Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6933Btlr/Mmmh
Stock Number:
045048-MU
Citation ID:
RRID:MMRRC_045048-MU
Other Names:
R6933 (G1)
Major Collection:

Strain Information

Ccr2
Name: C-C motif chemokine receptor 2
Synonyms: CC-CKR-2, CKR2B, CKR2A, CCR2B, CCR2A, CKR2, Cmkbr2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12772
HGNC: HGNC:1603
Homologene: 537
Ep400
Name: E1A binding protein p400
Synonyms: p400, mDomino, 1700020J09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75560
Homologene: 38779
Taok1
Name: TAO kinase 1
Synonyms: D130018F14Rik, 2810468K05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216965
Homologene: 27041
Rapgef2
Name: Rap guanine nucleotide exchange factor (GEF) 2
Synonyms: 5830453M24Rik, Pdzgef1, RA-GEF-1, CNRasGEF, nRapGEP
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76089
Homologene: 35477
Polr2a
Name: polymerase (RNA) II (DNA directed) polypeptide A
Synonyms: 220kDa, Rpo2-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20020
HGNC: HGNC:9187
Homologene: 721
Sfpq
Name: splicing factor proline/glutamine rich (polypyrimidine tract binding protein associated)
Synonyms: D4Ertd314e, 9030402K04Rik, 2810416M14Rik, 5730453G22Rik, 1110004P21Rik, REP1, PSF
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 71514
Homologene: 3714
Cdc40
Name: cell division cycle 40
Synonyms: PRP17, EHB3, 1200003H23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71713
VEGA: 10
Homologene: 5716
Ank3
Name: ankyrin 3, epithelial
Synonyms: Ank-3, Ankyrin-3, AnkG, 2900054D09Rik, Ankyrin-G
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11735
HGNC: HGNC:494
Homologene: 56908
Tg
Name: thyroglobulin
Synonyms: Tgn
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 21819
Homologene: 2430
Lrpprc
Name: leucine-rich PPR-motif containing
Synonyms: Lrp130, 3110001K13Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72416
Homologene: 32695
Washc3
Name: WASH complex subunit 3
Synonyms: 5730495F03Rik, 2900091E11Rik, Ccdc53
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67282
Homologene: 9364
Traf3
Name: TNF receptor-associated factor 3
Synonyms: LAP1, CAP-1, CD40bp, CRAF1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 22031
Homologene: 7981
Fam114a2
Name: family with sequence similarity 114, member A2
Synonyms: 9030624B09Rik, 1810073G14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67726
HGNC: HGNC:1333
Homologene: 10270
Sox11
Name: SRY (sex determining region Y)-box 11
Synonyms: end1, 6230403H02Rik, 1110038H03Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20666
Homologene: 37733
Sbf1
Name: SET binding factor 1
Synonyms: Mtmr5, B230113C15Rik, 2610510A08Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 77980
Homologene: 84710
Vps26b
Name: VPS26 retromer complex component B
Synonyms: 1810012I05Rik, 2310075A12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69091
VEGA: 9
Homologene: 3601
Ptpn4
Name: protein tyrosine phosphatase, non-receptor type 4
Synonyms: hPTP-MEG, protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte), TEP/mPTPMEG, testis-enriched phosphatase, TEP, PTPMEG
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19258
HGNC: HGNC:9656
Homologene: 2120
Nr1h2
Name: nuclear receptor subfamily 1, group H, member 2
Synonyms: RIP15, LXRbeta, LXRB, Unr2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22260
HGNC: HGNC:7965
Homologene: 21397
Zfhx4
Name: zinc finger homeodomain 4
Synonyms: Zfh-4, C130041O22Rik, Zfh4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80892
Homologene: 23477
Cmya5
Name: cardiomyopathy associated 5
Synonyms: Myospryn, 2310076E16Rik, 2310076E21Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76469
VEGA: 13
Homologene: 137367
Xirp2
Name: xin actin-binding repeat containing 2
Synonyms: A530024P18Rik, 2310008C07Rik, 2310003D02Rik, mXin beta, myomaxin, Cmya3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241431
Homologene: 19388
Sox21
Name: SRY (sex determining region Y)-box 21
Synonyms: Sox25
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 223227
Homologene: 5143
Tspyl3
Name: TSPY-like 3
Synonyms: LOC241732
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241732
Homologene: 19093
Clk3
Name: CDC-like kinase 3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102414
VEGA: 9
HGNC: HGNC:2071
Homologene: 101534
Pnpla8
Name: patatin-like phospholipase domain containing 8
Synonyms: 1200006O19Rik, iPLA2 gamma
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 67452
Homologene: 12136
Mndal
Name: myeloid nuclear differentiation antigen like
Synonyms: Ifi212
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100040462
HGNC: HGNC:5395
Homologene: 115929
Shank2
Name: SH3 and multiple ankyrin repeat domains 2
Synonyms: ProSAP1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210274
Homologene: 105965
Myom1
Name: myomesin 1
Synonyms: skelemin, D430047A17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17929
VEGA: 17
HGNC: HGNC:7613
Homologene: 31196
Cntnap5b
Name: contactin associated protein-like 5B
Synonyms: Caspr5-2, C230078M14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241175
Homologene: 104295
Slc22a23
Name: solute carrier family 22, member 23
Synonyms: 3110004L20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 73102
Homologene: 41457
Fam83e
Name: family with sequence similarity 83, member E
Synonyms: 4930403C10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73813
Homologene: 9791
Elovl4
Name: ELOVL fatty acid elongase 4
Synonyms: elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83603
Homologene: 41488
Fnip2
Name: folliculin interacting protein 2
Synonyms: D630023B12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329679
Homologene: 46417
Cfap61
Name: cilia and flagella associated protein 61
Synonyms: 4930529M08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78774
Vmn2r86
Name: vomeronasal 2, receptor 86
Synonyms: EG625109
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 625109
Homologene: 129606
Dync1i1
Name: dynein cytoplasmic 1 intermediate chain 1
Synonyms: IC74, DIC, Dncic1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13426
HGNC: HGNC:2963
Homologene: 68398
Antxrl
Name: anthrax toxin receptor-like
Synonyms: 1700112N15Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239029
VEGA: 14
Homologene: 52111
Anks6
Name: ankyrin repeat and sterile alpha motif domain containing 6
Synonyms: LOC269533, 2210417J20Rik, Samd6, SamCystin, b2b1801.1Clo
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75691
Homologene: 19545
Anks1b
Name: ankyrin repeat and sterile alpha motif domain containing 1B
Synonyms: LOC380650, C030032C09Rik, E530015N03Rik, AIDA-1b, Gm10937
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 77531
Homologene: 51570
Or52n2c
Name: olfactory receptor family 52 subfamily N member 2C
Synonyms: GA_x6K02T2PBJ9-7554614-7553658, MOR34-3, Olfr668
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259061
Homologene: 64947
Ccnl1
Name: cyclin L1
Synonyms: ania-6a, 2610030E23Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56706
Homologene: 10541
Cfap97d2
Name: CFAP97 domain containing 2
Synonyms: 4932443I19Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 403185
Pet117
Name: PET117 homolog
Synonyms: Gm20571
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 100048644
Homologene: 130056
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 100,383,450 bp
  • T to C, chromosome 1 at 119,773,148 bp
  • T to A, chromosome 1 at 173,875,683 bp
  • C to A, chromosome 2 at 67,514,857 bp
  • T to A, chromosome 2 at 144,369,099 bp
  • T to A, chromosome 2 at 145,951,050 bp
  • T to C, chromosome 2 at 153,225,283 bp
  • T to C, chromosome 3 at 5,412,987 bp
  • A to T, chromosome 3 at 55,723,610 bp
  • T to C, chromosome 3 at 65,947,952 bp
  • A to T, chromosome 3 at 79,085,959 bp
  • A to T, chromosome 3 at 79,518,111 bp
  • A to G, chromosome 4 at 47,049,164 bp
  • GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC to GCCGCCGCAGCAGCC, chromosome 4 at 127,021,626 bp
  • C to A, chromosome 5 at 110,665,862 bp
  • A to C, chromosome 6 at 5,913,333 bp
  • A to T, chromosome 7 at 44,550,013 bp
  • A to G, chromosome 7 at 45,722,394 bp
  • A to G, chromosome 7 at 104,925,123 bp
  • A to T, chromosome 7 at 144,091,778 bp
  • CA to CAA, chromosome 8 at 13,734,865 bp
  • A to T, chromosome 9 at 27,015,317 bp
  • A to T, chromosome 9 at 57,761,849 bp
  • A to G, chromosome 9 at 83,785,100 bp
  • T to G, chromosome 9 at 124,106,124 bp
  • A to G, chromosome 10 at 40,844,996 bp
  • G to T, chromosome 10 at 69,904,212 bp
  • A to G, chromosome 10 at 88,201,852 bp
  • A to G, chromosome 10 at 90,069,490 bp
  • A to T, chromosome 10 at 130,446,257 bp
  • T to C, chromosome 11 at 57,484,071 bp
  • T to C, chromosome 11 at 69,736,177 bp
  • C to T, chromosome 11 at 69,739,467 bp
  • A to T, chromosome 11 at 77,555,653 bp
  • G to T, chromosome 12 at 27,341,494 bp
  • A to G, chromosome 12 at 44,283,427 bp
  • T to C, chromosome 12 at 111,255,224 bp
  • T to C, chromosome 13 at 34,305,180 bp
  • T to C, chromosome 13 at 93,095,136 bp
  • A to G, chromosome 14 at 34,075,771 bp
  • T to C, chromosome 14 at 118,235,313 bp
  • C to T, chromosome 15 at 66,764,309 bp
  • G to A, chromosome 15 at 89,300,369 bp
  • C to A, chromosome 17 at 71,052,671 bp
  • T to C, chromosome 17 at 84,722,703 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6933 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045048-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.