Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6916Btlr/Mmmh
Stock Number:
045037-MU
Citation ID:
RRID:MMRRC_045037-MU
Other Names:
R6916 (G1)
Major Collection:

Strain Information

Frem2
Name: Fras1 related extracellular matrix protein 2
Synonyms: 8430406N05Rik, 6030440P17Rik, my, ne, b2b1562Clo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242022
Homologene: 18454
Bahcc1
Name: BAH domain and coiled-coil containing 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268515
Homologene: 129585
Usp48
Name: ubiquitin specific peptidase 48
Synonyms: D330022K21Rik, 2810449C13Rik, Usp31
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 170707
Homologene: 12988
Ints3
Name: integrator complex subunit 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229543
Homologene: 11309
Fbxl20
Name: F-box and leucine-rich repeat protein 20
Synonyms: C86145, Fbl2, 2610511F20Rik, 4632423N09Rik, Scr, Scrapper
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72194
Homologene: 68784
Kifbp
Name: kinesin family binding protein
Synonyms: 2510003E04Rik, Kif1bp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 72320
Homologene: 9223
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 58,910,025 bp
  • C to T, chromosome 2 at 32,752,653 bp
  • A to T, chromosome 2 at 35,010,032 bp
  • A to T, chromosome 2 at 59,968,776 bp
  • C to A, chromosome 2 at 73,437,404 bp
  • A to T, chromosome 2 at 84,609,646 bp
  • A to C, chromosome 2 at 131,179,624 bp
  • A to T, chromosome 2 at 143,974,598 bp
  • T to C, chromosome 3 at 53,547,688 bp
  • C to T, chromosome 3 at 66,994,649 bp
  • A to G, chromosome 3 at 86,084,911 bp
  • T to C, chromosome 3 at 89,276,388 bp
  • T to C, chromosome 3 at 90,406,334 bp
  • G to T, chromosome 3 at 100,888,163 bp
  • T to C, chromosome 3 at 105,680,613 bp
  • T to C, chromosome 3 at 121,207,156 bp
  • A to G, chromosome 4 at 33,943,897 bp
  • T to C, chromosome 4 at 137,638,233 bp
  • A to T, chromosome 4 at 150,867,473 bp
  • T to C, chromosome 5 at 24,537,856 bp
  • G to T, chromosome 5 at 26,019,348 bp
  • G to A, chromosome 5 at 65,225,334 bp
  • T to A, chromosome 5 at 87,254,600 bp
  • T to A, chromosome 5 at 104,974,735 bp
  • T to A, chromosome 6 at 48,931,053 bp
  • A to T, chromosome 6 at 129,053,811 bp
  • T to A, chromosome 7 at 4,527,533 bp
  • T to C, chromosome 7 at 44,629,313 bp
  • T to C, chromosome 7 at 45,459,540 bp
  • T to C, chromosome 7 at 50,701,179 bp
  • A to T, chromosome 7 at 141,864,717 bp
  • C to A, chromosome 8 at 45,350,406 bp
  • G to T, chromosome 8 at 119,467,616 bp
  • T to C, chromosome 9 at 38,982,904 bp
  • C to A, chromosome 9 at 59,525,474 bp
  • A to G, chromosome 9 at 74,155,039 bp
  • A to G, chromosome 9 at 110,626,108 bp
  • T to C, chromosome 10 at 5,227,912 bp
  • C to A, chromosome 10 at 7,608,714 bp
  • T to C, chromosome 10 at 33,157,018 bp
  • T to C, chromosome 10 at 62,566,064 bp
  • C to A, chromosome 10 at 117,045,549 bp
  • A to T, chromosome 10 at 120,201,365 bp
  • G to A, chromosome 11 at 23,458,023 bp
  • T to A, chromosome 11 at 73,777,069 bp
  • T to A, chromosome 11 at 98,113,253 bp
  • C to A, chromosome 11 at 108,859,376 bp
  • T to A, chromosome 11 at 120,273,009 bp
  • T to A, chromosome 12 at 71,164,544 bp
  • C to T, chromosome 12 at 105,591,779 bp
  • C to T, chromosome 14 at 7,907,171 bp
  • A to T, chromosome 14 at 30,095,364 bp
  • A to T, chromosome 14 at 54,665,416 bp
  • T to A, chromosome 14 at 80,014,198 bp
  • T to C, chromosome 15 at 38,677,581 bp
  • C to T, chromosome 15 at 101,936,170 bp
  • T to A, chromosome 16 at 10,509,207 bp
  • T to A, chromosome 16 at 91,654,785 bp
  • T to C, chromosome 17 at 37,169,973 bp
  • G to A, chromosome 18 at 5,114,682 bp
  • A to T, chromosome 18 at 37,422,381 bp
  • ATCCTCCTCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTCCTC, chromosome 19 at 42,766,725 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6916 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045037-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.