Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7040Btlr/Mmmh
Stock Number:
045013-MU
Citation ID:
RRID:MMRRC_045013-MU
Other Names:
R7040 (G1)
Major Collection:

Strain Information

Spen
Name: spen family transcription repressor
Synonyms: Mint
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56381
Homologene: 124461
Plcb4
Name: phospholipase C, beta 4
Synonyms: C230058B11Rik, A930039J07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18798
HGNC: HGNC:9059
Homologene: 8471
Ube2o
Name: ubiquitin-conjugating enzyme E2O
Synonyms: B230113M03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217342
Homologene: 11113
Patj
Name: PATJ, crumbs cell polarity complex component
Synonyms: Cipp, Inadl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12695
Homologene: 72199
Naa15
Name: N(alpha)-acetyltransferase 15, NatA auxiliary subunit
Synonyms: tubedown, Tbdn-1, mNAT1, 5730450D16Rik, Narg1, ASTBDN
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74838
Homologene: 14211
Eif4enif1
Name: eukaryotic translation initiation factor 4E nuclear import factor 1
Synonyms: Clast4, 2610509L04Rik, D11Ertd166e, A930019J01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74203
Homologene: 10522
Sorbs1
Name: sorbin and SH3 domain containing 1
Synonyms: c-Cbl-associated protein, CAP, Sh3d5, 9530001P15Rik, 2310065E01Rik, Ponsin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20411
VEGA: 19
Homologene: 83252
Kif15
Name: kinesin family member 15
Synonyms: N-10 kinesin, HKLP2, 3930402I10Rik, 3110023M17Rik, Knsl7
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 209737
VEGA: 9
Homologene: 23210
Rpap3
Name: RNA polymerase II associated protein 3
Synonyms: 2310042P20Rik, D15Ertd682e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71919
VEGA: 15
Homologene: 11613
Zfp90
Name: zinc finger protein 90
Synonyms: Nk10 expressed protein, NK10, 6430515L01Rik, Zfp64, KRAB17, Zfp83
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22751
Homologene: 86800
Zfp160
Name: zinc finger protein 160
Synonyms: 6720480D16Rik, 6720480D16Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224585
VEGA: 17
Homologene: 137372
Vps8
Name: VPS8 CORVET complex subunit
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 209018
Homologene: 44592
Bmp2
Name: bone morphogenetic protein 2
Synonyms: Bmp2a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12156
HGNC: HGNC:1069
Homologene: 926
Dsg4
Name: desmoglein 4
Synonyms: lah, CDHF13
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16769
Homologene: 65341
Tenm4
Name: teneurin transmembrane protein 4
Synonyms: l(7)-3Rn, Ten-m4, Doc4, l7Rn3, ELM2, Odz4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23966
Homologene: 8034
Ooep
Name: oocyte expressed protein
Synonyms: 2410146L05Rik, Moep19, Floped
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67968
Homologene: 12217
Muc2
Name: mucin 2
Synonyms: 2010015E03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17831
HGNC: HGNC:7512
Homologene: 136755
Fan1
Name: FANCD2/FANCI-associated nuclease 1
Synonyms: 6030441H18Rik, Mtmr15
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330554
Homologene: 45598
C1qtnf9
Name: C1q and tumor necrosis factor related protein 9
Synonyms: 9130217G22Rik, CTRP9
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239126
Homologene: 18679
Mme
Name: membrane metallo endopeptidase
Synonyms: CD10, neprilysin, 6030454K05Rik, NEP, neutral endopeptidase
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17380
HGNC: HGNC:7154
Homologene: 5275
Uimc1
Name: ubiquitin interaction motif containing 1
Synonyms: D630032M02Rik, D330018D10Rik, 9430016E08Rik, Rxrip110
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20184
Homologene: 9455
Cdc37
Name: cell division cycle 37
Synonyms: p50Cdc37
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12539
VEGA: 9
HGNC: HGNC:1735
Homologene: 38268
Lrrc47
Name: leucine rich repeat containing 47
Synonyms: 2900010D03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72946
Homologene: 10795
Patl1
Name: protein associated with topoisomerase II homolog 1 (yeast)
Synonyms: Pat1b
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225929
VEGA: 19
Homologene: 82269
Map4k3
Name: mitogen-activated protein kinase kinase kinase kinase 3
Synonyms: 9530052P13Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 225028
VEGA: 17
HGNC: HGNC:6865
Homologene: 2683
Ythdc2
Name: YTH domain containing 2
Synonyms: 3010002F02Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240255
Homologene: 11265
Nr2e1
Name: nuclear receptor subfamily 2, group E, member 1
Synonyms: Nr2e1, Tlx, Mtll, tailless
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21907
HGNC: HGNC:7973
Homologene: 37750
Lama4
Name: laminin, alpha 4
Synonyms: laminin [a]4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16775
HGNC: HGNC:6484
Homologene: 37604
Nalcn
Name: sodium leak channel, non-selective
Synonyms: A530023G15Rik, Vgcnl1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 338370
VEGA: 14
Homologene: 21832
Vwa8
Name: von Willebrand factor A domain containing 8
Synonyms: 4932416F07Rik, 1300010F03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219189
VEGA: 14
Homologene: 44881
Grhpr
Name: glyoxylate reductase/hydroxypyruvate reductase
Synonyms: 6430629L09Rik, 1110059D05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76238
HGNC: HGNC:4570
Homologene: 49088
Myo1h
Name: myosin 1H
Synonyms: 4631401O15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231646
Homologene: 82639
Cyp2g1
Name: cytochrome P450, family 2, subfamily g, polypeptide 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13108
HGNC: HGNC:2633
Homologene: 75020
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: LOC227058, Dnahc7b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227058
Homologene: 41287
Nme8
Name: NME/NM23 family member 8
Synonyms: 1700056P15Rik, Sptrx-2, Txndc3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 73412
Homologene: 9593
Or4e1
Name: olfactory receptor family 4 subfamily E member 1
Synonyms: GA_x6K02T2RJGY-520647-521579, MOR244-2, MOR244-4, MOR10, Olfr1508
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 57270
HGNC: HGNC:8296
Homologene: 10737
Fpr-rs6
Name: formyl peptide receptor, related sequence 6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 321020
Homologene: 104303
Dab2
Name: disabled 2, mitogen-responsive phosphoprotein
Synonyms: D15Wsu122e, 5730435J12Rik, p96, D630005B22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 13132
HGNC: HGNC:2662
Homologene: 1026
Or52i2
Name: olfactory receptor family 52 subfamily J member 2
Synonyms: GA_x6K02T2PBJ9-5386601-5387575, MOR41-1, Olfr556
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258749
Homologene: 17380
Vmn2r60
Name: vomeronasal 2, receptor 60
Synonyms: Casr-rs3, EG637898, Gprc2a-rs3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 637898
Homologene: 129683
Zfp696
Name: zinc finger protein 696
Synonyms: 9130023H24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043133
Usp16
Name: ubiquitin specific peptidase 16
Synonyms: 2810483I07Rik, UBP-M, 1200004E02Rik, 6330514E22Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74112
Homologene: 38183
Ovch2
Name: ovochymase 2
Synonyms: 9230106D23Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244199
Homologene: 18255
Cyp2c29
Name: cytochrome P450, family 2, subfamily c, polypeptide 29
Synonyms: AHOH, AHOHase, Ahh-1, Ah-2, P450-2C, Cyp2c
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13095
Homologene: 117948
Zfp945
Name: zinc finger protein 945
Synonyms: C730040L01Rik, A630033E08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240041
Homologene: 133214
Krt1
Name: keratin 1
Synonyms: Krt2-1, Krt-2.1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16678
VEGA: 15
HGNC: HGNC:6412
Homologene: 38146
Nt5c2
Name: 5'-nucleotidase, cytosolic II
Synonyms: cN-II, PNT5, NT5B
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 76952
HGNC: HGNC:8022
Homologene: 8158
Acaa1a
Name: acetyl-Coenzyme A acyltransferase 1A
Synonyms: peroxisomal 3-ketoacyl-CoA thiolase, PTL, D9Ertd25e, Acaa1, thiolase A
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 113868
HGNC: HGNC:82
Homologene: 37497
Pcdhb20
Name: protocadherin beta 20
Synonyms: Pcdhb14, PcdhbT
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93891
HGNC: HGNC:8685
Homologene: 134303
Or10ak13
Name: olfactory receptor family 10 subfamily AK member 13
Synonyms: GA_x6K02SYWGW3-414-3, GA_x6K02T2QD9B-18767132-18768073, MOR259-10, Olfr219-ps1, Olfr1337
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 258306
Homologene: 121524
Crb2
Name: crumbs family member 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241324
Homologene: 45474
Or52n2c
Name: olfactory receptor family 52 subfamily N member 2C
Synonyms: GA_x6K02T2PBJ9-7554614-7553658, MOR34-3, Olfr668
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259061
Homologene: 64947
Cd3d
Name: CD3 antigen, delta polypeptide
Synonyms: T3d
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12500
VEGA: 9
HGNC: HGNC:1673
Homologene: 585
Mucl1
Name: mucin-like 1
Synonyms: Spt-2, Spt2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20771
Homologene: 137219
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to C, chromosome 1 at 46,236,809 bp
  • T to A, chromosome 2 at 37,787,684 bp
  • A to G, chromosome 2 at 133,561,684 bp
  • G to A, chromosome 2 at 135,932,262 bp
  • T to A, chromosome 3 at 51,472,784 bp
  • T to A, chromosome 3 at 63,368,923 bp
  • A to G, chromosome 4 at 44,985,362 bp
  • T to C, chromosome 4 at 98,441,080 bp
  • T to C, chromosome 4 at 118,781,986 bp
  • T to A, chromosome 4 at 141,494,382 bp
  • T to A, chromosome 4 at 154,020,452 bp
  • A to T, chromosome 5 at 114,359,744 bp
  • A to C, chromosome 7 at 26,820,759 bp
  • G to A, chromosome 7 at 42,142,242 bp
  • T to A, chromosome 7 at 64,372,486 bp
  • G to A, chromosome 7 at 96,553,496 bp
  • A to T, chromosome 7 at 102,670,730 bp
  • A to T, chromosome 7 at 104,925,510 bp
  • A to T, chromosome 7 at 107,796,565 bp
  • A to T, chromosome 7 at 122,114,399 bp
  • A to G, chromosome 7 at 128,236,725 bp
  • A to G, chromosome 7 at 141,751,457 bp
  • T to A, chromosome 8 at 106,425,009 bp
  • T to C, chromosome 9 at 21,142,223 bp
  • G to A, chromosome 9 at 44,985,693 bp
  • T to C, chromosome 9 at 78,378,401 bp
  • T to C, chromosome 9 at 119,349,038 bp
  • T to A, chromosome 9 at 123,011,614 bp
  • A to G, chromosome 10 at 39,060,162 bp
  • A to G, chromosome 10 at 42,568,378 bp
  • T to G, chromosome 11 at 3,234,040 bp
  • T to C, chromosome 11 at 116,541,860 bp
  • A to T, chromosome 13 at 19,694,328 bp
  • T to A, chromosome 13 at 55,075,454 bp
  • T to C, chromosome 14 at 52,463,475 bp
  • T to C, chromosome 14 at 60,779,792 bp
  • T to C, chromosome 14 at 78,912,205 bp
  • T to C, chromosome 14 at 123,287,855 bp
  • A to C, chromosome 15 at 6,422,251 bp
  • A to G, chromosome 15 at 97,679,112 bp
  • AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC, chromosome 15 at 101,850,378 bp
  • T to A, chromosome 15 at 103,753,578 bp
  • T to A, chromosome 16 at 21,575,022 bp
  • C to T, chromosome 16 at 87,480,929 bp
  • A to G, chromosome 17 at 20,182,934 bp
  • A to T, chromosome 17 at 21,026,532 bp
  • A to G, chromosome 17 at 22,852,290 bp
  • A to C, chromosome 17 at 80,680,915 bp
  • A to T, chromosome 18 at 20,451,852 bp
  • A to T, chromosome 18 at 37,504,717 bp
  • A to G, chromosome 18 at 44,834,462 bp
  • T to A, chromosome 19 at 11,929,954 bp
  • A to C, chromosome 19 at 39,330,337 bp
  • G to C, chromosome 19 at 40,376,800 bp
  • A to T, chromosome 19 at 46,893,535 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7040 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045013-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.