Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6828Btlr/Mmmh
Stock Number:
045020-MU
Citation ID:
RRID:MMRRC_045020-MU
Other Names:
R6828 (G1)
Major Collection:

Strain Information

Npr1
Name: natriuretic peptide receptor 1
Synonyms: NPRA, GC-A, NPR-A, guanylyl cyclase-A
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18160
HGNC: HGNC:7943
Homologene: 37367
Lamb3
Name: laminin, beta 3
Synonyms: nicein, 125kDa
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16780
HGNC: HGNC:6490
Homologene: 191
Itk
Name: IL2 inducible T cell kinase
Synonyms: Emt, Tsk, Tcsk
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16428
HGNC: HGNC:6171
Homologene: 4051
Rpa1
Name: replication protein A1
Synonyms: Rpa, RF-A, RP-A, 5031405K23Rik, 70kDa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68275
Homologene: 2208
Zfp553
Name: zinc finger protein 553
Synonyms: C330013F15Rik, 2600009K23Rik, ENSMUSG00000054461
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233887
Homologene: 27098
Pibf1
Name: progesterone immunomodulatory binding factor 1
Synonyms: 1700017E21Rik, 4933438D16Rik, 4933439E17Rik, 4930513H15Rik, D14Ertd581e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 52023
VEGA: 14
Homologene: 4628
Rock2
Name: Rho-associated coiled-coil containing protein kinase 2
Synonyms: Rock-II, B230113H15Rik, Rho-kinase, ROKalpha, Rock2m
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 19878
VEGA: 12
Homologene: 21010
Aurka
Name: aurora kinase A
Synonyms: Ayk1, Ark1, IAK, AIRK1, aurora A, Aurora-A, Stk6, IAK1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20878
Homologene: 2670
Usp15
Name: ubiquitin specific peptidase 15
Synonyms: Gcap18, 4921514G19Rik, E430033I05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14479
VEGA: 10
Homologene: 101542
Fry
Name: FRY microtubule binding protein
Synonyms: cg003, 9330186A19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320365
Homologene: 113770
Ccar1
Name: cell division cycle and apoptosis regulator 1
Synonyms: Carp1, 2610511G16Rik, 9430036H15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67500
VEGA: 10
Homologene: 10086
Srrt
Name: serrate RNA effector molecule homolog (Arabidopsis)
Synonyms: Asr2, Ars2, 2810019G02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 83701
Homologene: 9298
Sipa1l3
Name: signal-induced proliferation-associated 1 like 3
Synonyms: 2610511M17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74206
Homologene: 77938
Akap12
Name: A kinase anchor protein 12
Synonyms: SSeCKS, Tsga12, Srcs5
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 83397
VEGA: 10
HGNC: HGNC:370
Homologene: 3740
Dmxl1
Name: Dmx-like 1
Synonyms: C630007L23Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240283
HGNC: HGNC:2937
Homologene: 21136
Lpin2
Name: lipin 2
Synonyms: 2610511G02Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 64898
Homologene: 8769
Ash1l
Name: ASH1 like histone lysine methyltransferase
Synonyms: chromatin remodeling factor, 8030453L17Rik, E430018P19Rik, KMT2H
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 192195
Homologene: 10225
Ikzf5
Name: IKAROS family zinc finger 5
Synonyms: 2610034F18Rik, Zfpn1a5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67143
Homologene: 23363
Tmem131
Name: transmembrane protein 131
Synonyms: CC28, 2610524E03Rik, YR-23, D1Bwg0491e, Neg, Rw1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56030
Homologene: 32428
Nsd2
Name: nuclear receptor binding SET domain protein 2
Synonyms: 5830445G22Rik, Whsc1l, 9430010A17Rik, D030027O06Rik, C130020C13Rik, D930023B08Rik, Whsc1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 107823
Homologene: 26175
Abca17
Name: ATP-binding cassette, sub-family A member 17
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381072
Homologene: 86807
Clec14a
Name: C-type lectin domain family 14, member a
Synonyms: 1200003C23Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66864
VEGA: 12
Homologene: 12047
Olfm4
Name: olfactomedin 4
Synonyms: LOC239192, LOC380924, GC1, OlfD, GW112, pPD4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 380924
VEGA: 14
Homologene: 4684
Mxd3
Name: Max dimerization protein 3
Synonyms: 4631412E13Rik, Mad3, bHLHc13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17121
Homologene: 32333
Ctps1
Name: cytidine 5'-triphosphate synthase 1
Synonyms: Ctps
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 51797
HGNC: HGNC:2519
Homologene: 20446
Arid3b
Name: AT-rich interaction domain 3B
Synonyms: Bdp, Dri2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56380
Homologene: 4721
Apeh
Name: acylpeptide hydrolase
Synonyms: N-acylaminoacyl peptide hydrolase
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235606
HGNC: HGNC:586
Homologene: 1240
Dennd5b
Name: DENN domain containing 5B
Synonyms: 9330160C06Rik, D030011O10Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320560
Homologene: 44911
Col11a2
Name: collagen, type XI, alpha 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12815
HGNC: HGNC:2187
Homologene: 22547
Col5a3
Name: collagen, type V, alpha 3
Synonyms: Pro-alpha3(V)
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 53867
Homologene: 9253
Zim1
Name: zinc finger, imprinted 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22776
Homologene: 129793
Aplnr
Name: apelin receptor
Synonyms: msr/apj, apelin receptor, APJ, Agtrl1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 23796
HGNC: HGNC:339
Homologene: 3784
Snrk
Name: SNF related kinase
Synonyms: SNRK, 2010012F07Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20623
Homologene: 9797
Man2b1
Name: mannosidase 2, alpha B1
Synonyms: lysosomal alpha-mannosidase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17159
HGNC: HGNC:6826
Homologene: 37322
Cracdl
Name: capping protein inhibiting regulator of actin like
Synonyms: 2010300C02Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72097
Homologene: 19208
Or5p80
Name: olfactory receptor family 5 subfamily P member 80
Synonyms: GA_x6K02T2PBJ9-10959726-10960658, MOR204-6, Olfr508
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258769
Homologene: 72039
Taok2
Name: TAO kinase 2
Synonyms: TAO1, PSK1, 1110033K02Rik, MAP3K17, TAO2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381921
Homologene: 74531
Clk3
Name: CDC-like kinase 3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102414
VEGA: 9
HGNC: HGNC:2071
Homologene: 101534
Gria1
Name: glutamate receptor, ionotropic, AMPA1 (alpha 1)
Synonyms: GluR1, GluR-A, Glr-1, Glur-1, Glur1, GluRA, Glr1, 2900051M01Rik, HIPA1, GluA1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14799
HGNC: HGNC:4571
Homologene: 20226
Frmpd1
Name: FERM and PDZ domain containing 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 666060
Homologene: 8939
Meak7
Name: MTOR associated protein, eak-7 homolog
Synonyms: 4632415K11Rik, Tldc1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74347
Homologene: 32494
Rhoj
Name: ras homolog family member J
Synonyms: TCL, 1110005O19Rik, TC10L, Arhj
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 80837
HGNC: HGNC:688
Homologene: 56894
Foxs1
Name: forkhead box S1
Synonyms: FREAC10, Fkh3, Fkhl18
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14239
HGNC: HGNC:3735
Homologene: 20871
Ap2s1
Name: adaptor-related protein complex 2, sigma 1 subunit
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232910
HGNC: HGNC:565
Homologene: 3001
Fam170b
Name: family with sequence similarity 170, member B
Synonyms: 4922501K12Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105511
VEGA: 14
Homologene: 19055
Calhm4
Name: calcium homeostasis modulator family member 4
Synonyms: LOC270711, 4732454E20Rik, Fam26d
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 270711
VEGA: 10
Homologene: 19551
Igdcc4
Name: immunoglobulin superfamily, DCC subclass, member 4
Synonyms: 9330155G14Rik, WI-18508, Nope, WI-16786
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56741
VEGA: 9
Homologene: 10570
Crb2
Name: crumbs family member 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241324
Homologene: 45474
Pecr
Name: peroxisomal trans-2-enoyl-CoA reductase
Synonyms: 2400003B18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 111175
Homologene: 69255
Cd8b1
Name: CD8 subunit beta 1
Synonyms: Ly-C, Ly-3, Lyt-3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12526
Homologene: 3621
Or6c3b
Name: olfactory receptor family 6 subfamily C member 3B
Synonyms: GA_x6K02T2PULF-11370664-11369738, MOR111-3, Olfr803
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258547
Homologene: 105153
Sdf2l1
Name: stromal cell-derived factor 2-like 1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 64136
Homologene: 11101
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 36,804,643 bp
  • T to C, chromosome 1 at 37,624,817 bp
  • C to A, chromosome 1 at 72,267,457 bp
  • A to T, chromosome 1 at 133,897,867 bp
  • A to G, chromosome 1 at 193,335,448 bp
  • ACTGCTGCTGCTGCTGCTGCTGC to ACTGCTGCTGCTGCTGCTGC, chromosome 2 at 37,776,409 bp
  • G to A, chromosome 2 at 85,139,759 bp
  • G to A, chromosome 2 at 152,933,128 bp
  • T to A, chromosome 2 at 172,357,252 bp
  • A to C, chromosome 3 at 89,076,113 bp
  • C to A, chromosome 3 at 90,464,813 bp
  • T to C, chromosome 4 at 45,275,383 bp
  • A to T, chromosome 4 at 120,548,138 bp
  • C to T, chromosome 5 at 33,893,568 bp
  • A to T, chromosome 5 at 137,296,968 bp
  • G to A, chromosome 5 at 150,466,446 bp
  • T to C, chromosome 6 at 67,759,713 bp
  • T to C, chromosome 6 at 71,334,116 bp
  • A to G, chromosome 6 at 148,993,746 bp
  • T to C, chromosome 7 at 6,677,689 bp
  • T to C, chromosome 7 at 16,748,701 bp
  • G to A, chromosome 7 at 29,339,032 bp
  • A to C, chromosome 7 at 108,630,293 bp
  • A to T, chromosome 7 at 126,871,875 bp
  • A to G, chromosome 7 at 127,236,275 bp
  • A to T, chromosome 7 at 131,391,672 bp
  • C to A, chromosome 8 at 85,086,919 bp
  • G to A, chromosome 8 at 119,772,567 bp
  • C to T, chromosome 9 at 20,798,452 bp
  • G to A, chromosome 9 at 57,760,849 bp
  • A to G, chromosome 9 at 57,810,163 bp
  • T to C, chromosome 9 at 65,122,697 bp
  • A to G, chromosome 9 at 108,087,038 bp
  • T to C, chromosome 9 at 122,137,566 bp
  • A to G, chromosome 10 at 4,354,606 bp
  • A to G, chromosome 10 at 34,043,957 bp
  • C to A, chromosome 10 at 62,764,430 bp
  • T to C, chromosome 10 at 123,127,989 bp
  • A to T, chromosome 10 at 129,691,994 bp
  • G to A, chromosome 11 at 46,341,218 bp
  • A to G, chromosome 11 at 57,289,462 bp
  • G to A, chromosome 11 at 75,314,871 bp
  • G to A, chromosome 12 at 16,942,959 bp
  • T to C, chromosome 12 at 58,268,504 bp
  • A to G, chromosome 12 at 75,308,879 bp
  • T to C, chromosome 13 at 55,326,154 bp
  • A to G, chromosome 14 at 32,835,958 bp
  • A to G, chromosome 14 at 80,021,533 bp
  • A to G, chromosome 14 at 99,186,551 bp
  • C to G, chromosome 16 at 17,132,294 bp
  • A to T, chromosome 17 at 24,326,415 bp
  • A to G, chromosome 17 at 34,053,633 bp
  • T to C, chromosome 17 at 71,222,128 bp
  • C to T, chromosome 18 at 49,921,024 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6828 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045020-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.