Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6828Btlr/Mmmh
Stock Number:
045020-MU
Citation ID:
RRID:MMRRC_045020-MU
Other Names:
R6828 (G1)
Major Collection:

Strain Information

Npr1
Name: natriuretic peptide receptor 1
Synonyms: NPRA, GC-A, NPR-A, guanylyl cyclase-A
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18160
HGNC: HGNC:7943
Homologene: 37367
Lamb3
Name: laminin, beta 3
Synonyms: nicein, 125kDa
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16780
HGNC: HGNC:6490
Homologene: 191
Itk
Name: IL2 inducible T cell kinase
Synonyms: Emt, Tsk, Tcsk
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16428
HGNC: HGNC:6171
Homologene: 4051
Rpa1
Name: replication protein A1
Synonyms: Rpa, RF-A, RP-A, 5031405K23Rik, 70kDa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68275
Homologene: 2208
Zfp553
Name: zinc finger protein 553
Synonyms: C330013F15Rik, 2600009K23Rik, ENSMUSG00000054461
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233887
Homologene: 27098
Pibf1
Name: progesterone immunomodulatory binding factor 1
Synonyms: 1700017E21Rik, 4933438D16Rik, 4933439E17Rik, 4930513H15Rik, D14Ertd581e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 52023
VEGA: 14
Homologene: 4628
Rock2
Name: Rho-associated coiled-coil containing protein kinase 2
Synonyms: Rock-II, B230113H15Rik, Rho-kinase, ROKalpha, Rock2m
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 19878
VEGA: 12
Homologene: 21010
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 36,804,643 bp
  • T to C, chromosome 1 at 37,624,817 bp
  • C to A, chromosome 1 at 72,267,457 bp
  • A to T, chromosome 1 at 133,897,867 bp
  • A to G, chromosome 1 at 193,335,448 bp
  • ACTGCTGCTGCTGCTGCTGCTGC to ACTGCTGCTGCTGCTGCTGC, chromosome 2 at 37,776,409 bp
  • G to A, chromosome 2 at 85,139,759 bp
  • G to A, chromosome 2 at 152,933,128 bp
  • T to A, chromosome 2 at 172,357,252 bp
  • A to C, chromosome 3 at 89,076,113 bp
  • C to A, chromosome 3 at 90,464,813 bp
  • T to C, chromosome 4 at 45,275,383 bp
  • A to T, chromosome 4 at 120,548,138 bp
  • C to T, chromosome 5 at 33,893,568 bp
  • A to T, chromosome 5 at 137,296,968 bp
  • G to A, chromosome 5 at 150,466,446 bp
  • T to C, chromosome 6 at 67,759,713 bp
  • T to C, chromosome 6 at 71,334,116 bp
  • A to G, chromosome 6 at 148,993,746 bp
  • T to C, chromosome 7 at 6,677,689 bp
  • T to C, chromosome 7 at 16,748,701 bp
  • G to A, chromosome 7 at 29,339,032 bp
  • A to C, chromosome 7 at 108,630,293 bp
  • A to T, chromosome 7 at 126,871,875 bp
  • A to G, chromosome 7 at 127,236,275 bp
  • A to T, chromosome 7 at 131,391,672 bp
  • C to A, chromosome 8 at 85,086,919 bp
  • G to A, chromosome 8 at 119,772,567 bp
  • C to T, chromosome 9 at 20,798,452 bp
  • G to A, chromosome 9 at 57,760,849 bp
  • A to G, chromosome 9 at 57,810,163 bp
  • T to C, chromosome 9 at 65,122,697 bp
  • A to G, chromosome 9 at 108,087,038 bp
  • T to C, chromosome 9 at 122,137,566 bp
  • A to G, chromosome 10 at 4,354,606 bp
  • A to G, chromosome 10 at 34,043,957 bp
  • C to A, chromosome 10 at 62,764,430 bp
  • T to C, chromosome 10 at 123,127,989 bp
  • A to T, chromosome 10 at 129,691,994 bp
  • G to A, chromosome 11 at 46,341,218 bp
  • A to G, chromosome 11 at 57,289,462 bp
  • G to A, chromosome 11 at 75,314,871 bp
  • G to A, chromosome 12 at 16,942,959 bp
  • T to C, chromosome 12 at 58,268,504 bp
  • A to G, chromosome 12 at 75,308,879 bp
  • T to C, chromosome 13 at 55,326,154 bp
  • A to G, chromosome 14 at 32,835,958 bp
  • A to G, chromosome 14 at 80,021,533 bp
  • A to G, chromosome 14 at 99,186,551 bp
  • C to G, chromosome 16 at 17,132,294 bp
  • A to T, chromosome 17 at 24,326,415 bp
  • A to G, chromosome 17 at 34,053,633 bp
  • T to C, chromosome 17 at 71,222,128 bp
  • C to T, chromosome 18 at 49,921,024 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6828 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045020-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.