homologene: 9142
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 31,204,193 bp
  • A to G, chromosome 1 at 58,016,640 bp
  • T to G, chromosome 1 at 133,102,372 bp
  • C to T, chromosome 1 at 139,469,472 bp
  • G to A, chromosome 1 at 179,770,915 bp
  • G to T, chromosome 2 at 29,912,617 bp
  • T to A, chromosome 2 at 30,355,321 bp
  • A to T, chromosome 2 at 86,594,144 bp
  • A to T, chromosome 2 at 88,678,508 bp
  • T to C, chromosome 2 at 148,700,425 bp
  • A to T, chromosome 2 at 165,354,002 bp
  • T to A, chromosome 3 at 22,179,290 bp
  • A to G, chromosome 3 at 98,162,710 bp
  • G to A, chromosome 3 at 108,876,648 bp
  • T to A, chromosome 4 at 11,204,537 bp
  • A to G, chromosome 4 at 15,930,960 bp
  • T to C, chromosome 4 at 136,543,444 bp
  • G to A, chromosome 4 at 155,648,343 bp
  • T to A, chromosome 5 at 21,543,689 bp
  • T to C, chromosome 5 at 21,620,613 bp
  • T to C, chromosome 5 at 30,114,170 bp
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp
  • A to G, chromosome 6 at 70,457,589 bp
  • C to A, chromosome 6 at 91,752,438 bp
  • T to C, chromosome 6 at 124,508,902 bp
  • T to G, chromosome 7 at 10,037,757 bp
  • A to G, chromosome 7 at 118,732,897 bp
  • T to C, chromosome 7 at 141,818,714 bp
  • C to A, chromosome 8 at 35,591,356 bp
  • C to T, chromosome 9 at 13,621,185 bp
  • T to C, chromosome 9 at 27,006,442 bp
  • T to A, chromosome 9 at 50,789,621 bp
  • T to A, chromosome 9 at 72,618,505 bp
  • T to C, chromosome 9 at 121,915,993 bp
  • T to A, chromosome 10 at 4,453,937 bp
  • T to C, chromosome 10 at 40,056,503 bp
  • A to C, chromosome 11 at 7,079,026 bp
  • T to C, chromosome 11 at 30,100,633 bp
  • A to T, chromosome 11 at 93,924,612 bp
  • T to C, chromosome 11 at 95,051,462 bp
  • C to T, chromosome 11 at 106,158,690 bp
  • A to G, chromosome 11 at 119,322,899 bp
  • T to C, chromosome 12 at 69,213,906 bp
  • G to A, chromosome 12 at 86,244,184 bp
  • T to C, chromosome 12 at 100,916,852 bp
  • T to A, chromosome 12 at 112,112,194 bp
  • C to A, chromosome 12 at 115,145,492 bp
  • A to G, chromosome 13 at 4,583,851 bp
  • G to T, chromosome 13 at 11,712,166 bp
  • A to T, chromosome 14 at 50,453,433 bp
  • A to T, chromosome 14 at 50,893,021 bp
  • G to T, chromosome 15 at 6,424,649 bp
  • T to C, chromosome 15 at 101,937,872 bp
  • A to T, chromosome 18 at 84,015,841 bp
  • T to C, chromosome 19 at 17,473,112 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6998 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045010-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.