Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7040Btlr/Mmmh
Stock Number:
045013-MU
Citation ID:
RRID:MMRRC_045013-MU
Other Names:
R7040 (G1)
Major Collection:

Strain Information

Spen
Name: spen family transcription repressor
Synonyms: Mint
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56381
Homologene: 124461
Plcb4
Name: phospholipase C, beta 4
Synonyms: C230058B11Rik, A930039J07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18798
HGNC: HGNC:9059
Homologene: 8471
Ube2o
Name: ubiquitin-conjugating enzyme E2O
Synonyms: B230113M03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217342
Homologene: 11113
Patj
Name: PATJ, crumbs cell polarity complex component
Synonyms: Cipp, Inadl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12695
Homologene: 72199
Naa15
Name: N(alpha)-acetyltransferase 15, NatA auxiliary subunit
Synonyms: tubedown, Tbdn-1, mNAT1, 5730450D16Rik, Narg1, ASTBDN
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74838
Homologene: 14211
Eif4enif1
Name: eukaryotic translation initiation factor 4E nuclear import factor 1
Synonyms: Clast4, 2610509L04Rik, D11Ertd166e, A930019J01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74203
Homologene: 10522
Sorbs1
Name: sorbin and SH3 domain containing 1
Synonyms: c-Cbl-associated protein, CAP, Sh3d5, 9530001P15Rik, 2310065E01Rik, Ponsin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20411
VEGA: 19
Homologene: 83252
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to C, chromosome 1 at 46,236,809 bp
  • T to A, chromosome 2 at 37,787,684 bp
  • A to G, chromosome 2 at 133,561,684 bp
  • G to A, chromosome 2 at 135,932,262 bp
  • T to A, chromosome 3 at 51,472,784 bp
  • T to A, chromosome 3 at 63,368,923 bp
  • A to G, chromosome 4 at 44,985,362 bp
  • T to C, chromosome 4 at 98,441,080 bp
  • T to C, chromosome 4 at 118,781,986 bp
  • T to A, chromosome 4 at 141,494,382 bp
  • T to A, chromosome 4 at 154,020,452 bp
  • A to T, chromosome 5 at 114,359,744 bp
  • A to C, chromosome 7 at 26,820,759 bp
  • G to A, chromosome 7 at 42,142,242 bp
  • T to A, chromosome 7 at 64,372,486 bp
  • G to A, chromosome 7 at 96,553,496 bp
  • A to T, chromosome 7 at 102,670,730 bp
  • A to T, chromosome 7 at 104,925,510 bp
  • A to T, chromosome 7 at 107,796,565 bp
  • A to T, chromosome 7 at 122,114,399 bp
  • A to G, chromosome 7 at 128,236,725 bp
  • A to G, chromosome 7 at 141,751,457 bp
  • T to A, chromosome 8 at 106,425,009 bp
  • T to C, chromosome 9 at 21,142,223 bp
  • G to A, chromosome 9 at 44,985,693 bp
  • T to C, chromosome 9 at 78,378,401 bp
  • T to C, chromosome 9 at 119,349,038 bp
  • T to A, chromosome 9 at 123,011,614 bp
  • A to G, chromosome 10 at 39,060,162 bp
  • A to G, chromosome 10 at 42,568,378 bp
  • T to G, chromosome 11 at 3,234,040 bp
  • T to C, chromosome 11 at 116,541,860 bp
  • A to T, chromosome 13 at 19,694,328 bp
  • T to A, chromosome 13 at 55,075,454 bp
  • T to C, chromosome 14 at 52,463,475 bp
  • T to C, chromosome 14 at 60,779,792 bp
  • T to C, chromosome 14 at 78,912,205 bp
  • T to C, chromosome 14 at 123,287,855 bp
  • A to C, chromosome 15 at 6,422,251 bp
  • A to G, chromosome 15 at 97,679,112 bp
  • AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC, chromosome 15 at 101,850,378 bp
  • T to A, chromosome 15 at 103,753,578 bp
  • T to A, chromosome 16 at 21,575,022 bp
  • C to T, chromosome 16 at 87,480,929 bp
  • A to G, chromosome 17 at 20,182,934 bp
  • A to T, chromosome 17 at 21,026,532 bp
  • A to G, chromosome 17 at 22,852,290 bp
  • A to C, chromosome 17 at 80,680,915 bp
  • A to T, chromosome 18 at 20,451,852 bp
  • A to T, chromosome 18 at 37,504,717 bp
  • A to G, chromosome 18 at 44,834,462 bp
  • T to A, chromosome 19 at 11,929,954 bp
  • A to C, chromosome 19 at 39,330,337 bp
  • G to C, chromosome 19 at 40,376,800 bp
  • A to T, chromosome 19 at 46,893,535 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7040 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045013-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.